The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP013749	Lactiplantibacillus plantarum strain KP chromosome, complete genome	3418468	52232	143573	3418468	terminase,capsid,tRNA,integrase,tail,protease,holin,portal	Lactobacillus_phage(54.39%)	112	104246:104262	151974:151990
WP_011101144.1|52232_52877_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003640983.1|53041_53719_-	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_013355247.1|53887_55870_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	29.2	4.4e-50
WP_011101143.1|56756_57803_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	41.4	1.0e-61
WP_003640979.1|57807_58263_-	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_011101142.1|58255_58834_-	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_003640977.1|58817_59543_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_003640976.1|59822_60875_+	PhnD/SsuA/transferrin family substrate-binding protein	NA	NA	NA	NA	NA
WP_022638340.1|60912_61683_+	phosphonate ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	31.8	4.9e-13
WP_022638341.1|61672_62476_+	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_003640973.1|62472_63327_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_013355242.1|63351_64149_+	phosphonoacetaldehyde hydrolase	NA	NA	NA	NA	NA
WP_013355241.1|64170_65271_+	2-aminoethylphosphonate--pyruvate transaminase	NA	NA	NA	NA	NA
WP_013355240.1|65404_66400_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	38.5	2.0e-51
WP_003640969.1|66538_67324_-	acyl-ACP thioesterase	NA	NA	NA	NA	NA
WP_013355239.1|67327_68224_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	55.7	4.4e-82
WP_003640967.1|68322_68670_-	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	33.3	2.4e-12
WP_003640966.1|68694_69714_-	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	33.5	2.1e-32
WP_003640965.1|69730_70060_-	cyclic-di-AMP receptor	NA	NA	NA	NA	NA
WP_003643941.1|70056_70722_-	dTMP kinase	NA	M1PSC7	Streptococcus_phage	52.7	1.4e-53
WP_003640957.1|71119_71371_-	YaaL family protein	NA	NA	NA	NA	NA
WP_003637790.1|71385_71985_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_003640956.1|72000_72309_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_003643940.1|72330_74028_-	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	37.0	3.9e-55
WP_003640954.1|74553_75060_-	nucleoside deaminase	NA	NA	NA	NA	NA
WP_003640953.1|75062_75671_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003640952.1|75893_76124_+	redoxin NrdH	NA	X2KRY7	Enterococcus_phage	40.0	2.8e-09
WP_013355235.1|76262_78428_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	63.3	2.2e-268
WP_003640950.1|78455_79466_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A096XT60	Enterococcus_phage	60.5	3.1e-108
WP_003640949.1|79547_80123_+	TIGR00730 family Rossman fold protein	NA	A0A1G5S9X4	Enterococcus_phage	41.7	6.4e-26
WP_022638342.1|80297_82901_-	bifunctional lysylphosphatidylglycerol flippase/synthetase MprF	NA	NA	NA	NA	NA
WP_013355233.1|83204_83873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022638343.1|83885_84815_+	DNA/RNA non-specific endonuclease	NA	NA	NA	NA	NA
WP_063491215.1|85616_86495_+	Abi family protein	NA	NA	NA	NA	NA
WP_080476963.1|86580_86790_+	hypothetical protein	NA	O48431	Lactobacillus_phage	44.8	1.7e-05
WP_063491216.1|86841_87468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063491217.1|87467_87659_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063491218.1|87847_88225_-|holin	holin	holin	A0A2H4PBB2	Lactobacillus_phage	85.4	2.8e-14
WP_063491219.1|88211_88508_-	hypothetical protein	NA	A0A1I9KK55	Lactobacillus_phage	76.5	9.9e-39
WP_187337720.1|88508_89621_-	LysM peptidoglycan-binding domain-containing protein	NA	O03950	Lactobacillus_phage	33.5	2.5e-34
WP_063491221.1|89674_89887_-	hypothetical protein	NA	A0A0A1ENR9	Lactobacillus_phage	85.2	2.1e-19
WP_063491222.1|89883_90978_-	hypothetical protein	NA	A0A1I9KKB6	Lactobacillus_phage	57.6	3.4e-36
WP_134901158.1|90995_91145_-	XkdX family protein	NA	U5U4L4	Lactobacillus_phage	56.8	3.6e-05
WP_063491223.1|91144_91456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_187337719.1|91467_93627_-	hypothetical protein	NA	M4ZSB3	Bacillus_phage	32.9	1.5e-38
WP_022638353.1|93627_93918_-	hypothetical protein	NA	O03939	Lactobacillus_phage	53.9	2.2e-11
WP_076637296.1|93895_94189_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022638355.1|94181_95300_-|tail	phage tail protein	tail	O03938	Lactobacillus_phage	93.8	1.5e-199
WP_022638356.1|95312_96122_-|tail	phage tail family protein	tail	D2KRB8	Lactobacillus_phage	41.2	9.6e-52
WP_063491224.1|96121_100978_-	peptidoglycan DD-metalloendopeptidase family protein	NA	O03937	Lactobacillus_phage	66.8	0.0e+00
WP_063491225.1|100981_101605_-	hypothetical protein	NA	O03936	Lactobacillus_phage	94.4	1.2e-102
WP_063491226.1|101610_102042_-	hypothetical protein	NA	O03935	Lactobacillus_phage	97.2	2.4e-73
WP_063491227.1|102091_102628_-	hypothetical protein	NA	O03972	Lactobacillus_phage	98.9	8.8e-94
WP_022638361.1|102660_103065_-|capsid	phage capsid protein	capsid	O03934	Lactobacillus_phage	96.3	9.0e-67
WP_022638362.1|103064_103412_-|capsid	minor capsid protein	capsid	O03933	Lactobacillus_phage	77.1	4.1e-44
WP_022638363.1|103411_103762_-|capsid	phage capsid protein	capsid	O03932	Lactobacillus_phage	92.2	1.1e-55
WP_022638364.1|103761_104190_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022638365.1|104210_105098_-	hypothetical protein	NA	U3PDP8	Lactobacillus_phage	59.4	6.1e-92
104246:104262	attL	CAGGCGTAGCGGCTACG	NA	NA	NA	NA
WP_022638367.1|105791_106055_-	hypothetical protein	NA	O03930	Lactobacillus_phage	48.1	3.4e-14
WP_022638368.1|106061_107222_-|capsid	phage capsid protein	capsid	O03929	Lactobacillus_phage	90.2	2.5e-162
WP_033607818.1|107218_108745_-|portal	phage portal protein	portal	O03928	Lactobacillus_phage	96.3	7.6e-284
WP_068874229.1|108754_110098_-|terminase	PBSX family phage terminase large subunit	terminase	O03927	Lactobacillus_phage	96.0	5.2e-260
WP_080476964.1|110078_110555_-	hypothetical protein	NA	Q597W0	Lactobacillus_virus	58.5	2.1e-38
WP_068874232.1|110700_110889_-	hypothetical protein	NA	E9LUP6	Lactobacillus_phage	85.1	2.0e-16
WP_003642805.1|111944_112406_-	transcriptional regulator	NA	D6PSV8	Lactobacillus_phage	57.0	1.1e-39
WP_022638180.1|112533_112701_-	hypothetical protein	NA	E9LUP4	Lactobacillus_phage	87.2	1.8e-13
WP_022638179.1|112697_113045_-	hypothetical protein	NA	A0A142F1A4	Bacillus_phage	43.4	4.9e-13
WP_187326027.1|113041_113407_-	hypothetical protein	NA	Q5ULS7	Lactobacillus_virus	51.9	1.0e-13
WP_022638177.1|113427_113601_-	hypothetical protein	NA	A0A2K9VC41	Lactobacillus_phage	87.7	4.7e-25
WP_022638176.1|113593_113812_-	hypothetical protein	NA	A0A2P0ZLC3	Lactobacillus_phage	90.2	1.1e-13
WP_022638175.1|113857_114253_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022638173.1|114389_114620_-	hypothetical protein	NA	O03916	Lactobacillus_phage	56.6	1.0e-19
WP_022638172.1|114616_115036_-	RusA family crossover junction endodeoxyribonuclease	NA	A8YQM5	Lactobacillus_phage	42.3	1.3e-23
WP_022638171.1|115028_115562_-	hypothetical protein	NA	O03915	Lactobacillus_phage	54.3	2.1e-39
WP_022638170.1|115558_115846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022638169.1|115842_116727_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022638168.1|116808_117774_-	hypothetical protein	NA	A6M982	Geobacillus_virus	53.6	1.0e-63
WP_022638167.1|117776_118289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027821907.1|118741_119029_+	hypothetical protein	NA	A0A2H4JEH2	uncultured_Caudovirales_phage	48.9	1.3e-22
WP_063491234.1|119279_119567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011101088.1|119572_120127_-	hypothetical protein	NA	O03909	Lactobacillus_phage	100.0	3.6e-98
WP_060417488.1|120187_120370_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062688295.1|120449_120728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154698910.1|120724_120865_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062688292.1|120922_121144_+	DUF2188 domain-containing protein	NA	E8ZD70	Streptococcus_phage	66.2	5.0e-19
WP_061468338.1|121140_121341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061468339.1|121337_121565_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011101778.1|121693_122056_+	helix-turn-helix domain-containing protein	NA	A0A2R2ZGJ3	Clostridioides_phage	48.4	1.7e-08
WP_033608843.1|122067_122481_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A0M4RD70	Bacillus_phage	32.1	1.5e-05
WP_068874234.1|122507_123380_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003644972.1|123892_125095_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A126GGK4	Streptococcus_phage	29.5	2.6e-37
WP_003637775.1|125246_125615_-	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_003643933.1|125676_126180_-	50S ribosomal protein L10	NA	NA	NA	NA	NA
WP_003640943.1|126378_127068_-	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_003640942.1|127168_127594_-	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_022638154.1|127695_128583_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003643932.1|128610_129159_-	transcription termination/antitermination protein NusG	NA	NA	NA	NA	NA
WP_003640939.1|129263_129449_-	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_003637768.1|129460_129610_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_050578344.1|129671_130274_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_003640936.1|130780_131326_-	NYN domain-containing protein	NA	NA	NA	NA	NA
WP_003640935.1|131327_132113_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_003640934.1|132084_132495_-	Mini-ribonuclease 3	NA	NA	NA	NA	NA
WP_013355229.1|132496_133909_-|tRNA	cysteine--tRNA ligase	tRNA	F1C979	Terra1_virus	27.7	1.5e-44
WP_003640932.1|134186_135677_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003640931.1|136002_137178_-	PIN/TRAM domain-containing protein	NA	NA	NA	NA	NA
WP_003643928.1|137193_138573_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_011101073.1|139620_140157_-	dUTP diphosphatase	NA	J9PV85	Bacillus_phage	46.4	1.1e-35
WP_003640927.1|140295_140592_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_003640926.1|140600_141284_+	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
WP_003643927.1|141359_142691_+	C1 family peptidase	NA	R4TV59	Phaeocystis_globosa_virus	33.3	5.4e-68
WP_033607779.1|142880_143573_-|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
151974:151990	attR	CAGGCGTAGCGGCTACG	NA	NA	NA	NA
>prophage 2
NZ_CP013749	Lactiplantibacillus plantarum strain KP chromosome, complete genome	3418468	255256	316116	3418468	bacteriocin,protease,tRNA	uncultured_Mediterranean_phage(22.22%)	55	NA	NA
WP_003643835.1|255256_256528_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	43.4	8.4e-95
WP_003642042.1|256996_258610_-	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	49.9	1.2e-143
WP_003642041.1|258782_259391_-	DNA-directed RNA polymerase subunit delta	NA	NA	NA	NA	NA
WP_003642040.1|259435_259876_-	DUF1934 domain-containing protein	NA	NA	NA	NA	NA
WP_003643833.1|260238_261171_+	lipoate--protein ligase family protein	NA	NA	NA	NA	NA
WP_169484456.1|261179_262538_+	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	32.9	5.2e-26
WP_003642037.1|262557_263367_+	sugar-phosphatase	NA	NA	NA	NA	NA
WP_022638206.1|265301_266288_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003642034.1|266370_267393_-	YdcF family protein	NA	NA	NA	NA	NA
WP_003643830.1|267681_268662_-	ribose-phosphate diphosphokinase	NA	A0A2K9L8D8	Tupanvirus	36.3	4.9e-42
WP_022638207.1|269027_269852_-	serine hydrolase	NA	NA	NA	NA	NA
WP_022638208.1|270087_271470_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A2K9L140	Tupanvirus	33.2	5.7e-28
WP_003642030.1|271538_272375_-	pur operon repressor	NA	NA	NA	NA	NA
WP_003642029.1|272867_273131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022638209.1|273145_273688_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_003642026.1|274236_274398_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068874482.1|274766_275564_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_003642023.1|275556_276255_-	ABC transporter ATP-binding protein	NA	A0A1V0SGN0	Hokovirus	27.8	1.2e-15
WP_003642022.1|276521_277466_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003643828.1|277775_278642_-	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_003642020.1|278774_279026_-	Veg family protein	NA	NA	NA	NA	NA
WP_003642019.1|279130_280021_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_022638211.1|280017_280581_-	ribonuclease M5	NA	NA	NA	NA	NA
WP_003643825.1|280567_281344_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_022638212.1|281466_282651_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_003643823.1|282883_284935_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	35.8	2.7e-90
WP_003646492.1|285256_285646_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_003642012.1|286242_287085_-	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_003642011.1|287084_287789_-	NAD-dependent protein deacylase	NA	NA	NA	NA	NA
WP_068874235.1|287810_288770_-	IpaB/EvcA family protein	NA	NA	NA	NA	NA
WP_003642009.1|288762_290037_-	hydroxymethylglutaryl-CoA reductase, degradative	NA	NA	NA	NA	NA
WP_003642008.1|290082_291000_-	Ppx/GppA family phosphatase	NA	NA	NA	NA	NA
WP_003643820.1|291168_291963_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003642006.1|291967_293101_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003643818.1|293554_294568_-|tRNA	tRNA-dihydrouridine synthase family protein	tRNA	NA	NA	NA	NA
WP_003642004.1|294680_295427_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003642003.1|295576_296473_-	ROK family protein	NA	NA	NA	NA	NA
WP_022638214.1|296593_298030_-	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	25.8	1.7e-30
WP_003643816.1|298047_299403_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_003642000.1|299625_300048_-	DUF3284 domain-containing protein	NA	NA	NA	NA	NA
WP_003641999.1|300037_300226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003641998.1|300232_301594_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_003641997.1|301666_302377_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003643815.1|302784_303801_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003643814.1|304239_305016_-	carbon-nitrogen family hydrolase	NA	NA	NA	NA	NA
WP_022638217.1|305274_307584_+	ATP-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003641993.1|307678_307882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003641992.1|308019_308706_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003641991.1|308799_309480_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003641990.1|309566_310235_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003641987.1|311081_312458_-	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_003641986.1|312473_314624_-	peptide cleavage/export ABC transporter	NA	W8CYL7	Bacillus_phage	27.9	6.1e-45
WP_003641985.1|314890_315061_+|bacteriocin	two-peptide bacteriocin plantaricin EF subunit PlnE	bacteriocin	NA	NA	NA	NA
WP_003643811.1|315085_315244_+|bacteriocin	two-peptide bacteriocin plantaricin EF subunit PlnF	bacteriocin	NA	NA	NA	NA
WP_003646470.1|315342_316116_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 3
NZ_CP013749	Lactiplantibacillus plantarum strain KP chromosome, complete genome	3418468	319545	364861	3418468	bacteriocin,protease	Paramecium_bursaria_Chlorella_virus(50.0%)	42	NA	NA
WP_003641979.1|319545_319692_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_003641977.1|320569_321316_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003641976.1|321346_322546_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_003641975.1|322663_322831_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_003641974.1|322958_323159_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_003641973.1|324020_324188_+|bacteriocin	two-peptide bacteriocin plantaricin JK subunit PlnJ	bacteriocin	NA	NA	NA	NA
WP_003641972.1|324218_324392_+|bacteriocin	two-peptide bacteriocin plantaricin JK subunit PlnK	bacteriocin	NA	NA	NA	NA
WP_003641971.1|324388_325057_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_003641969.1|325468_325672_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011100995.1|326056_327241_-	cation:proton antiporter	NA	NA	NA	NA	NA
WP_011100994.1|327285_328662_-	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
WP_003641966.1|329187_330003_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_003641965.1|330162_331035_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_022638220.1|331105_331897_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_022638221.1|331900_333055_+	MFS transporter	NA	NA	NA	NA	NA
WP_003641962.1|333058_333676_+	sugar O-acetyltransferase	NA	NA	NA	NA	NA
WP_003641960.1|334057_334333_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003641956.1|335603_336011_-	immunity 63 family protein	NA	NA	NA	NA	NA
WP_114071742.1|336087_336234_-	glycohydrolase toxin TNT-related protein	NA	NA	NA	NA	NA
WP_003641952.1|337077_337464_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003641950.1|337843_338122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003641949.1|338233_338497_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003641948.1|338540_339458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068874237.1|339454_341254_-	pre-toxin TG domain-containing protein	NA	NA	NA	NA	NA
WP_003641946.1|341255_344939_-	MucBP domain-containing protein	NA	NA	NA	NA	NA
WP_003641945.1|345525_346248_-	aquaporin family protein	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	31.9	3.2e-30
WP_022638505.1|346262_348092_-	type 1 glycerol-3-phosphate oxidase	NA	NA	NA	NA	NA
WP_003643773.1|348106_349624_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_022638504.1|350089_351421_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003641941.1|351498_352470_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.7	1.7e-23
WP_003641940.1|352470_353997_-	ABC transporter permease/substrate-binding protein	NA	NA	NA	NA	NA
WP_003646442.1|354234_354681_+	ribonuclease H	NA	NA	NA	NA	NA
WP_013355178.1|355427_356339_-	oxidoreductase	NA	NA	NA	NA	NA
WP_003646441.1|356475_357396_+	ribonucleoside hydrolase RihC	NA	NA	NA	NA	NA
WP_013355176.1|357561_358134_-	acetyl-CoA carboxylase biotin carboxyl carrier protein subunit	NA	NA	NA	NA	NA
WP_003641935.1|358237_358693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013355174.1|359290_360487_+	DUF2075 domain-containing protein	NA	NA	NA	NA	NA
WP_003641932.1|360517_361027_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_013355173.1|361139_361508_-	DUF1304 domain-containing protein	NA	NA	NA	NA	NA
WP_022638503.1|361772_363278_-	multicopper oxidase domain-containing protein	NA	NA	NA	NA	NA
WP_022638502.1|363435_364104_-	ribose 5-phosphate isomerase A	NA	NA	NA	NA	NA
WP_003643762.1|364297_364861_+|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
>prophage 4
NZ_CP013749	Lactiplantibacillus plantarum strain KP chromosome, complete genome	3418468	648879	655900	3418468	terminase,head,capsid,tail,portal	Staphylococcus_phage(40.0%)	7	NA	NA
WP_022638531.1|648879_649146_-|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_022638530.1|649556_651140_-|capsid	phage major capsid protein	capsid	A0A1J0MFW8	Staphylococcus_phage	34.3	2.5e-40
WP_022638529.1|651129_652236_-|portal	phage portal protein	portal	A0A2H4J9Q5	uncultured_Caudovirales_phage	33.6	3.2e-50
WP_022638527.1|652390_654094_-|terminase	terminase large subunit	terminase	A0A2H4JBN3	uncultured_Caudovirales_phage	41.3	4.4e-123
WP_022638526.1|654090_654564_-|terminase	phage terminase small subunit P27 family	terminase	NA	NA	NA	NA
WP_033607857.1|655179_655569_-	HNH endonuclease	NA	A0A1J0MFT4	Staphylococcus_phage	45.2	1.0e-19
WP_033607856.1|655561_655900_-|head	phage head closure protein	head	A0A2P0ZLF0	Lactobacillus_phage	34.7	7.9e-08
>prophage 5
NZ_CP013749	Lactiplantibacillus plantarum strain KP chromosome, complete genome	3418468	1560414	1568925	3418468		Synechococcus_phage(33.33%)	9	NA	NA
WP_003645861.1|1560414_1560897_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	41.0	2.3e-16
WP_011101896.1|1560880_1562011_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_003642587.1|1562013_1562745_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	M4SM18	Cyanophage	37.3	1.6e-37
WP_003642588.1|1562746_1563001_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_022638052.1|1563000_1563681_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_003645864.1|1563673_1565893_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	39.3	4.5e-144
WP_003642591.1|1565877_1567332_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.0	2.5e-50
WP_013355836.1|1567328_1568354_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	40.7	5.4e-60
WP_003645867.1|1568346_1568925_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	33.9	1.3e-21
>prophage 6
NZ_CP013749	Lactiplantibacillus plantarum strain KP chromosome, complete genome	3418468	1729882	1795680	3418468	terminase,head,capsid,transposase,integrase,tail,holin,portal	Lactobacillus_phage(56.41%)	79	1744133:1744148	1765443:1765458
WP_013355194.1|1729882_1731145_-|transposase	ISL3-like element ISP1 family transposase	transposase	NA	NA	NA	NA
WP_011101813.1|1731299_1731749_-	VOC family protein	NA	NA	NA	NA	NA
WP_003642738.1|1732809_1733397_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003642739.1|1733481_1735035_+	ABC-F family ATP-binding cassette domain-containing protein	NA	Q6DMX7	Streptococcus_phage	27.0	1.2e-39
WP_003644673.1|1735295_1736486_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_003642741.1|1736709_1736940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003642742.1|1736965_1737187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003642743.1|1737333_1737798_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_003642744.1|1738019_1738913_+	C40 family peptidase	NA	NA	NA	NA	NA
WP_003644672.1|1738979_1739843_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003642746.1|1740404_1740569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003642747.1|1740627_1741371_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_022638136.1|1741476_1742664_+	MFS transporter	NA	NA	NA	NA	NA
WP_003644671.1|1742877_1743195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003642750.1|1743270_1743831_+	ECF transporter S component	NA	NA	NA	NA	NA
1744133:1744148	attL	ATAATGGAGATGGCGA	NA	NA	NA	NA
WP_011101810.1|1744587_1745526_-	EamA family transporter	NA	NA	NA	NA	NA
WP_003646616.1|1745722_1745992_+	ACT domain-containing protein	NA	NA	NA	NA	NA
WP_003642754.1|1746001_1747345_+	PFL family protein	NA	NA	NA	NA	NA
WP_003646617.1|1747717_1748446_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	37.1	2.1e-34
WP_068874294.1|1748442_1749966_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_003642757.1|1750261_1751443_+	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	30.1	1.0e-46
WP_003642758.1|1751677_1752535_+	GRP family sugar transporter	NA	NA	NA	NA	NA
WP_068874296.1|1752755_1754108_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_063491282.1|1754220_1755489_-|integrase	site-specific integrase	integrase	A0A0P0I3D2	Lactobacillus_phage	42.7	4.3e-91
WP_063491281.1|1755837_1756548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080474029.1|1756713_1757139_-	ImmA/IrrE family metallo-endopeptidase	NA	D6PSS8	Lactobacillus_phage	46.8	6.2e-26
WP_063491280.1|1757135_1757483_-	helix-turn-helix domain-containing protein	NA	A8ASM2	Listeria_phage	38.7	1.7e-10
WP_063491279.1|1757640_1757844_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011101087.1|1757911_1758094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063491278.1|1758154_1758709_+	hypothetical protein	NA	O03909	Lactobacillus_phage	98.9	2.3e-97
WP_063491277.1|1758715_1758961_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024002536.1|1759355_1759886_+	host-nuclease inhibitor Gam family protein	NA	E9LUU0	Lactobacillus_phage	59.2	6.1e-55
WP_063491276.1|1759897_1760863_+	hypothetical protein	NA	A6M982	Geobacillus_virus	53.6	1.3e-63
WP_063491275.1|1760942_1761731_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063491274.1|1761711_1762554_+	ATP-binding protein	NA	O03914	Lactobacillus_phage	97.9	4.8e-155
WP_063491273.1|1762686_1763187_+	hypothetical protein	NA	O03915	Lactobacillus_phage	89.7	3.4e-84
WP_134901162.1|1763228_1763609_+	VRR-NUC domain-containing protein	NA	A0A0M7RDN7	Lactobacillus_phage	58.6	4.4e-23
WP_063491272.1|1763608_1763839_+	hypothetical protein	NA	O03916	Lactobacillus_phage	57.9	1.1e-21
WP_063491271.1|1763841_1764477_+	hypothetical protein	NA	E9LUN9	Lactobacillus_phage	38.6	6.4e-35
WP_134901160.1|1764489_1764669_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063491269.1|1764808_1765204_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022638176.1|1765249_1765468_+	hypothetical protein	NA	A0A2P0ZLC3	Lactobacillus_phage	90.2	1.1e-13
1765443:1765458	attR	ATAATGGAGATGGCGA	NA	NA	NA	NA
WP_022638177.1|1765460_1765634_+	hypothetical protein	NA	A0A2K9VC41	Lactobacillus_phage	87.7	4.7e-25
WP_187326027.1|1765654_1766020_+	hypothetical protein	NA	Q5ULS7	Lactobacillus_virus	51.9	1.0e-13
WP_022638179.1|1766016_1766364_+	hypothetical protein	NA	A0A142F1A4	Bacillus_phage	43.4	4.9e-13
WP_022638180.1|1766360_1766528_+	hypothetical protein	NA	E9LUP4	Lactobacillus_phage	87.2	1.8e-13
WP_003642805.1|1766655_1767117_+	transcriptional regulator	NA	D6PSV8	Lactobacillus_phage	57.0	1.1e-39
WP_022638374.1|1768030_1768582_+	hypothetical protein	NA	A8ASQ2	Listeria_phage	38.9	3.2e-22
WP_022638373.1|1768786_1768966_+	hypothetical protein	NA	E9LUP6	Lactobacillus_phage	56.4	1.4e-08
WP_022638372.1|1768934_1769213_+	hypothetical protein	NA	C9E2J2	Enterococcus_phage	59.8	3.1e-26
WP_063491267.1|1769266_1769794_+|terminase	terminase small subunit	terminase	O03926	Lactobacillus_phage	64.2	3.2e-48
WP_063491266.1|1769777_1771064_+|terminase	PBSX family phage terminase large subunit	terminase	B7T0C6	Staphylococcus_virus	49.9	2.2e-114
WP_080476969.1|1771053_1772712_+|portal	phage portal protein	portal	D2IZF6	Enterococcus_phage	32.8	9.1e-65
WP_063491265.1|1772711_1773656_+|capsid	minor capsid protein	capsid	NA	NA	NA	NA
WP_063491264.1|1773753_1774404_+	DUF4355 domain-containing protein	NA	NA	NA	NA	NA
WP_063491263.1|1774417_1775488_+	hypothetical protein	NA	A0A0S0N2Q7	Pseudomonas_phage	30.8	2.7e-33
WP_063491262.1|1775502_1775877_+|head,tail	phage head-tail connector protein	head,tail	H9A0V3	Staphylococcus_phage	38.2	9.0e-05
WP_187337711.1|1775830_1776205_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063491261.1|1776194_1776749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080476970.1|1776750_1777137_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_063491259.1|1777147_1777738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063491258.1|1777755_1778268_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063491257.1|1778336_1778573_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063492973.1|1778572_1782808_+	hypothetical protein	NA	E9LUR1	Lactobacillus_phage	31.1	5.2e-64
WP_063491256.1|1782817_1783714_+|tail	phage tail family protein	tail	A8ATA8	Listeria_phage	28.2	1.0e-17
WP_187337712.1|1783713_1784892_+|tail	phage tail protein	tail	Q9T1A5	Listeria_phage	24.5	6.3e-20
WP_063491254.1|1784888_1785146_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063491253.1|1785135_1785426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_187337713.1|1785426_1787586_+	hypothetical protein	NA	M4ZSB3	Bacillus_phage	34.0	1.3e-39
WP_063491252.1|1787597_1787909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_134901158.1|1787908_1788058_+	XkdX family protein	NA	U5U4L4	Lactobacillus_phage	56.8	3.6e-05
WP_063491251.1|1788075_1789083_+	hypothetical protein	NA	A0A2K9VCK7	Lactobacillus_phage	62.0	1.7e-37
WP_063491250.1|1789079_1789322_+	hypothetical protein	NA	A0A0A1ENR9	Lactobacillus_phage	86.4	2.2e-12
WP_063491249.1|1789333_1790506_+	LysM peptidoglycan-binding domain-containing protein	NA	E9LUR8	Lactobacillus_phage	91.3	1.0e-203
WP_063491248.1|1790506_1790803_+	hypothetical protein	NA	A0A2K9VCD4	Lactobacillus_phage	71.4	1.2e-36
WP_063491247.1|1790789_1791164_+|holin	holin	holin	A0A2K9VCG4	Lactobacillus_phage	63.8	3.3e-15
WP_063491246.1|1791395_1792310_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003646619.1|1793089_1793281_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003642761.1|1793685_1795680_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	41.3	7.2e-32
>prophage 7
NZ_CP013749	Lactiplantibacillus plantarum strain KP chromosome, complete genome	3418468	1816714	1904396	3418468	terminase,head,capsid,transposase,integrase,tail,protease,holin,portal	Lactobacillus_phage(44.78%)	115	1811324:1811383	1828304:1828376
1811324:1811383	attL	TAAGCGAGTGACGGGAATCGGACCCGCGACTACAGCTTGGAAGGCTGTCGTTTTACCACT	NA	NA	NA	NA
WP_013355755.1|1816714_1817137_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0S2SXM3	Bacillus_phage	35.1	3.0e-12
WP_013355754.1|1817151_1817655_-	helix-turn-helix transcriptional regulator	NA	S6C481	Thermus_phage	42.6	1.7e-22
WP_033099030.1|1817800_1818055_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_013355753.1|1818111_1818426_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011101085.1|1818463_1818700_-	helix-turn-helix transcriptional regulator	NA	A0A0K2CNE2	Brevibacillus_phage	30.7	8.5e-09
WP_011101086.1|1818846_1819047_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003642792.1|1819205_1819376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003642793.1|1819387_1819693_+	DUF771 domain-containing protein	NA	NA	NA	NA	NA
WP_022638124.1|1819760_1820273_+	helix-turn-helix transcriptional regulator	NA	D6PST4	Lactobacillus_phage	39.4	2.0e-23
WP_022638122.1|1820643_1821024_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022638121.1|1821026_1821914_+	recombinase RecT	NA	E9LUM3	Lactobacillus_phage	53.3	4.6e-63
WP_161325284.1|1821945_1822698_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	A0A0P0IZH9	Lactobacillus_phage	52.2	6.3e-74
WP_003642799.1|1822776_1823685_+	DnaD domain protein	NA	NA	NA	NA	NA
WP_022638119.1|1823681_1823969_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022638118.1|1823965_1824484_+	hypothetical protein	NA	O03915	Lactobacillus_phage	68.4	1.9e-53
WP_022638117.1|1824480_1824861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021356389.1|1824853_1824994_+	hypothetical protein	NA	E9LUN8	Lactobacillus_phage	96.3	3.4e-05
WP_022638116.1|1825071_1825533_+	hypothetical protein	NA	D6PSV8	Lactobacillus_phage	57.0	4.1e-39
WP_155118608.1|1826053_1826605_+	abortive infection family protein	NA	NA	NA	NA	NA
WP_063491238.1|1826756_1827959_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A126GGK4	Streptococcus_phage	29.5	1.5e-37
WP_063491237.1|1828028_1828235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161324305.1|1828406_1829111_-	Ltp family lipoprotein	NA	V9QJ01	Oenococcus_phage	41.0	3.0e-09
1828304:1828376	attR	TAAGCGAGTGACGGGAATCGGACCCGCGACTACAGCTTGGAAGGCTGTCGTTTTACCACTAAACTACACTCGC	NA	NA	NA	NA
WP_063491236.1|1829720_1830143_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0S2SXM3	Bacillus_phage	34.4	3.0e-12
WP_063204180.1|1830157_1830676_-	helix-turn-helix domain-containing protein	NA	S6C481	Thermus_phage	34.1	3.5e-15
WP_068874298.1|1830817_1831072_+	helix-turn-helix transcriptional regulator	NA	A0A2H4JFN1	uncultured_Caudovirales_phage	41.3	1.1e-06
WP_155118609.1|1831068_1831227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155118610.1|1831216_1831381_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154698910.1|1831439_1831580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062688295.1|1831576_1831855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060417488.1|1831934_1832117_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011101088.1|1832177_1832732_+	hypothetical protein	NA	O03909	Lactobacillus_phage	100.0	3.6e-98
WP_033607781.1|1832737_1833025_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_022638167.1|1833519_1834032_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068874300.1|1834034_1835000_+	hypothetical protein	NA	A6M982	Geobacillus_virus	56.2	3.9e-60
WP_068874308.1|1835079_1835985_+	DnaD domain protein	NA	NA	NA	NA	NA
WP_068874313.1|1835998_1836514_+	hypothetical protein	NA	O03915	Lactobacillus_phage	68.3	3.1e-56
WP_068874316.1|1836506_1836926_+	RusA family crossover junction endodeoxyribonuclease	NA	A8YQM5	Lactobacillus_phage	43.1	4.4e-24
WP_068874318.1|1836922_1837153_+	hypothetical protein	NA	O03916	Lactobacillus_phage	60.5	1.7e-22
WP_068874488.1|1838040_1838304_+	DUF3310 domain-containing protein	NA	A0A2P0ZL48	Lactobacillus_phage	82.3	1.4e-31
WP_068874320.1|1838403_1839000_+	hypothetical protein	NA	E9LUN9	Lactobacillus_phage	87.1	8.5e-98
WP_155118611.1|1839073_1839223_+	hypothetical protein	NA	NA	NA	NA	NA
WP_187337714.1|1839240_1839390_+	hypothetical protein	NA	O03920	Lactobacillus_phage	68.1	2.2e-10
WP_068874322.1|1839414_1839831_+	hypothetical protein	NA	A0A1I9KKG9	Lactobacillus_phage	60.9	1.0e-41
WP_068874325.1|1839903_1840149_+	DUF3850 domain-containing protein	NA	C9E2N9	Enterococcus_phage	54.1	2.0e-13
WP_068874328.1|1840376_1840685_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068874330.1|1840714_1840906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068874332.1|1840987_1841455_+	hypothetical protein	NA	B4XYT9	Lactobacillus_phage	40.8	1.3e-16
WP_068874335.1|1842510_1842714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155118612.1|1842761_1842923_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068874337.1|1842909_1843173_+	hypothetical protein	NA	A0A1S5RCN3	Lactobacillus_phage	69.8	4.8e-29
WP_068874340.1|1843212_1843728_+|terminase	terminase small subunit	terminase	O03926	Lactobacillus_phage	71.1	1.5e-50
WP_068874342.1|1843720_1845034_+|terminase	PBSX family phage terminase large subunit	terminase	D2IYW1	Enterococcus_phage	54.3	1.2e-125
WP_068874344.1|1845048_1846785_+|portal	phage portal protein	portal	D2IZF6	Enterococcus_phage	34.8	2.4e-76
WP_068874346.1|1846784_1847696_+|capsid	minor capsid protein	capsid	NA	NA	NA	NA
WP_068874348.1|1847806_1848466_+	DUF4355 domain-containing protein	NA	NA	NA	NA	NA
WP_060418034.1|1848479_1848851_+	hypothetical protein	NA	A0A0K2CNR0	Brevibacillus_phage	34.4	1.3e-08
WP_068874350.1|1848866_1849976_+|capsid	major capsid protein	capsid	A0A2H4J022	uncultured_Caudovirales_phage	40.1	3.1e-61
WP_068874352.1|1849993_1850362_+|head,tail	phage head-tail connector protein	head,tail	NA	NA	NA	NA
WP_068874354.1|1850358_1850691_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068874357.1|1850691_1851183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068874360.1|1851185_1851581_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068874362.1|1851629_1852283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027821926.1|1852311_1852830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061871561.1|1852904_1853162_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080476979.1|1853386_1857175_+	tape measure protein	NA	A0A0A7DMV4	Lactobacillus_phage	58.6	1.4e-39
WP_068874366.1|1857200_1857467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068874367.1|1857540_1858452_+|tail	phage tail family protein	tail	Q9T1A6	Listeria_phage	30.3	1.2e-18
WP_061871752.1|1858444_1859632_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_068874373.1|1859606_1859972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068874376.1|1859964_1860240_+	hypothetical protein	NA	NA	NA	NA	NA
WP_187337715.1|1860240_1862400_+	hypothetical protein	NA	M4ZSB3	Bacillus_phage	34.0	1.3e-39
WP_063491252.1|1862411_1862723_+	hypothetical protein	NA	NA	NA	NA	NA
WP_134901158.1|1862722_1862872_+	XkdX family protein	NA	U5U4L4	Lactobacillus_phage	56.8	3.6e-05
WP_063491251.1|1862889_1863897_+	hypothetical protein	NA	A0A2K9VCK7	Lactobacillus_phage	62.0	1.7e-37
WP_068874378.1|1863893_1864106_+	hypothetical protein	NA	A0A0A1ENR9	Lactobacillus_phage	83.6	1.8e-18
WP_068874490.1|1864169_1865282_+	LysM peptidoglycan-binding domain-containing protein	NA	O03950	Lactobacillus_phage	59.5	5.9e-44
WP_015380597.1|1865282_1865579_+	hypothetical protein	NA	A0A1I9KK55	Lactobacillus_phage	77.6	1.2e-39
WP_068874385.1|1865565_1865940_+|holin	holin	holin	A0A2H4PBB2	Lactobacillus_phage	87.8	4.6e-25
WP_063486137.1|1866350_1866617_+	hypothetical protein	NA	A9D9X7	Lactobacillus_prophage	47.1	3.9e-10
WP_068874386.1|1866655_1867030_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_187337716.1|1867340_1867595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033607771.1|1867704_1867884_+	hypothetical protein	NA	E9LUP6	Lactobacillus_phage	56.9	4.6e-07
WP_022638114.1|1868061_1868589_+|terminase	terminase small subunit	terminase	O03926	Lactobacillus_phage	73.1	5.0e-41
WP_022638113.1|1868578_1869817_+|terminase	PBSX family phage terminase large subunit	terminase	M1PG09	Streptococcus_phage	61.0	7.1e-139
WP_022638112.1|1869828_1871337_+|portal	phage portal protein	portal	V5US18	Oenococcus_phage	52.0	3.1e-136
WP_024971552.1|1871266_1871563_+|protease	ribosomal-processing cysteine protease Prp	protease	D2J003	Enterococcus_phage	40.2	1.1e-10
WP_013355736.1|1871709_1873395_+|capsid	minor capsid protein	capsid	V5US81	Oenococcus_phage	58.0	6.5e-119
WP_003642815.1|1873369_1873648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013355734.1|1873699_1873906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013355733.1|1874078_1874756_+	DUF4355 domain-containing protein	NA	Q6SE80	Lactobacillus_prophage	32.1	6.0e-15
WP_013355732.1|1874770_1875118_+	hypothetical protein	NA	V5UTH9	Oenococcus_phage	63.8	4.4e-30
WP_022638111.1|1875137_1876160_+|capsid	major capsid protein	capsid	V5US24	Oenococcus_phage	62.8	7.5e-118
WP_003642820.1|1876172_1876349_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013355731.1|1876360_1876693_+|head,tail	phage head-tail connector protein	head,tail	V9QJ97	Oenococcus_phage	45.3	1.8e-12
WP_003642822.1|1876692_1877040_+	hypothetical protein	NA	V5US85	Oenococcus_phage	62.3	3.2e-36
WP_013355730.1|1877041_1877593_+	HK97 gp10 family phage protein	NA	V5URV0	Oenococcus_phage	62.3	2.0e-64
WP_013355729.1|1877592_1877958_+	hypothetical protein	NA	V5UQS4	Oenococcus_phage	53.4	3.0e-29
WP_099447638.1|1878059_1878443_+|tail	phage tail protein	tail	V5USQ9	Oenococcus_phage	58.4	1.8e-37
WP_003642826.1|1878542_1878941_+	hypothetical protein	NA	V9QJA0	Oenococcus_phage	74.8	3.0e-46
WP_031275283.1|1879048_1879312_+	hypothetical protein	NA	V9QKH3	Oenococcus_phage	65.4	2.3e-23
WP_022638110.1|1879327_1885159_+|tail	phage tail protein	tail	V5URV5	Oenococcus_phage	40.9	5.0e-227
WP_099739626.1|1885202_1885535_+	hypothetical protein	NA	V5UQS8	Oenococcus_phage	73.4	2.2e-42
WP_022638109.1|1885549_1890805_+	hypothetical protein	NA	Q6SE68	Lactobacillus_prophage	59.6	1.3e-144
WP_022638108.1|1890826_1891276_+	DUF1617 family protein	NA	A0A2P0ZLE0	Lactobacillus_phage	39.9	1.8e-20
WP_021732622.1|1891278_1891713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050578343.1|1891891_1893007_+	LysM peptidoglycan-binding domain-containing protein	NA	O03950	Lactobacillus_phage	77.4	3.1e-32
WP_022638106.1|1893007_1893304_+	hypothetical protein	NA	A0A2K9VCD4	Lactobacillus_phage	74.5	6.4e-38
WP_022638105.1|1893290_1893668_+	hypothetical protein	NA	A0A2K9VCG4	Lactobacillus_phage	67.5	7.9e-17
WP_022638104.1|1894764_1895610_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022638794.1|1896178_1897030_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_003641420.1|1897252_1897645_+	YxeA family protein	NA	NA	NA	NA	NA
WP_003644665.1|1897868_1899599_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.6	2.6e-46
WP_003641422.1|1899598_1901488_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	32.1	9.4e-58
WP_003641423.1|1901502_1902474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013355994.1|1902743_1904396_+|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	41.3	1.8e-92
>prophage 8
NZ_CP013749	Lactiplantibacillus plantarum strain KP chromosome, complete genome	3418468	2730109	2742887	3418468		Lactobacillus_phage(70.0%)	11	NA	NA
WP_013355474.1|2730109_2731054_-	glycosyltransferase family 2 protein	NA	V5USA4	Oenococcus_phage	45.5	2.0e-72
WP_013355473.1|2731078_2731744_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_021356352.1|2732453_2733146_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	37.6	5.3e-35
WP_022638019.1|2733138_2734506_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	31.0	3.4e-25
WP_013355470.1|2734896_2735337_+	nucleoside 2-deoxyribosyltransferase	NA	A0A2P0ZL88	Lactobacillus_phage	97.9	1.2e-75
WP_013355469.1|2735407_2735968_-	hypothetical protein	NA	A0A2P0ZL75	Lactobacillus_phage	98.4	6.5e-100
WP_022638021.1|2736055_2738494_-	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	99.6	0.0e+00
WP_003643097.1|2738496_2739111_-	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	100.0	6.3e-112
WP_003643099.1|2739453_2740401_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	100.0	2.7e-178
WP_013355468.1|2740586_2741558_+	peptidase S41	NA	A0A2P0ZL68	Lactobacillus_phage	98.5	3.5e-181
WP_013355467.1|2741648_2742887_-	hypothetical protein	NA	A0A2P0ZL72	Lactobacillus_phage	98.7	2.4e-219
>prophage 9
NZ_CP013749	Lactiplantibacillus plantarum strain KP chromosome, complete genome	3418468	2768993	2835784	3418468	terminase,head,capsid,tRNA,integrase,tail,protease,holin,portal	Lactobacillus_phage(79.49%)	72	2790560:2790576	2830057:2830073
WP_003643128.1|2768993_2770682_-|tRNA	arginine--tRNA ligase	tRNA	A0A2I2L3K1	Orpheovirus	32.9	1.2e-75
WP_013355456.1|2770953_2771400_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003643130.1|2771788_2772034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003643131.1|2772160_2773552_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_013355455.1|2773827_2775603_-	SLC13 family permease	NA	NA	NA	NA	NA
WP_013355454.1|2776108_2777848_-	aryl-sulfate sulfotransferase	NA	NA	NA	NA	NA
WP_013355453.1|2778068_2779025_-	bifunctional oligoribonuclease/PAP phosphatase NrnA	NA	NA	NA	NA	NA
WP_013355452.1|2779014_2779638_-	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	40.6	6.3e-27
WP_134901165.1|2779640_2780741_-	sulfate adenylyltransferase	NA	A0A2P1ELS9	Moumouvirus	32.9	6.1e-49
WP_022638032.1|2780773_2782411_-	sulfotransferase family protein	NA	NA	NA	NA	NA
WP_013355448.1|2783299_2785606_+	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_003643140.1|2785619_2787476_+	bifunctional homocysteine S-methyltransferase/methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
WP_003645248.1|2787548_2787908_+	YisL family protein	NA	NA	NA	NA	NA
WP_003643142.1|2788007_2788529_-	GtrA family protein	NA	NA	NA	NA	NA
WP_003643143.1|2788634_2789648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003645249.1|2789812_2790238_+	hypothetical protein	NA	NA	NA	NA	NA
2790560:2790576	attL	CTGCCTGGGGCATAATT	NA	NA	NA	NA
WP_068874417.1|2791294_2791825_-|holin	holin	holin	E9LUS0	Lactobacillus_phage	98.9	8.5e-41
WP_003644510.1|2791836_2792100_-	hemolysin XhlA family protein	NA	E9LUR9	Lactobacillus_phage	100.0	2.0e-38
WP_068874418.1|2793139_2793499_-	hypothetical protein	NA	A0A2P0ZLF6	Lactobacillus_phage	79.0	5.0e-45
WP_181815834.1|2793482_2793644_-	hypothetical protein	NA	A0A2P0ZLG1	Lactobacillus_phage	96.2	6.8e-18
WP_068874420.1|2793647_2793890_-	hypothetical protein	NA	A0A2K9VDF6	Lactobacillus_phage	94.7	2.4e-30
WP_068874422.1|2796988_2799403_-	hypothetical protein	NA	A0A2P0ZLF8	Lactobacillus_phage	90.5	0.0e+00
WP_068874425.1|2799471_2801247_-|tail	phage tail family protein	tail	A0A2P0ZLH2	Lactobacillus_phage	96.8	0.0e+00
WP_068874427.1|2801325_2806074_-	C40 family peptidase	NA	A0A2P0ZLG0	Lactobacillus_phage	73.6	0.0e+00
WP_015640500.1|2806105_2806291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068874429.1|2806335_2806710_-|tail	phage tail assembly chaperone	tail	A0A2P0ZLH4	Lactobacillus_phage	95.2	3.5e-57
WP_068874433.1|2806782_2807436_-|tail	phage tail protein	tail	A0A2P0ZLH1	Lactobacillus_phage	95.4	5.4e-114
WP_068874435.1|2807452_2807833_-	DUF806 family protein	NA	A0A2P0ZLF4	Lactobacillus_phage	95.2	4.8e-62
WP_068874437.1|2807832_2808240_-	HK97 gp10 family phage protein	NA	A0A2P0ZLE6	Lactobacillus_phage	93.1	2.2e-65
WP_061812664.1|2808242_2808590_-|head	phage head closure protein	head	A0A2P0ZLF0	Lactobacillus_phage	73.9	4.1e-44
WP_068874440.1|2808579_2808912_-|head,tail	phage gp6-like head-tail connector protein	head,tail	E9LUQ4	Lactobacillus_phage	86.1	6.1e-45
WP_068874442.1|2808984_2810217_-|capsid	phage major capsid protein	capsid	E9LUQ3	Lactobacillus_phage	91.6	5.5e-208
WP_022638400.1|2810216_2810975_-|protease	Clp protease ClpP	protease	E9LUQ2	Lactobacillus_phage	96.0	1.2e-128
WP_068874444.1|2810952_2812146_-|portal	phage portal protein	portal	E9LUQ1	Lactobacillus_phage	98.5	3.4e-223
WP_063722563.1|2812148_2812343_-	DUF1056 family protein	NA	E9LUQ0	Lactobacillus_phage	95.3	1.8e-25
WP_068874448.1|2812332_2814231_-|terminase	terminase large subunit	terminase	E9LUP9	Lactobacillus_phage	92.6	0.0e+00
WP_016511011.1|2814240_2814696_-|terminase	phage terminase small subunit P27 family	terminase	E9LUP8	Lactobacillus_phage	96.7	3.0e-79
WP_013355635.1|2814885_2815137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068874450.1|2815154_2815424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080476972.1|2815429_2815900_-	HNH endonuclease	NA	E9LUP7	Lactobacillus_phage	94.2	1.6e-83
WP_013355638.1|2815910_2816081_-	hypothetical protein	NA	E9LUP6	Lactobacillus_phage	96.4	3.3e-23
WP_033098961.1|2816240_2817053_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021732015.1|2817631_2818057_-	RinA family transcriptional regulator	NA	E9LUP5	Lactobacillus_phage	87.2	7.2e-67
WP_022638825.1|2818214_2818412_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054598400.1|2818484_2818919_-	hypothetical protein	NA	Q5ULS7	Lactobacillus_virus	53.2	7.2e-14
WP_022638755.1|2818902_2819079_-	hypothetical protein	NA	E9LUP2	Lactobacillus_phage	81.0	8.8e-19
WP_155118607.1|2819108_2819276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022638754.1|2819450_2819609_-	hypothetical protein	NA	A0A2P0ZLB5	Lactobacillus_phage	92.3	3.9e-18
WP_022638753.1|2819601_2819910_-	hypothetical protein	NA	E9LUN7	Lactobacillus_phage	96.1	1.7e-49
WP_068874453.1|2820045_2820831_-	ATP-binding protein	NA	E9LUN6	Lactobacillus_phage	90.8	1.4e-132
WP_068874454.1|2820830_2821547_-	helix-turn-helix domain-containing protein	NA	A0A0P0I7Q1	Lactobacillus_phage	39.3	1.2e-32
WP_068874456.1|2821641_2821899_-	hypothetical protein	NA	NA	NA	NA	NA
WP_187337717.1|2821898_2822069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003644546.1|2822554_2822809_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003644547.1|2822821_2823025_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_033615377.1|2823190_2823481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068874458.1|2824021_2824351_-	DUF771 domain-containing protein	NA	E9LUT3	Lactobacillus_phage	88.1	4.6e-53
WP_068874460.1|2824443_2824653_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155118613.1|2824649_2824811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003641364.1|2824823_2825033_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068874462.1|2825044_2825779_-	ORF6C domain-containing protein	NA	A0A1P8BM06	Lactococcus_phage	45.2	1.4e-49
WP_063845781.1|2825794_2825998_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_068874463.1|2826254_2826674_+	helix-turn-helix transcriptional regulator	NA	A0A0M4QX29	Bacillus_phage	47.9	5.3e-30
WP_068874464.1|2826685_2827123_+	ImmA/IrrE family metallo-endopeptidase	NA	Q9T201	Bacillus_phage	35.2	2.3e-07
WP_068874466.1|2827180_2827930_+	ion transporter	NA	A0A1B0Y2S3	Lactobacillus_phage	53.1	1.3e-39
WP_068874469.1|2827932_2828151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068874471.1|2828803_2829940_+|integrase	site-specific integrase	integrase	E9LUS1	Lactobacillus_phage	97.6	1.4e-210
WP_022638033.1|2830586_2832854_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	31.4	2.0e-118
2830057:2830073	attR	CTGCCTGGGGCATAATT	NA	NA	NA	NA
WP_003643147.1|2832918_2833206_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013355446.1|2833320_2833833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003643149.1|2833949_2834426_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003645251.1|2835097_2835784_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 10
NZ_CP013749	Lactiplantibacillus plantarum strain KP chromosome, complete genome	3418468	2995447	3079000	3418468	terminase,head,capsid,integrase,tRNA,tail,protease,portal	Lactobacillus_phage(73.33%)	93	3023679:3023695	3072314:3072330
WP_072533917.1|2995447_2996050_+|integrase	tyrosine-type recombinase/integrase	integrase	D2XR58	Bacillus_phage	41.3	4.8e-32
WP_013355383.1|2996098_2997115_-	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	42.0	2.3e-66
WP_022638386.1|2997207_2998413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013355381.1|2998539_2998935_-	glycerol-3-phosphate cytidylyltransferase	NA	A0A1V0SGE7	Hokovirus	42.2	1.7e-17
WP_022638387.1|2998954_3000370_-	flippase	NA	NA	NA	NA	NA
WP_013355379.1|3000439_3001324_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_033098981.1|3001341_3002466_-	CDP-glycerol--glycerophosphate glycerophosphotransferase	NA	NA	NA	NA	NA
WP_013355377.1|3002455_3003520_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_013355376.1|3003564_3004341_-	DUF4422 domain-containing protein	NA	NA	NA	NA	NA
WP_022638388.1|3004349_3005630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033607823.1|3005654_3006794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013355374.1|3006780_3007383_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_013355373.1|3007406_3008042_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013355372.1|3008165_3009284_-	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	79.8	4.0e-173
WP_003643315.1|3009433_3010150_-	aquaporin family protein	NA	A0A1J0F964	Only_Syngen_Nebraska_virus	32.7	5.6e-19
WP_003643314.1|3010339_3011269_-	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_003646267.1|3011645_3012764_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A0N9R0B2	Chrysochromulina_ericina_virus	31.2	2.7e-20
WP_171831422.1|3014375_3015731_+	NADP-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_003646269.1|3015813_3016377_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003643305.1|3016810_3017251_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003643304.1|3017450_3017651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003643303.1|3017800_3018667_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_013355368.1|3018659_3019967_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_003643301.1|3020100_3020541_+	universal stress protein	NA	NA	NA	NA	NA
WP_022638390.1|3021083_3021617_-	hypothetical protein	NA	E9LUS0	Lactobacillus_phage	97.6	1.4e-35
WP_003644510.1|3021628_3021892_-	hemolysin XhlA family protein	NA	E9LUR9	Lactobacillus_phage	100.0	2.0e-38
WP_022638392.1|3022922_3023282_-	hypothetical protein	NA	A0A2P0ZLF6	Lactobacillus_phage	80.7	1.0e-45
WP_003644513.1|3023265_3023427_-	hypothetical protein	NA	A0A2P0ZLG1	Lactobacillus_phage	100.0	9.5e-20
WP_022638393.1|3023430_3023673_-	hypothetical protein	NA	A0A2P0ZLG3	Lactobacillus_phage	100.0	3.4e-29
WP_022638394.1|3023665_3026305_-	hypothetical protein	NA	A0A2P0ZLG5	Lactobacillus_phage	64.5	1.2e-130
3023679:3023695	attL	TTGGCCTCCAATTTGTT	NA	NA	NA	NA
WP_022638395.1|3026321_3028736_-|tail	phage tail protein	tail	A0A2P0ZLF8	Lactobacillus_phage	92.4	0.0e+00
WP_022638396.1|3028802_3030578_-|tail	phage tail family protein	tail	A0A2P0ZLH2	Lactobacillus_phage	90.3	1.4e-300
WP_022638397.1|3030650_3035558_-	tape measure protein	NA	E9LUR1	Lactobacillus_phage	62.9	0.0e+00
WP_016058335.1|3035570_3035762_-	hypothetical protein	NA	E9LUR0	Lactobacillus_phage	100.0	1.5e-27
WP_016058334.1|3035758_3036142_-	hypothetical protein	NA	E9LUQ9	Lactobacillus_phage	100.0	3.9e-64
WP_021732001.1|3036343_3036982_-|tail	phage tail protein	tail	E9LUQ8	Lactobacillus_phage	92.9	3.7e-107
WP_022638398.1|3036982_3037366_-	DUF806 family protein	NA	E9LUQ7	Lactobacillus_phage	96.9	1.0e-64
WP_021732003.1|3037362_3037803_-	hypothetical protein	NA	E9LUQ6	Lactobacillus_phage	97.9	3.2e-78
WP_021732004.1|3037792_3038155_-|head	phage head closure protein	head	E9LUQ5	Lactobacillus_phage	99.2	1.5e-65
WP_016058329.1|3038138_3038477_-|head,tail	phage gp6-like head-tail connector protein	head,tail	E9LUQ4	Lactobacillus_phage	100.0	7.0e-57
WP_022638399.1|3038549_3039782_-|capsid	phage major capsid protein	capsid	E9LUQ3	Lactobacillus_phage	88.0	8.5e-201
WP_022638400.1|3039781_3040540_-|protease	Clp protease ClpP	protease	E9LUQ2	Lactobacillus_phage	96.0	1.2e-128
WP_022638401.1|3040517_3041711_-|portal	phage portal protein	portal	E9LUQ1	Lactobacillus_phage	98.7	6.9e-224
WP_022638402.1|3041713_3041908_-	DUF1056 family protein	NA	E9LUQ0	Lactobacillus_phage	93.8	5.3e-25
WP_063491136.1|3041897_3043796_-|terminase	terminase large subunit	terminase	E9LUP9	Lactobacillus_phage	92.6	0.0e+00
WP_016511011.1|3043805_3044261_-|terminase	phage terminase small subunit P27 family	terminase	E9LUP8	Lactobacillus_phage	96.7	3.0e-79
WP_050578353.1|3044438_3044978_-	HNH endonuclease	NA	A0A2D1GPF4	Lactobacillus_phage	48.4	6.9e-30
WP_022638404.1|3044980_3045451_-	HNH endonuclease	NA	E9LUP7	Lactobacillus_phage	75.2	1.5e-65
WP_022638405.1|3045461_3045641_-	hypothetical protein	NA	E9LUP6	Lactobacillus_phage	67.8	4.3e-13
WP_022638406.1|3045843_3046395_-	hypothetical protein	NA	A8ASQ2	Listeria_phage	38.3	1.6e-21
WP_022638818.1|3046930_3047356_-	phage transcriptional activator RinA	NA	E9LUP5	Lactobacillus_phage	81.6	3.1e-62
WP_033607948.1|3047537_3047732_-	hypothetical protein	NA	E9LUP4	Lactobacillus_phage	52.7	8.0e-05
WP_054598401.1|3047728_3048145_-	hypothetical protein	NA	E9LUP3	Lactobacillus_phage	54.9	4.2e-35
WP_022638825.1|3048141_3048339_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054598400.1|3048411_3048846_-	hypothetical protein	NA	Q5ULS7	Lactobacillus_virus	53.2	7.2e-14
WP_022638755.1|3048829_3049006_-	hypothetical protein	NA	E9LUP2	Lactobacillus_phage	81.0	8.8e-19
WP_155118607.1|3049035_3049203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022638754.1|3049377_3049536_-	hypothetical protein	NA	A0A2P0ZLB5	Lactobacillus_phage	92.3	3.9e-18
WP_022638753.1|3049528_3049837_-	hypothetical protein	NA	E9LUN7	Lactobacillus_phage	96.1	1.7e-49
WP_022638752.1|3049972_3050758_-	ATP-binding protein	NA	E9LUN6	Lactobacillus_phage	90.0	2.2e-130
WP_022638751.1|3050757_3051465_-	conserved phage C-terminal domain-containing protein	NA	A0A0P0I7Q1	Lactobacillus_phage	59.3	1.8e-33
WP_022638750.1|3051506_3052205_-	DUF968 domain-containing protein	NA	E9LUU3	Lactobacillus_phage	92.2	3.4e-122
WP_022638749.1|3052251_3052923_-	DUF669 domain-containing protein	NA	E9LUU2	Lactobacillus_phage	87.9	2.8e-81
WP_022638748.1|3052924_3053587_-	AAA family ATPase	NA	E9LUU1	Lactobacillus_phage	97.7	1.5e-119
WP_022638747.1|3053587_3054448_-	DUF1351 domain-containing protein	NA	A0A2D1GPE4	Lactobacillus_phage	36.1	3.4e-31
WP_022638746.1|3054447_3054594_-	hypothetical protein	NA	E9LUT9	Lactobacillus_phage	87.2	1.3e-15
WP_022638745.1|3054876_3055116_-	hypothetical protein	NA	E9LUT6	Lactobacillus_phage	82.4	5.9e-34
WP_033607908.1|3055577_3055859_+	CRISPR-associated endonuclease Cas2	NA	A0A2H4JEH2	uncultured_Caudovirales_phage	42.9	1.9e-15
WP_022638743.1|3055852_3055999_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022638742.1|3056067_3056556_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022638741.1|3056533_3056740_-	hypothetical protein	NA	A0A182BQC3	Lactococcus_phage	57.4	6.0e-11
WP_022638740.1|3056769_3057522_-	phage antirepressor KilAC domain-containing protein	NA	E9LUT0	Lactobacillus_phage	96.5	6.4e-58
WP_022638739.1|3057534_3057750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022638738.1|3058009_3058339_+	helix-turn-helix transcriptional regulator	NA	A0A0P0IZG9	Lactobacillus_phage	38.7	1.8e-12
WP_033607910.1|3058369_3058759_+	ImmA/IrrE family metallo-endopeptidase	NA	D6PSS8	Lactobacillus_phage	55.8	7.1e-37
WP_022638736.1|3058822_3059398_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022638735.1|3059403_3059604_+	hypothetical protein	NA	E9LUS6	Lactobacillus_phage	98.5	3.2e-25
WP_022638734.1|3060054_3061236_+|integrase	site-specific integrase	integrase	B4XYR4	Lactobacillus_phage	37.4	1.2e-58
WP_003641354.1|3061477_3062812_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	30.9	2.9e-37
WP_003644135.1|3062824_3063832_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_003638174.1|3064018_3064219_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	71.4	3.1e-20
WP_003641352.1|3064562_3064928_+	DUF4828 domain-containing protein	NA	NA	NA	NA	NA
WP_013355365.1|3065083_3065860_-	lysozyme	NA	A0A141HSE6	Bacillus_phage	31.1	2.6e-06
WP_003644133.1|3065884_3066763_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_022638540.1|3066887_3067772_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003644132.1|3067764_3069081_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_003646275.1|3069320_3071660_-	cation-translocating P-type ATPase	NA	M1HI01	Paramecium_bursaria_Chlorella_virus	24.8	7.1e-39
WP_003641346.1|3071926_3072505_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
3072314:3072330	attR	AACAAATTGGAGGCCAA	NA	NA	NA	NA
WP_022638541.1|3072958_3074332_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	F5CA72	Streptococcus_phi-m46.1-like_phage	52.2	5.5e-124
WP_003641344.1|3074665_3075688_-	diacylglycerol kinase	NA	A0A1V0SBJ0	Catovirus	26.5	2.6e-17
WP_003641343.1|3075792_3077217_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_003644129.1|3077216_3078680_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_003641341.1|3078679_3079000_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
>prophage 1
NZ_CP013750	Lactiplantibacillus plantarum strain KP plasmid unnamed1, complete sequence	127346	59062	100641	127346	holin,transposase,protease	Streptococcus_phage(33.33%)	37	NA	NA
WP_063485943.1|59062_59698_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_068874499.1|60965_63119_+	type IA DNA topoisomerase	NA	A0A1X9I6W8	Streptococcus_phage	46.9	5.2e-105
WP_063491173.1|63137_63599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068874505.1|63588_63996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068874506.1|64105_65071_+	DUF3991 and TOPRIM domain-containing protein	NA	NA	NA	NA	NA
WP_063493016.1|65067_65262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068874507.1|65264_65870_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068874509.1|65872_67657_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A2C9CXH0	Yersinia_phage	35.9	1.8e-82
WP_062690082.1|67722_68037_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068874510.1|68130_70233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063489405.1|70242_71022_+	class A sortase	NA	NA	NA	NA	NA
WP_063489404.1|71050_74038_+	isopeptide-forming domain-containing fimbrial protein	NA	NA	NA	NA	NA
WP_063489403.1|74114_74411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068874511.1|74512_75427_-	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_021353390.1|76486_76576_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_068874513.1|76873_78028_-	S-adenosyl-L-homocysteine hydrolase	NA	NA	NA	NA	NA
WP_014940864.1|78017_78680_-	HD domain-containing protein	NA	A0A1Q1PP35	Noumeavirus	31.4	5.0e-14
WP_063489446.1|78679_80071_-	MFS transporter	NA	NA	NA	NA	NA
WP_021731144.1|80349_80463_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_063489400.1|80695_81844_+	FRG domain-containing protein	NA	NA	NA	NA	NA
WP_063489399.1|82011_82506_-	HXXEE domain-containing protein	NA	NA	NA	NA	NA
WP_063489398.1|82595_83156_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_080476989.1|83734_83842_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_063489397.1|84970_85486_-	HXXEE domain-containing protein	NA	NA	NA	NA	NA
WP_063489396.1|85577_85904_-	DUF4828 domain-containing protein	NA	NA	NA	NA	NA
WP_068874514.1|85909_87745_-	DHA2 family efflux MFS transporter permease subunit	NA	A0A0M3UL24	Mycobacterium_phage	25.4	3.5e-25
WP_050676723.1|87916_88468_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016526703.1|89848_90148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013356270.1|90149_91010_-	ParA family protein	NA	F0PIG8	Enterococcus_phage	40.2	1.7e-43
WP_010014534.1|93690_93972_+	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_033098918.1|93961_94468_+	mRNA interferase PemK	NA	NA	NA	NA	NA
WP_013356307.1|94457_94736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003555660.1|94758_94986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068874515.1|95237_97298_+	MobA/MobL family protein	NA	NA	NA	NA	NA
WP_080476987.1|97417_98929_+	topoisomerase C-terminal repeat-containing protein	NA	A0A1X9I6W8	Streptococcus_phage	46.0	2.0e-106
WP_057138795.1|99050_99266_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021353390.1|100551_100641_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
>prophage 1
NZ_CP013751	Lactiplantibacillus plantarum strain KP plasmid unnamed2, complete sequence	78406	4049	67414	78406	holin,protease,transposase	Streptococcus_phage(55.56%)	54	NA	NA
WP_022638817.1|4049_5279_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	48.8	1.9e-88
WP_080476990.1|5637_6546_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063491182.1|6857_7148_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063491181.1|7149_7650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068874551.1|7667_8135_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063491179.1|8106_10296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063491178.1|10297_10930_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_187337722.1|11141_11219_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_063491176.1|11571_11811_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063491175.1|11829_12738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068874553.1|13779_15933_+	type IA DNA topoisomerase	NA	A0A1X9I6W8	Streptococcus_phage	47.9	9.6e-107
WP_063491173.1|15951_16413_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063491172.1|16402_16810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063492928.1|16919_17885_+	DUF3991 and TOPRIM domain-containing protein	NA	NA	NA	NA	NA
WP_063485948.1|17881_18076_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063485949.1|18078_18681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068874555.1|18683_20468_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A223W0B1	Agrobacterium_phage	33.4	1.3e-80
WP_022638680.1|20533_20848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022638679.1|20943_23037_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022638678.1|23046_23787_+	class A sortase	NA	NA	NA	NA	NA
WP_022638677.1|23817_26811_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022638676.1|26886_27183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063485848.1|37067_37505_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_022638658.1|37882_38458_+	recombinase family protein	NA	A0A1J1J8Z4	Escherichia_phage	44.6	1.6e-32
WP_022638657.1|38567_39425_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_033607892.1|40307_40781_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022638655.1|41373_41655_+	BRCT domain-containing protein	NA	NA	NA	NA	NA
WP_063492998.1|41837_44552_+	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_022638653.1|44681_44900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068874557.1|44900_46712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022638651.1|46793_47192_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022638650.1|47184_47505_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022638649.1|47497_48799_-	Y-family DNA polymerase	NA	M1Q231	Streptococcus_phage	39.3	8.4e-82
WP_022638648.1|49079_49367_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099735248.1|49350_50304_-	AAA family ATPase	NA	A0A1X9I765	Streptococcus_phage	28.3	3.5e-21
WP_022638646.1|51043_52576_+	primase C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_068874559.1|52884_55506_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022638644.1|55831_56158_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_022638643.1|56235_56799_-	cadmium resistance transporter	NA	NA	NA	NA	NA
WP_022638642.1|57083_57467_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022638641.1|57438_58098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022638640.1|58113_60066_+	conjugation-related ATPase	NA	NA	NA	NA	NA
WP_063491305.1|60067_60274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063491307.1|60274_61438_+	CHAP domain-containing protein	NA	A0A0A0RSI6	Bacillus_phage	35.5	4.5e-10
WP_063491308.1|61450_62080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022638636.1|62100_62256_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063491310.1|62373_62613_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068874561.1|62638_63367_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063491314.1|63924_64884_+	DUF3102 domain-containing protein	NA	A0A2H4JAH5	uncultured_Caudovirales_phage	39.7	2.0e-32
WP_022638631.1|64880_65093_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063491315.1|65094_65310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063491317.1|65309_65615_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063491319.1|65604_66030_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_022638817.1|66184_67414_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	48.8	1.9e-88
