The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP029397	Acinetobacter defluvii strain WCHA30 chromosome, complete genome	3353930	187745	228032	3353930	integrase,coat	Leptospira_phage(14.29%)	30	186791:186807	225876:225892
186791:186807	attL	TTGTATATTTTGAGGAA	NA	NA	NA	NA
WP_065993195.1|187745_188990_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_065993196.1|188967_190569_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_065993197.1|190561_192535_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065993199.1|192537_192951_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065993201.1|193082_195770_+	class I SAM-dependent DNA methyltransferase	NA	Q6NE04	Leptospira_phage	37.9	9.6e-157
WP_065993202.1|195780_197712_+	DNA helicase	NA	NA	NA	NA	NA
WP_065993204.1|197715_198003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065993206.1|198006_198921_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_065993208.1|198941_200300_+	SIR2 family protein	NA	NA	NA	NA	NA
WP_065993210.1|200296_202372_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_065993212.1|204382_207370_+	type III restriction-modification system endonuclease	NA	Q71TG1	Escherichia_phage	46.4	1.0e-228
WP_026444247.1|207418_208918_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065993213.1|208925_209930_+	Fic family protein	NA	D7RWK9	Brochothrix_phage	25.1	8.1e-08
WP_058644667.1|209955_211152_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	42.0	8.8e-78
WP_065993214.1|211548_213429_+	potassium transporter Kup	NA	A7K9V6	Acanthocystis_turfacea_chlorella_virus	33.5	3.2e-74
WP_065993215.1|213517_213880_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065993216.1|214164_215250_+	DNA/RNA non-specific endonuclease	NA	X2KR27	Campylobacter_phage	32.3	1.6e-09
WP_065993218.1|215321_215567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065993220.1|215652_216345_-	aquaporin Z	NA	NA	NA	NA	NA
WP_065993222.1|216400_217435_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_065993224.1|217628_218255_+	sterol desaturase family protein	NA	NA	NA	NA	NA
WP_065993225.1|219008_219443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065993227.1|219564_220845_+	3-deoxy-D-manno-octulosonic acid transferase	NA	NA	NA	NA	NA
WP_065993228.1|220841_221555_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_065993229.1|221528_222512_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_065993230.1|222970_224914_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	39.5	6.6e-91
WP_065993231.1|225433_226057_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
225876:225892	attR	TTCCTCAAAATATACAA	NA	NA	NA	NA
WP_065993232.1|226357_226888_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_065993233.1|226912_227470_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_065993235.1|227501_228032_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
>prophage 2
NZ_CP029397	Acinetobacter defluvii strain WCHA30 chromosome, complete genome	3353930	1234228	1242474	3353930		Acinetobacter_phage(62.5%)	11	NA	NA
WP_065991941.1|1234228_1235098_-	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	39.6	2.3e-43
WP_065991942.1|1235260_1235500_-	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_004822370.1|1235892_1236105_+	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	50.0	1.9e-12
WP_065991943.1|1236224_1237376_+	ATP-dependent RNA helicase RhlB	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	31.0	1.1e-48
WP_065991944.1|1237607_1237967_-	DUF861 domain-containing protein	NA	NA	NA	NA	NA
WP_171488605.1|1238023_1238572_-	GTP cyclohydrolase I FolE	NA	A0A0P0HSD2	Acinetobacter_phage	91.8	6.6e-89
WP_065991947.1|1238662_1239358_-	Smr/MutS family protein	NA	A0A0P0IDT4	Acinetobacter_phage	76.6	1.4e-91
WP_065991949.1|1239473_1239896_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065991951.1|1240009_1240816_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	85.0	4.2e-124
WP_065991952.1|1240846_1241893_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	84.5	2.3e-159
WP_171488606.1|1241898_1242474_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	92.7	8.5e-103
>prophage 3
NZ_CP029397	Acinetobacter defluvii strain WCHA30 chromosome, complete genome	3353930	1365128	1371836	3353930		Tetraselmis_virus(16.67%)	9	NA	NA
WP_065992441.1|1365128_1366106_+	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	31.4	3.1e-36
WP_065992172.1|1366109_1366649_+	HAD-IIIA family hydrolase	NA	NA	NA	NA	NA
WP_065992173.1|1366692_1367238_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_065992176.1|1367224_1367791_+	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
WP_065992182.1|1367790_1368537_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.7	4.7e-21
WP_065992184.1|1368669_1369266_+	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	37.4	3.4e-22
WP_065992186.1|1369258_1369873_+	acyltransferase	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	46.0	8.4e-08
WP_065992188.1|1370005_1370848_+	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	33.9	1.0e-35
WP_065992190.1|1371170_1371836_-	O-methyltransferase	NA	S5YRC3	Mycobacterium_phage	38.8	4.5e-31
>prophage 4
NZ_CP029397	Acinetobacter defluvii strain WCHA30 chromosome, complete genome	3353930	1614679	1621909	3353930	tRNA	uncultured_Caudovirales_phage(50.0%)	8	NA	NA
WP_065993896.1|1614679_1615384_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	72.2	6.7e-94
WP_065993895.1|1615380_1616430_-	ACR3 family arsenite efflux transporter	NA	NA	NA	NA	NA
WP_065993894.1|1616440_1616914_-	arsenate reductase ArsC	NA	A0A2H4J8A6	uncultured_Caudovirales_phage	50.3	1.4e-34
WP_065993987.1|1616928_1617252_-	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	54.3	4.9e-23
WP_065993893.1|1617415_1618831_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	64.2	1.3e-128
WP_065993892.1|1618833_1619091_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	48.2	2.4e-17
WP_065993891.1|1619939_1620809_+	NLPA lipoprotein	NA	NA	NA	NA	NA
WP_065993890.1|1620883_1621909_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	38.5	1.1e-31
>prophage 5
NZ_CP029397	Acinetobacter defluvii strain WCHA30 chromosome, complete genome	3353930	1686663	1756621	3353930	transposase,capsid,terminase,protease,tRNA	Acinetobacter_phage(31.43%)	83	NA	NA
WP_081406152.1|1686663_1687050_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_065995301.1|1687433_1687802_+	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	36.2	4.7e-14
WP_065995302.1|1687846_1688197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065995303.1|1688235_1688520_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065995317.1|1688570_1688882_+	TusE/DsrC/DsvC family sulfur relay protein	NA	A0A2H4J8B6	uncultured_Caudovirales_phage	42.2	1.1e-16
WP_081406153.1|1689453_1690032_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A2H4J538	uncultured_Caudovirales_phage	50.9	1.4e-44
WP_065995304.1|1690571_1692434_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.3	1.0e-27
WP_065995305.1|1692433_1692883_+	MaoC family dehydratase	NA	NA	NA	NA	NA
WP_065995306.1|1692974_1694006_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_065995307.1|1694083_1694458_+	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_065995308.1|1694635_1695811_+	MFS transporter	NA	NA	NA	NA	NA
WP_065995309.1|1695860_1696070_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065995310.1|1696268_1696736_-|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
WP_065995319.1|1696971_1697187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065995311.1|1697365_1699354_-	transketolase	NA	NA	NA	NA	NA
WP_065995320.1|1699725_1700079_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	59.4	6.5e-29
WP_065995312.1|1700176_1702453_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	43.1	8.1e-165
WP_065995313.1|1702462_1702879_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.2e-12
WP_065995314.1|1702897_1703650_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171488613.1|1703729_1704785_-	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
WP_065995315.1|1705217_1706384_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	60.9	2.3e-123
WP_109849248.1|1706431_1707736_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_065995032.1|1707909_1708224_+	monooxygenase	NA	NA	NA	NA	NA
WP_065995033.1|1708302_1708554_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065995112.1|1708845_1709061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065995034.1|1709023_1709653_-	LysE family transporter	NA	NA	NA	NA	NA
WP_065995035.1|1710384_1711062_+	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_065995036.1|1711333_1711681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065995037.1|1711673_1713116_+|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	49.5	1.9e-127
WP_065995038.1|1713841_1714582_-	N-acetylmuramoyl-L-alanine amidase	NA	U5PZX6	Acinetobacter_phage	67.3	2.2e-58
WP_065995040.1|1714935_1715166_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065995041.1|1715158_1717054_-	hypothetical protein	NA	B7SYF1	Stenotrophomonas_phage	29.2	8.0e-33
WP_065995042.1|1717069_1717474_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065995043.1|1717470_1717827_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065995044.1|1717816_1719037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065995045.1|1719089_1720709_-	hypothetical protein	NA	A0A0M4U447	Ralstonia_phage	43.3	1.0e-113
WP_065995046.1|1720716_1722705_-	hypothetical protein	NA	A0A0M4U447	Ralstonia_phage	32.3	1.6e-87
WP_065995047.1|1722694_1723117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065995048.1|1723117_1727749_-	tape measure protein	NA	A0A1C6ZDP8	Pseudomonas_phage	36.7	6.3e-39
WP_065995049.1|1727812_1728328_-	Rha family transcriptional regulator	NA	A0A0K0N5U2	Gordonia_phage	40.4	1.1e-11
WP_065995050.1|1728470_1728932_-	PH domain-containing protein	NA	A0A249Y2R5	Serratia_phage	38.7	6.1e-19
WP_065995051.1|1729022_1729304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065995052.1|1729363_1729942_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148245833.1|1729963_1730143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065995054.1|1730279_1731014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171488555.1|1731006_1731180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065995055.1|1731188_1731620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065995056.1|1731603_1732161_-	phage virion morphogenesis protein	NA	A0A2H4J9E5	uncultured_Caudovirales_phage	44.7	3.5e-21
WP_065995057.1|1732168_1732609_-	DUF1320 domain-containing protein	NA	A0A2I7S9E9	Vibrio_phage	37.6	3.5e-08
WP_065995058.1|1732616_1732901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065995059.1|1732910_1733987_-|capsid	major capsid protein	capsid	V5Q8X6	Xylella_phage	25.7	5.8e-20
WP_065995060.1|1733999_1734377_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065995061.1|1734380_1735337_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065995062.1|1735391_1735766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065995063.1|1735827_1736070_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065995064.1|1736071_1737274_-|capsid	minor capsid protein	capsid	A0A2K9VGX3	Faecalibacterium_phage	34.7	1.1e-24
WP_065995065.1|1737273_1738731_-	DUF935 family protein	NA	A0A2H4JHL1	uncultured_Caudovirales_phage	43.9	1.6e-102
WP_065995066.1|1738746_1740423_-|terminase	terminase	terminase	A0A2H4JGD8	uncultured_Caudovirales_phage	82.3	4.9e-284
WP_065995067.1|1740419_1740920_-	DUF2280 domain-containing protein	NA	A0A1B1P9C2	Acinetobacter_phage	62.9	1.6e-33
WP_065995068.1|1740978_1741617_-	hypothetical protein	NA	A0A0P0I449	Acinetobacter_phage	82.5	1.2e-105
WP_065995069.1|1741978_1742221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065995070.1|1742413_1742854_-	hypothetical protein	NA	A0A0P0IRI6	Acinetobacter_phage	71.6	2.9e-55
WP_065995071.1|1744009_1744516_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065995113.1|1745430_1745934_-	hypothetical protein	NA	A0A0P0IY98	Acinetobacter_phage	71.4	6.1e-65
WP_065995072.1|1745939_1746335_-	hypothetical protein	NA	A0A0P0I8E8	Acinetobacter_phage	58.8	9.5e-37
WP_065995073.1|1746312_1746513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065995075.1|1747017_1747200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065995076.1|1747196_1747706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065995077.1|1747698_1748457_-	ATP-binding protein	NA	A0A0D4DBZ2	Acinetobacter_phage	49.4	1.7e-58
WP_065995078.1|1748456_1749362_-	hypothetical protein	NA	A0A068C8G6	Acinetobacter_phage	51.5	5.9e-42
WP_065995079.1|1749472_1749820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065995080.1|1749829_1750093_-	hypothetical protein	NA	A0A0R6PIJ0	Moraxella_phage	50.7	8.3e-13
WP_065995081.1|1750209_1750983_+	S24 family peptidase	NA	A0A2H4JAJ5	uncultured_Caudovirales_phage	76.4	5.6e-25
WP_065995082.1|1751024_1751228_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065995083.1|1751272_1751545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065995084.1|1751548_1751785_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065995085.1|1751868_1752228_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065995086.1|1752415_1753372_+	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	28.0	2.1e-13
WP_148245834.1|1753661_1753916_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089024802.1|1753899_1754196_-	hypothetical protein	NA	A0A0P0I4B0	Acinetobacter_phage	45.9	3.9e-11
WP_065995088.1|1754335_1754797_+	hypothetical protein	NA	A0A0N7IRE9	Acinetobacter_phage	42.6	6.5e-21
WP_065995089.1|1754796_1755561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065995090.1|1755571_1756621_+	hypothetical protein	NA	A0A0D4DBR8	Acinetobacter_phage	36.3	2.6e-49
>prophage 6
NZ_CP029397	Acinetobacter defluvii strain WCHA30 chromosome, complete genome	3353930	1946772	1991223	3353930	protease,transposase,integrase	uncultured_virus(33.33%)	43	1953327:1953342	1999797:1999812
WP_171488561.1|1946772_1947162_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_089024773.1|1948502_1949948_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_065993062.1|1950030_1951002_-	D-glycerate dehydrogenase	NA	M1HTA3	Paramecium_bursaria_Chlorella_virus	25.8	1.6e-13
WP_065992864.1|1951036_1951717_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065993060.1|1951846_1953736_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
1953327:1953342	attL	GCTGTTAAAGCATTTA	NA	NA	NA	NA
WP_065992863.1|1953860_1955405_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	40.1	1.1e-85
WP_065992862.1|1955429_1956020_-	CvpA family protein	NA	NA	NA	NA	NA
WP_065992861.1|1956021_1957026_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_065992859.1|1957116_1957596_-	type II secretion system protein M	NA	NA	NA	NA	NA
WP_065992857.1|1957595_1958738_-	general secretion pathway protein GspL	NA	NA	NA	NA	NA
WP_065992853.1|1958777_1959233_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_065992848.1|1959305_1960379_-	NAD(P)H-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_065992846.1|1960439_1961018_-	nitroreductase	NA	NA	NA	NA	NA
WP_065992841.1|1961223_1961604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065992840.1|1962047_1962977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065992838.1|1963101_1965114_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_065992835.1|1965182_1966577_-	MFS transporter	NA	NA	NA	NA	NA
WP_065992833.1|1966601_1967867_-	outer membrane porin, OprD family	NA	NA	NA	NA	NA
WP_065992831.1|1968198_1968591_-	DUF4440 domain-containing protein	NA	NA	NA	NA	NA
WP_065992828.1|1968755_1969673_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_065992827.1|1969791_1970901_+	muconate cycloisomerase	NA	NA	NA	NA	NA
WP_065992825.1|1970915_1971206_+	muconolactone Delta-isomerase	NA	NA	NA	NA	NA
WP_065992823.1|1971407_1972094_+	3-oxoacid CoA-transferase subunit A	NA	NA	NA	NA	NA
WP_065992821.1|1972111_1972762_+	CoA transferase subunit B	NA	NA	NA	NA	NA
WP_065992818.1|1973011_1974217_+	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_065992817.1|1974282_1975059_+	3-oxoadipate enol-lactonase	NA	NA	NA	NA	NA
WP_065992816.1|1975658_1976240_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001055589.1|1976528_1976912_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_000618091.1|1976908_1977244_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_001094417.1|1977318_1978965_+|transposase	IS66-like element ISAba16 family transposase	transposase	A0A218MNE7	uncultured_virus	54.4	1.5e-144
WP_065992815.1|1979379_1980309_-	FRG domain-containing protein	NA	NA	NA	NA	NA
WP_065992813.1|1981664_1982390_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065992812.1|1982731_1983940_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	2.4e-51
WP_065992811.1|1984278_1986417_-	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_065992806.1|1986413_1986683_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065992804.1|1986684_1986981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065992803.1|1986983_1987328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065992802.1|1987324_1987540_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_065992798.1|1987536_1988250_-	Rha family transcriptional regulator	NA	Q8HA02	Enterobacteria_phage	47.7	2.0e-32
WP_065992794.1|1988246_1988630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065992793.1|1988632_1988842_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_065992790.1|1988956_1989868_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065992789.1|1990017_1991223_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JAT5	uncultured_Caudovirales_phage	33.6	7.6e-53
1999797:1999812	attR	GCTGTTAAAGCATTTA	NA	NA	NA	NA
>prophage 7
NZ_CP029397	Acinetobacter defluvii strain WCHA30 chromosome, complete genome	3353930	2006719	2025189	3353930	tail,integrase,head	uncultured_Caudovirales_phage(28.57%)	26	2005540:2005557	2028340:2028357
2005540:2005557	attL	TAAAACTTGTTTTTGTTT	NA	NA	NA	NA
WP_065992767.1|2006719_2007223_-	hypothetical protein	NA	A0A218MN86	uncultured_virus	37.1	2.1e-17
WP_065992766.1|2007225_2007675_-	GNAT family N-acetyltransferase	NA	A0A2H4P7M4	Pseudomonas_phage	24.8	7.3e-09
WP_065992765.1|2007677_2009759_-	carbohydrate-binding protein	NA	A0A2H4J6H2	uncultured_Caudovirales_phage	28.9	4.1e-62
WP_081406070.1|2009758_2010325_-	hypothetical protein	NA	A0A2H4JID6	uncultured_Caudovirales_phage	42.3	1.2e-32
WP_065992762.1|2010382_2010703_-	hypothetical protein	NA	A0A1I9KG26	Aeromonas_phage	46.1	3.2e-11
WP_065992761.1|2010767_2011670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065992757.1|2012330_2012771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065992756.1|2012767_2014408_-|head,tail	head-tail connector protein	head,tail	A0A2H4J3N6	uncultured_Caudovirales_phage	45.0	1.6e-122
WP_065992755.1|2014408_2014588_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065992752.1|2014589_2014916_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065992750.1|2014962_2015604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065992748.1|2015652_2015913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065993058.1|2015909_2016320_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065992745.1|2016365_2016872_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A1X9SFE9	Acinetobacter_phage	48.2	5.8e-23
WP_065992744.1|2016955_2017591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065992743.1|2017583_2018576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065993056.1|2018572_2018848_-	hypothetical protein	NA	A0A2H4J8L7	uncultured_Caudovirales_phage	46.6	8.7e-05
WP_065992740.1|2018859_2019174_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065992739.1|2019185_2019386_-	hypothetical protein	NA	A0A0P0IKT3	Acinetobacter_phage	42.6	2.6e-06
WP_065992738.1|2019503_2020259_+	LexA family transcriptional regulator	NA	A0A0R6PIM7	Moraxella_phage	32.1	3.9e-31
WP_065992735.1|2020816_2021002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065992733.1|2021005_2021260_+	hypothetical protein	NA	K4HYN5	Acinetobacter_phage	51.2	1.4e-17
WP_065992731.1|2021256_2022138_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	G8EY36	Synechococcus_phage	29.2	2.9e-17
WP_065992729.1|2022187_2023738_+	hypothetical protein	NA	J7HXB6	Pseudomonas_phage	52.7	1.1e-61
WP_065992728.1|2023850_2024144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065992727.1|2024172_2025189_-|integrase	site-specific integrase	integrase	A0A0R6PHH4	Moraxella_phage	46.5	6.6e-74
2028340:2028357	attR	TAAAACTTGTTTTTGTTT	NA	NA	NA	NA
>prophage 8
NZ_CP029397	Acinetobacter defluvii strain WCHA30 chromosome, complete genome	3353930	2099393	2110024	3353930	integrase	uncultured_Caudovirales_phage(50.0%)	10	2093334:2093349	2108157:2108172
2093334:2093349	attL	ATGATGCTGCAAATGC	NA	NA	NA	NA
WP_065992612.1|2099393_2101010_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4J8L8	uncultured_Caudovirales_phage	46.8	1.8e-94
WP_065992610.1|2101014_2101524_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065992608.1|2101520_2102105_-	glycoside hydrolase	NA	A0A2H4JAK8	uncultured_Caudovirales_phage	71.5	9.0e-76
WP_042890510.1|2102104_2102485_-	hypothetical protein	NA	A0A2H4JFC0	uncultured_Caudovirales_phage	62.5	8.0e-33
WP_065992607.1|2102625_2103207_+	DUF4124 domain-containing protein	NA	A0A2K8IBL8	Pseudomonas_phage	46.8	3.6e-08
WP_065992606.1|2103238_2103556_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_165382487.1|2103666_2103822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065992604.1|2103900_2104191_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065992602.1|2104187_2104910_+	phage antirepressor KilAC domain-containing protein	NA	G0ZND1	Cronobacter_phage	46.0	9.2e-38
WP_171488618.1|2104948_2110024_-	PLxRFG domain-containing protein	NA	A0A1Y0T2N3	Pseudomonas_phage	27.7	1.5e-105
2108157:2108172	attR	GCATTTGCAGCATCAT	NA	NA	NA	NA
>prophage 9
NZ_CP029397	Acinetobacter defluvii strain WCHA30 chromosome, complete genome	3353930	2113096	2122869	3353930		Pseudomonas_virus(33.33%)	6	NA	NA
WP_065992599.1|2113096_2115028_-	hypothetical protein	NA	Q5QF54	Pseudomonas_virus	32.9	1.5e-42
WP_065992597.1|2115096_2115387_-	hypothetical protein	NA	A0A0P0IKW9	Acinetobacter_phage	47.9	1.1e-13
WP_065992596.1|2115535_2116354_+	ORF6C domain-containing protein	NA	A0A0P0J0J7	Acinetobacter_phage	41.9	1.8e-29
WP_065992594.1|2116401_2118912_-	hypothetical protein	NA	L7THA5	Pseudomonas_virus	40.9	6.2e-41
WP_065992591.1|2118913_2120254_-	hypothetical protein	NA	A0A0U1VZM6	Pseudomonas_phage	54.8	3.2e-44
WP_065992590.1|2120250_2122869_-	hypothetical protein	NA	A0A2K8HNU9	Pseudomonas_phage	50.8	9.7e-263
>prophage 10
NZ_CP029397	Acinetobacter defluvii strain WCHA30 chromosome, complete genome	3353930	2130642	2141922	3353930	terminase	Pseudomonas_phage(50.0%)	12	NA	NA
WP_065992569.1|2130642_2131029_-	hypothetical protein	NA	A0A0U1UNR7	Pseudomonas_phage	87.7	2.1e-33
WP_065992568.1|2131009_2131207_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065992567.1|2131300_2131975_-	hypothetical protein	NA	A0A0U1UNR8	Pseudomonas_phage	55.5	4.4e-66
WP_065992566.1|2131974_2132868_-	hypothetical protein	NA	A0A0U1UNM5	Pseudomonas_phage	41.2	9.0e-51
WP_065992561.1|2132939_2133413_-	hypothetical protein	NA	A0A0U1W0G3	Pseudomonas_phage	48.1	2.4e-26
WP_065992555.1|2133477_2134767_-	DUF4043 family protein	NA	L7TIC0	Pseudomonas_virus	61.6	2.4e-153
WP_065992553.1|2134793_2135840_-	hypothetical protein	NA	A0A0U1T6E0	Pseudomonas_phage	53.9	1.9e-68
WP_065993045.1|2135978_2136173_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065992551.1|2136220_2137108_-	hypothetical protein	NA	A0A2H4J3Y5	uncultured_Caudovirales_phage	63.0	3.8e-33
WP_065992550.1|2137169_2139473_-	hypothetical protein	NA	Q5QF74	Pseudomonas_virus	64.8	2.3e-292
WP_065992549.1|2139482_2141147_-|terminase	terminase	terminase	Q5QF75	Pseudomonas_virus	63.4	3.1e-214
WP_065992543.1|2141235_2141922_-	hypothetical protein	NA	G8C7P2	Escherichia_phage	40.9	5.1e-30
>prophage 11
NZ_CP029397	Acinetobacter defluvii strain WCHA30 chromosome, complete genome	3353930	2147872	2157038	3353930		Moraxella_phage(14.29%)	14	NA	NA
WP_065992515.1|2147872_2148598_+	helix-turn-helix transcriptional regulator	NA	A0A0R6PKV4	Moraxella_phage	45.9	1.3e-52
WP_065992513.1|2148627_2149212_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010112842.1|2149373_2149703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065992511.1|2149756_2150581_+	DUF2303 family protein	NA	NA	NA	NA	NA
WP_065992509.1|2150674_2151115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065992507.1|2151116_2151503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065992505.1|2151499_2151715_+	hypothetical protein	NA	A0A0B5A2Q3	Yersinia_phage	53.5	5.3e-18
WP_065992503.1|2151716_2152250_+	hypothetical protein	NA	A0A059VFZ8	Pseudomonas_phage	38.7	2.3e-25
WP_065992501.1|2152260_2153247_+	YqaJ viral recombinase family protein	NA	A6XMH8	Bacillus_virus	38.4	3.0e-47
WP_065992499.1|2153258_2154272_+	recombinase RecT	NA	G9L6A2	Escherichia_phage	59.8	3.0e-58
WP_065992497.1|2154325_2155840_+	ATP-dependent helicase	NA	A0A075DXT4	Acinetobacter_phage	36.4	3.5e-71
WP_065992495.1|2155827_2156145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171488563.1|2156190_2156757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065992494.1|2156756_2157038_+	pyocin activator PrtN family protein	NA	A0A2H4JC88	uncultured_Caudovirales_phage	47.7	2.9e-16
>prophage 1
NZ_CP029389	Acinetobacter defluvii strain WCHA30 plasmid p1_010030, complete sequence	76885	40544	53154	76885		Xanthomonas_citri_phage(10.0%)	18	NA	NA
WP_065994824.1|40544_40814_-	hypothetical protein	NA	K7ZPX9	Xanthomonas_citri_phage	51.1	2.1e-19
WP_171488520.1|41057_41231_-	hypothetical protein	NA	A0A1J0MGN0	Acinetobacter_phage	45.6	3.4e-07
WP_065994747.1|41227_42211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065994749.1|42740_43154_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065994750.1|43296_44205_-	replication initiation protein	NA	A0A218MNI2	uncultured_virus	35.9	6.1e-47
WP_065994751.1|44925_45123_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065994752.1|45236_45731_-	hypothetical protein	NA	A0A141HRY5	Bacillus_phage	52.6	4.9e-06
WP_065994753.1|45734_46331_-	hypothetical protein	NA	Q5QF30	Pseudomonas_virus	41.1	3.3e-33
WP_065994754.1|46364_46793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065994755.1|46793_47762_-	ATP-binding protein	NA	A0A2I7RA97	Vibrio_phage	29.1	1.3e-18
WP_065994756.1|47763_48783_-	hypothetical protein	NA	A0A140G6L9	Arthrobacter_phage	34.4	3.4e-06
WP_065994757.1|48828_49140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081406126.1|49319_50060_+	XRE family transcriptional regulator	NA	E5AGE6	Erwinia_phage	22.0	1.0e-07
WP_065994759.1|50297_50477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065994760.1|50551_51139_+	ERF family protein	NA	NA	NA	NA	NA
WP_065994761.1|51524_52160_+	ParA family protein	NA	B0ZSI1	Halomonas_phage	29.6	3.8e-11
WP_065994762.1|52174_52450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065994825.1|52488_53154_+	recombinase family protein	NA	A0A1L2JY12	Aeribacillus_phage	32.4	1.8e-24
>prophage 1
NZ_CP029396	Acinetobacter defluvii strain WCHA30 plasmid pOXA58_010030, complete sequence	355358	35400	84164	355358	integrase,transposase	Staphylococcus_phage(25.0%)	49	78045:78104	84294:84734
WP_000743272.1|35400_36333_-|transposase	IS5-like element IS17 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	42.3	3.4e-61
WP_065995615.1|36832_37264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065995446.1|37875_40092_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065995445.1|40088_42335_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005006108.1|43141_43510_-	hypothetical protein	NA	A0A0A7HAZ6	Arthrobacter_phage	36.1	3.6e-06
WP_005028515.1|43506_44622_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065995444.1|45976_47620_-	acyl-CoA synthetase	NA	A0A2H4PQM9	Staphylococcus_phage	26.1	2.1e-37
WP_089024811.1|47739_48829_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_063454684.1|49018_49750_+	type I-E CRISPR-associated protein Cas6/Cse3/CasE	NA	NA	NA	NA	NA
WP_065995442.1|49826_50909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005006095.1|51122_51467_+	hypothetical protein	NA	A0A1L2CU84	Pectobacterium_phage	51.3	2.9e-05
WP_005028520.1|51466_51736_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005006087.1|51815_52142_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_065995441.1|52328_53153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005006083.1|53380_53809_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005006080.1|53808_54702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005006077.1|54743_55169_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005028524.1|55283_55757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035272626.1|55748_56009_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087548153.1|56537_57612_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.6	3.0e-45
WP_065995440.1|58198_58654_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005006071.1|58851_59064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005006069.1|59133_59892_+	Fic family protein	NA	NA	NA	NA	NA
WP_005006063.1|60036_60600_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065995439.1|60643_61174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024160756.1|61426_62269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024160757.1|62281_62596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065995438.1|62668_63145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024160758.1|63321_64419_+	hypothetical protein	NA	H7BVI4	unidentified_phage	28.5	4.2e-42
WP_024160759.1|64576_64915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024160760.1|64984_65482_-	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_005006045.1|65634_66069_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031944366.1|66142_66631_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024160762.1|66831_67362_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024160763.1|67582_68224_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024160765.1|70387_70996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001988464.1|71028_72054_-|transposase	IS30-like element ISAba125 family transposase	transposase	W5R8L2	Staphylococcus_phage	38.1	1.2e-51
WP_000422636.1|72133_72913_-	aminoglycoside O-phosphotransferase APH(3')-VIa	NA	E4ZFP6	Streptococcus_phage	35.1	1.5e-30
WP_001988464.1|73013_74039_-|transposase	IS30-like element ISAba125 family transposase	transposase	W5R8L2	Staphylococcus_phage	38.1	1.2e-51
WP_058952573.1|74378_75527_+	hypothetical protein	NA	I6XKU1	Burkholderia_virus	28.3	1.8e-27
WP_033917496.1|75904_76330_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033917495.1|77644_78073_+	hypothetical protein	NA	NA	NA	NA	NA
78045:78104	attL	TGTCTTTGCACATTAAAGACTTAAACTGATGAATCATAAAATCAATAACTTACATTAGGT	NA	NA	NA	NA
WP_001381192.1|78894_79887_+	TniB family NTP-binding protein	NA	NA	NA	NA	NA
WP_000376623.1|79855_80356_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000259031.1|80483_81323_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000679427.1|81316_81664_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_003159191.1|81832_82387_-	aminoglycoside N-acetyltransferase AAC(6')-Ib4	NA	NA	NA	NA	NA
WP_001749986.1|82525_82978_-	NAD(+)--rifampin ADP-ribosyltransferase Arr-3	NA	NA	NA	NA	NA
WP_000845054.1|83150_84164_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	6.1e-72
84294:84734	attR	TGTCTTTGCACATTAAAGACTTAAACTGATGAATCATAAAATCAATAACTTACATTAGGTATGATTCAGTAAATTTACATTATAGTTCTAAACTCAATGAACTTTGAGTTTAGATAACCAATCCATTTATGACATAATAGTTGTAAATTTACTTATGTTTGAGTTTACCTATTCCAAATATCCAATAAGTAAATAAAACGGTGATTGCAAGTGATATAAAAATGACTATTGGGGATGGTACTTGCATTGGACTCAACCAAAATCCAAATAAAATACATGCAACAAATGCACTGCTACAAAGAAACAACTTAAAAAATACCACAAGTATTGAATCTGATTTTTTCGTAATATTCATTCAAACTTCCTCTTTGAGTTTACAACTATATTGTTAAAGTTTAGAACATTAATGTCATTTTTGAGACTTTAATGGTCAGTCACAGC	NA	NA	NA	NA
>prophage 2
NZ_CP029396	Acinetobacter defluvii strain WCHA30 plasmid pOXA58_010030, complete sequence	355358	163852	312089	355358	transposase	Escherichia_phage(21.74%)	113	NA	NA
WP_089024817.1|163852_164981_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	30.3	1.2e-20
WP_047471805.1|165108_166965_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005028671.1|167062_167545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047471802.1|167553_168342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005028673.1|168295_168868_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005005806.1|169140_169572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047471799.1|169581_176838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065995267.1|177097_184384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065995268.1|184592_185834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005028684.1|185846_187037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005028686.1|187042_187879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005028689.1|187891_188854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005028691.1|188879_189686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005028693.1|189689_190118_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005028694.1|190186_191080_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065995269.1|191082_195489_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058952558.1|195801_202434_-	strawberry notch C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_005005782.1|202465_204100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005005780.1|205792_206269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005005779.1|206436_208227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005005776.1|208219_208822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065995270.1|208923_209793_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005005771.1|210478_211609_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005005767.1|211616_212129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005005764.1|212194_212848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065995271.1|213012_213435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005005759.1|213440_213950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005005757.1|213959_214448_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005005756.1|214440_215220_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_005028393.1|215235_216171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005005752.1|217608_217908_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005005750.1|218083_218446_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044432037.1|218506_219253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044432035.1|219352_219706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043041616.1|219781_220300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043041615.1|220390_221713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043041614.1|221714_222482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042892771.1|222488_222872_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065995525.1|222890_224531_+	hypothetical protein	NA	A0A1U9AJC4	Stx1_converting_phage	35.2	2.0e-27
WP_005005742.1|224789_225566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005005740.1|226460_231686_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_005005738.1|231689_233066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005028412.1|234279_234606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005006366.1|234752_236378_-	SAVED domain-containing protein	NA	NA	NA	NA	NA
WP_089024817.1|236821_237950_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	30.3	1.2e-20
WP_005006360.1|238157_239816_-	ThiF family adenylyltransferase	NA	NA	NA	NA	NA
WP_005006358.1|239825_240839_-	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_001067790.1|241078_241783_+|transposase	IS6-like element IS1008 family transposase	transposase	A0A077SL39	Escherichia_phage	84.5	5.1e-118
WP_079863305.1|242069_243242_-	MCA family class C beta-lactamase	NA	NA	NA	NA	NA
WP_020846983.1|243494_244820_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_002002480.1|245405_246248_+	carbapenem-hydrolyzing class D beta-lactamase OXA-58	NA	NA	NA	NA	NA
WP_081406170.1|247218_247602_+	AraC family ligand binding domain-containing protein	NA	NA	NA	NA	NA
WP_000182043.1|247689_248943_+|transposase	IS256 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	46.5	9.2e-94
WP_000447788.1|249483_250089_+	LysE family translocator	NA	NA	NA	NA	NA
WP_008942541.1|250223_251549_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_000438825.1|251805_252093_+	BrnT family toxin	NA	NA	NA	NA	NA
WP_004728120.1|252079_252394_+	BrnA antitoxin family protein	NA	NA	NA	NA	NA
WP_000172759.1|252482_253013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008942541.1|253205_254531_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_000286964.1|254650_254953_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A141GEX6	Brucella_phage	49.0	9.5e-21
WP_000985609.1|254953_255235_+	putative addiction module antidote protein	NA	A4JWV1	Burkholderia_virus	43.3	5.7e-12
WP_001180106.1|255314_255734_-	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_000897307.1|255873_256194_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000369781.1|256186_256459_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_081406156.1|256549_257875_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_000052512.1|258438_259914_+	ABC-F type ribosomal protection protein Msr(E)	NA	A0A1B0RXA0	Streptococcus_phage	59.0	2.3e-160
WP_000155092.1|259969_260854_+	Mph(E) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_015060246.1|261043_261655_-	recombinase family protein	NA	NA	NA	NA	NA
WP_033917576.1|261910_262873_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	33.5	9.1e-33
WP_043041662.1|262885_263965_-	two-component sensor histidine kinase AdeS	NA	W8CYF6	Bacillus_phage	28.0	2.7e-25
WP_033917517.1|263954_264686_-	efflux system response regulator transcription factor AdeR	NA	NA	NA	NA	NA
WP_033917516.1|264824_266012_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_033917518.1|266011_269122_+	AdeB/AdeJ family multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	24.4	9.4e-63
WP_033917515.1|269201_270599_+	AdeC/AdeK/OprM family multidrug efflux complex outer membrane factor	NA	NA	NA	NA	NA
WP_033917554.1|270827_272342_+	MFS transporter	NA	NA	NA	NA	NA
WP_001067784.1|272775_273480_-|transposase	IS6-like element IS1006 family transposase	transposase	A0A077SL39	Escherichia_phage	85.8	1.9e-120
WP_058952605.1|274291_274996_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	83.6	2.8e-116
WP_019838318.1|275309_276401_-	NAD(P)-dependent alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	28.0	2.1e-30
WP_081316864.1|276473_277910_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_020753573.1|277842_279048_-|transposase	ISL3 family transposase	transposase	A9YX10	Burkholderia_phage	58.6	4.2e-112
WP_020753574.1|279040_280306_-	CmlA/FloR family chloramphenicol efflux MFS transporter	NA	S4TR35	Salmonella_phage	29.0	3.2e-25
WP_158660397.1|280773_281670_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_065995367.1|281870_283160_+	salicylate 1-monooxygenase	NA	NA	NA	NA	NA
WP_033917443.1|283259_284180_+	catechol 1,2-dioxygenase	NA	NA	NA	NA	NA
WP_019838314.1|284448_285801_+	MFS transporter	NA	NA	NA	NA	NA
WP_019838313.1|285850_286744_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005093359.1|287172_287646_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005093361.1|287639_288824_-	ThiF family adenylyltransferase	NA	NA	NA	NA	NA
WP_005093363.1|288798_289554_-	multiubiquitin domain-containing protein	NA	NA	NA	NA	NA
WP_033917444.1|289652_293036_-	UvrD-helicase domain-containing protein	NA	G3MA40	Bacillus_virus	26.3	1.9e-37
WP_033917445.1|293037_293604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005093369.1|293603_294380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067783.1|294691_295396_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	84.5	2.3e-118
WP_000993245.1|296653_296866_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_001087807.1|296931_297168_-	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_033917457.1|297164_297530_-	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_033917456.1|297570_298197_-	organomercurial lyase MerB	NA	NA	NA	NA	NA
WP_033917455.1|298236_299871_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.2	2.2e-39
WP_000522996.1|299909_300335_-	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_032490691.1|300362_300638_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_065995582.1|300651_301002_-	mercuric ion transporter MerT	NA	NA	NA	NA	NA
WP_001166626.1|301073_301529_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_033917453.1|304298_304865_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	83.5	1.7e-47
WP_033917452.1|305062_306409_-	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.3	8.5e-37
WP_010591735.1|306614_306851_-	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_026040425.1|306847_307195_-	mercuric resistance transcriptional repressor protein MerD	NA	NA	NA	NA	NA
WP_005028429.1|307212_307563_+	mercuric ion transporter MerT	NA	NA	NA	NA	NA
WP_005028432.1|307576_307855_+	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_033917451.1|308041_309751_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.2	2.8e-37
WP_033869423.1|309786_310440_+	phenylmercury resistance protein MerG	NA	NA	NA	NA	NA
WP_171026923.1|310535_311162_+	organomercurial lyase MerB	NA	NA	NA	NA	NA
WP_010591498.1|311158_311338_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001067790.1|311384_312089_+|transposase	IS6-like element IS1008 family transposase	transposase	A0A077SL39	Escherichia_phage	84.5	5.1e-118
