The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP012375	Microcystis aeruginosa NIES-2481 chromosome, complete genome	4293006	1763986	1819034	4293006	transposase,tRNA,protease	Agrobacterium_phage(20.0%)	50	NA	NA
WP_046661787.1|1763986_1764523_-|protease	aspartyl protease	protease	NA	NA	NA	NA
WP_002798810.1|1764606_1764948_-	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
WP_046661788.1|1765129_1766656_+	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_066029753.1|1766948_1768250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002740194.1|1768448_1768877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002793040.1|1768898_1769483_-	pseudouridine synthase	NA	NA	NA	NA	NA
WP_046661790.1|1769642_1770431_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_066029754.1|1771357_1773457_+	protein kinase	NA	M1HGF9	Acanthocystis_turfacea_Chlorella_virus	22.7	1.5e-08
WP_061432967.1|1773850_1774045_+	type II toxin-antitoxin system VapB family antitoxin	NA	NA	NA	NA	NA
WP_002803697.1|1774041_1774455_+	PIN domain nuclease	NA	NA	NA	NA	NA
WP_066029755.1|1774438_1774792_-	DUF5615 family PIN-like protein	NA	NA	NA	NA	NA
WP_002752166.1|1774788_1775025_-	DUF433 domain-containing protein	NA	NA	NA	NA	NA
WP_002797375.1|1775220_1775394_+	type II toxin-antitoxin system VapB family antitoxin	NA	NA	NA	NA	NA
WP_066029756.1|1775462_1777373_-	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_002758604.1|1777446_1778217_-	nickel pincer cofactor biosynthesis protein LarB	NA	A0A288TYA6	Enterococcus_phage	46.0	1.4e-20
WP_066029757.1|1778390_1780139_-	ribonuclease J	NA	NA	NA	NA	NA
WP_066029758.1|1780381_1781275_-	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_066029759.1|1781499_1782537_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_046661798.1|1782861_1784259_+	trigger factor	NA	NA	NA	NA	NA
WP_002797385.1|1784550_1785252_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	57.1	2.9e-52
WP_046661801.1|1785262_1786597_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	55.9	3.0e-135
WP_004160464.1|1786618_1786828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046661802.1|1786805_1787663_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_103672700.1|1787678_1787903_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_071846438.1|1788842_1789619_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
WP_046661804.1|1789878_1790073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046663662.1|1790416_1793131_+	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	32.3	1.8e-54
WP_046661805.1|1793164_1794859_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_046661806.1|1794938_1795676_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_046661807.1|1795779_1795965_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002738203.1|1796409_1796772_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002737941.1|1796731_1797022_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046661808.1|1797175_1798279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046661809.1|1798303_1799473_-	aminoglycoside phosphotransferase family protein	NA	NA	NA	NA	NA
WP_046661810.1|1800144_1801095_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_046661811.1|1801367_1802099_+	glutathione peroxidase	NA	A0A1D8KSL1	Synechococcus_phage	54.9	2.7e-45
WP_046661812.1|1802312_1802846_+	DNA starvation/stationary phase protection protein Dps	NA	NA	NA	NA	NA
WP_046663665.1|1802889_1804173_-	protein kinase	NA	NA	NA	NA	NA
WP_002731861.1|1804785_1804971_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103672701.1|1805247_1805481_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_066029760.1|1806011_1807829_-	DUF4101 domain-containing protein	NA	A0A2H4UVE2	Bodo_saltans_virus	26.5	1.2e-12
WP_046661814.1|1808328_1809111_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_002738764.1|1811163_1811526_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_046661816.1|1811578_1812241_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_046661818.1|1814152_1814773_+	PEP-CTERM sorting domain-containing protein	NA	NA	NA	NA	NA
WP_002739211.1|1814863_1815001_-	photosystem II reaction center protein K	NA	NA	NA	NA	NA
WP_046661819.1|1815051_1816176_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	43.8	1.8e-80
WP_046661820.1|1816270_1816732_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004163379.1|1816943_1817546_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	59.5	9.0e-55
WP_066029761.1|1817603_1819034_-|transposase	transposase	transposase	A0A191SB13	Nostoc_phage	50.5	4.7e-102
>prophage 2
NZ_CP012375	Microcystis aeruginosa NIES-2481 chromosome, complete genome	4293006	1837898	1877906	4293006	integrase,transposase,protease	Clostridium_phage(28.57%)	37	1861327:1861386	1885881:1886637
WP_066029764.1|1837898_1839179_+|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
WP_066029765.1|1839325_1839853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066029766.1|1840364_1841180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046661838.1|1841574_1842276_-	DUF4276 family protein	NA	NA	NA	NA	NA
WP_066029767.1|1842286_1843714_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_002781641.1|1844116_1844647_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	31.1	3.2e-11
WP_066029768.1|1844944_1845238_-	(2Fe-2S) ferredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_081310263.1|1845424_1846126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066029770.1|1846214_1846556_+	thioredoxin fold domain-containing protein	NA	A0A1J0GW78	Streptomyces_phage	39.5	1.0e-10
WP_066029771.1|1846821_1847478_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_066029772.1|1847491_1848250_+	protein phosphatase 2C domain-containing protein	NA	NA	NA	NA	NA
WP_002770523.1|1848339_1848633_+	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_066029773.1|1848629_1848965_+	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_046660511.1|1849762_1850752_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_046661847.1|1853226_1853979_-	TVP38/TMEM64 family protein	NA	NA	NA	NA	NA
WP_066029774.1|1854243_1855629_+	cytochrome P450	NA	A0A0B5IYC9	Pandoravirus	25.5	1.2e-12
WP_066029775.1|1855714_1856698_+	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_066029776.1|1856741_1857200_+	DUF29 domain-containing protein	NA	NA	NA	NA	NA
WP_066029777.1|1857216_1857681_+	DUF29 domain-containing protein	NA	NA	NA	NA	NA
WP_046661850.1|1858110_1858374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066029778.1|1858372_1858882_+	ricin-type beta-trefoil lectin domain protein	NA	NA	NA	NA	NA
WP_046661851.1|1859109_1859556_+	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_046661852.1|1859542_1859755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046661853.1|1860277_1860520_+	DUF433 domain-containing protein	NA	NA	NA	NA	NA
WP_046663670.1|1860603_1860987_+	DUF433 domain-containing protein	NA	NA	NA	NA	NA
WP_046661854.1|1860965_1861349_+	hypothetical protein	NA	NA	NA	NA	NA
1861327:1861386	attL	GGCGTTGCATAATAGAGATATGAATGGAGGAAATCAAAATGCAATGCCCTGAATGTAAAT	NA	NA	NA	NA
WP_103672714.1|1861364_1862058_+|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_080949805.1|1862588_1862897_-	ASCH domain-containing protein	NA	A0A068CCC0	Rhizobium_phage	46.7	3.3e-05
WP_046661856.1|1864237_1865200_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_046661857.1|1866254_1869275_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046661858.1|1869434_1871669_-|protease	M6 family metalloprotease domain-containing protein	protease	A0A1L2BY89	Clostridium_phage	52.9	2.8e-154
WP_046661859.1|1871740_1872064_-	hypothetical protein	NA	A0A1L2BY89	Clostridium_phage	50.0	3.1e-17
WP_066029779.1|1872444_1874289_-	alpha-amylase	NA	NA	NA	NA	NA
WP_052734173.1|1875143_1875416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080694069.1|1875420_1875858_+	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_071846442.1|1876026_1876398_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046661862.1|1876793_1877906_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0R8V9X2	Thermobifida_phage	59.9	6.4e-123
1885881:1886637	attR	GGCGTTGCATAATAGAGATATGAATGGAGGAAATCAAAATGCAATGCCCTGAATGTAAATCTACCCATATCCGTAAAAATGGCATCAATAAACAAGGTAAACAAAATCATATTTGTGTAACCTGTGGCCGTCAATTTATTAATAACTATGAAAAACAGAAAGGCTATGACGAAAAAACGAAGCGAGAATGCCTAACTGCCTATGTTAATGGGATGGGATTTAGAGGAATAGAAAGGCTAAAGGGAGTTCATCATACGACCGTAATTAATTGGGTAAAATCTGTGGGAGAATTATTGCCAGTCGCCTATGACCCAGAAACAATTCCTGAAGTAGGGGAACTGGATGAATTGGAAACCTTTGTTGGCTCAAAAAAAACAAAATCTGGGTGTGGACAGCCGTTGACCACTTTAAAAAAGGAATTTTAGGTTGGGTAATCGGAGACCATAGTAGCGAAACGTTTCGCCCATTATGGGAATTAGTTAAGTCTTGGGGATGCTATTTTTATGTGAGTGATGGATGGTCAGTTTATCCATGTTTTATAGCAGAGGGCGACCATATAATTAGTAAGACTTATATGACCAGAGTAGAGGGTGAGAACACACGTTTAAGACATTATCTAGCCCGATTGCATCGCAAAACACTCTGCTATTCTAAGTCTACAGAAATGTTAGGATACTCTATTCGTTTATTAATTCATTATCTGAAGTTTCAAGAAGTGCCTATTCCTTACTGATTCATAGCTTAATTCAGCAACGCC	NA	NA	NA	NA
>prophage 3
NZ_CP012375	Microcystis aeruginosa NIES-2481 chromosome, complete genome	4293006	1947734	1996211	4293006	transposase	Cedratvirus(11.11%)	53	NA	NA
WP_046661918.1|1947734_1948628_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_046661919.1|1949154_1949934_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_046661920.1|1949975_1950503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046661921.1|1950872_1951328_+	shikimate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_046661922.1|1951385_1952927_+	protein kinase	NA	A0A285Q1R7	Cedratvirus	28.9	3.5e-10
WP_052734174.1|1952975_1953788_-	rhodanese-related sulfurtransferase	NA	NA	NA	NA	NA
WP_046661924.1|1954545_1955541_-	DNA (cytosine-5-)-methyltransferase	NA	Q6DMX0	Streptococcus_phage	38.5	5.1e-55
WP_046661926.1|1955766_1956003_-	DUF4926 domain-containing protein	NA	NA	NA	NA	NA
WP_002764286.1|1956015_1956336_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002743274.1|1956385_1956580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002800319.1|1956573_1956774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149039044.1|1956777_1956903_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_046661927.1|1956989_1957781_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_046661928.1|1959318_1959705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046661929.1|1959852_1961964_-	TIGR00300 family protein	NA	NA	NA	NA	NA
WP_046661930.1|1962137_1963901_-	SWIM zinc finger domain-containing protein	NA	NA	NA	NA	NA
WP_046661931.1|1964016_1964298_+	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_046661932.1|1964311_1965004_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_046661933.1|1965059_1965908_-	M28 family peptidase	NA	NA	NA	NA	NA
WP_066029788.1|1966017_1967394_+	flavin monoamine oxidase family protein	NA	A0A0H3TLT2	Faustovirus	39.5	3.0e-05
WP_066029789.1|1967479_1970005_-	NTP transferase domain-containing protein	NA	I7I009	Enterobacteria_phage	30.9	1.6e-12
WP_043998683.1|1970211_1970403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002795807.1|1970943_1971219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046661936.1|1971560_1972109_-	RDD domain-containing protein	NA	NA	NA	NA	NA
WP_066029790.1|1972317_1972677_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066029791.1|1972724_1973882_+	8-amino-7-oxononanoate synthase	NA	D2TEZ5	Emiliania_huxleyi_virus	30.5	1.6e-39
WP_066029792.1|1973991_1975230_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	G3MB42	Bacillus_virus	38.0	7.5e-64
WP_046661939.1|1975201_1975795_-|transposase	IS607 family transposase	transposase	F9VHY9	Thermus_phage	58.5	3.9e-50
WP_071846449.1|1975861_1976044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046661940.1|1976030_1976273_-	antitoxin family protein	NA	NA	NA	NA	NA
WP_046661941.1|1976661_1977090_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002795799.1|1977082_1977298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046661942.1|1977567_1977972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046661943.1|1978071_1978461_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_002739406.1|1978453_1978693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046661944.1|1979041_1980493_-	ATP-dependent DNA helicase RecQ	NA	F2NZ48	Diadromus_pulchellus_ascovirus	35.6	5.7e-47
WP_046661945.1|1980721_1980907_+	DUF3285 domain-containing protein	NA	NA	NA	NA	NA
WP_046661946.1|1980918_1981431_+	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_046661947.1|1981459_1981948_+	diacylglycerol kinase family protein	NA	NA	NA	NA	NA
WP_002738935.1|1982551_1982791_+	DUF4327 family protein	NA	NA	NA	NA	NA
WP_046661948.1|1983019_1984210_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_046661949.1|1984496_1985777_+	AAA family ATPase	NA	C7BGE8	Burkholderia_phage	21.9	3.1e-12
WP_046661950.1|1985773_1986406_+	TIGR02646 family protein	NA	NA	NA	NA	NA
WP_162496089.1|1987005_1988706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046661952.1|1988644_1988950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004163638.1|1989146_1989296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066029793.1|1989375_1989756_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046661954.1|1989815_1990181_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046661955.1|1990612_1991599_+	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_081310265.1|1991595_1991826_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_066029794.1|1991837_1993955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066029795.1|1994031_1995369_+	proton extrusion protein PcxA	NA	NA	NA	NA	NA
WP_066029796.1|1995404_1996211_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP012375	Microcystis aeruginosa NIES-2481 chromosome, complete genome	4293006	3493464	3547960	4293006	transposase,protease	Bacteriophage(12.5%)	57	NA	NA
WP_066030081.1|3493464_3494724_-|transposase	transposase	transposase	A0A1L2BWU7	Bacteriophage	46.6	9.0e-89
WP_103672723.1|3494872_3495205_+|transposase	IS200/IS605 family transposase	transposase	A0A7E6	Microcystis_virus	51.0	2.7e-21
WP_066030083.1|3495249_3496344_-	heat-inducible transcriptional repressor HrcA	NA	NA	NA	NA	NA
WP_046662987.1|3496494_3496833_-	rhodanese-related sulfurtransferase	NA	NA	NA	NA	NA
WP_002782697.1|3497042_3497270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046662988.1|3497269_3497719_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_066030084.1|3497942_3500966_+	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	30.9	8.6e-21
WP_046662990.1|3500985_3501240_+	MoaD/ThiS family protein	NA	NA	NA	NA	NA
WP_046662991.1|3501309_3503592_+	single-stranded-DNA-specific exonuclease RecJ	NA	A0A1W6JL19	Lactococcus_phage	28.1	2.2e-29
WP_002782691.1|3503647_3504595_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_046662992.1|3504769_3505759_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_046662993.1|3505896_3506187_+	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_046662994.1|3506176_3506530_+	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_046662995.1|3506741_3507011_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_046662996.1|3507045_3507435_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_008196984.1|3507630_3508551_+	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_046662997.1|3508578_3510069_+|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_002800640.1|3510248_3510647_+	DUF4164 domain-containing protein	NA	NA	NA	NA	NA
WP_046662998.1|3510756_3511335_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_052734193.1|3511429_3511852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012264300.1|3511921_3512380_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_046663000.1|3512479_3513064_+	chorismate-binding protein	NA	C7BVI4	Synechococcus_phage	35.3	7.0e-20
WP_046663001.1|3513086_3513887_+	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_046663002.1|3514025_3514580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002782546.1|3514580_3514898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066030085.1|3515017_3515911_-	beta-carotene hydroxylase	NA	NA	NA	NA	NA
WP_004163265.1|3516074_3516494_-	transcriptional regulator	NA	A0A222YXG1	Escherichia_phage	34.4	1.3e-07
WP_066030086.1|3516477_3516777_-	type II toxin-antitoxin system HigB family toxin	NA	F5A3A2	Riemerella_phage	36.8	3.0e-11
WP_066030087.1|3517177_3517741_+	PEP-CTERM sorting domain-containing protein	NA	NA	NA	NA	NA
WP_162496092.1|3518015_3518153_-	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_066030088.1|3518142_3518364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066030089.1|3518865_3523440_+	glutamate synthase large subunit	NA	NA	NA	NA	NA
WP_066030257.1|3523536_3524688_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052275296.1|3524872_3525112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052275297.1|3525111_3525540_+	putative toxin-antitoxin system toxin component, PIN family	NA	NA	NA	NA	NA
WP_066030090.1|3525608_3525773_+	DUF4926 domain-containing protein	NA	NA	NA	NA	NA
WP_002791634.1|3525868_3526093_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066030091.1|3526082_3526505_+	putative toxin-antitoxin system toxin component, PIN family	NA	NA	NA	NA	NA
WP_066030092.1|3526565_3526826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046663009.1|3526894_3527230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046663010.1|3527226_3527643_+	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_071846486.1|3527759_3528308_-	HEAT repeat domain-containing protein	NA	NA	NA	NA	NA
WP_002754005.1|3530675_3531020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046663011.1|3531211_3531946_-	D-alanyl-D-alanine carboxypeptidase family protein	NA	NA	NA	NA	NA
WP_046663012.1|3531977_3533369_-	NAD-dependent malic enzyme	NA	NA	NA	NA	NA
WP_046663013.1|3533567_3534518_+	prolyl aminopeptidase	NA	NA	NA	NA	NA
WP_080949779.1|3536257_3537208_+|transposase	IS630 family transposase	transposase	A0A2H4UV16	Bodo_saltans_virus	29.2	1.0e-20
WP_046663015.1|3538165_3539179_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046663016.1|3539428_3540361_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_066030093.1|3540589_3541642_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_066030094.1|3541634_3542729_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_066030095.1|3542721_3543936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158657263.1|3543830_3544247_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046663827.1|3544524_3544845_+	TolC family protein	NA	NA	NA	NA	NA
WP_103672714.1|3544967_3545661_+|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_103672744.1|3545725_3546049_+	type II toxin-antitoxin system PrlF family antitoxin	NA	NA	NA	NA	NA
WP_046660474.1|3546463_3547960_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP012375	Microcystis aeruginosa NIES-2481 chromosome, complete genome	4293006	3564350	3632657	4293006	transposase,protease	Bodo_saltans_virus(33.33%)	52	NA	NA
WP_046663024.1|3564350_3564956_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_004269043.1|3564952_3567286_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066030098.1|3567299_3567971_-	DUF1822 family protein	NA	NA	NA	NA	NA
WP_066030099.1|3568087_3568663_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066030100.1|3568941_3570255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052734194.1|3570278_3570854_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_046663028.1|3571007_3571589_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_046663029.1|3571742_3572423_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_052734197.1|3572563_3573079_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_066030101.1|3573147_3573696_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158657264.1|3573890_3574316_+	DUF1295 domain-containing protein	NA	NA	NA	NA	NA
WP_046663031.1|3574386_3574785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052734219.1|3575979_3576792_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149976997.1|3577181_3577496_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_066030104.1|3577694_3578309_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071890152.1|3578311_3578509_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066030105.1|3578603_3578795_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149039036.1|3579094_3579277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149039038.1|3579828_3580362_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046663038.1|3580921_3581125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046663039.1|3581250_3582663_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_158524812.1|3583069_3583216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046663040.1|3584736_3586131_-	DUF2252 domain-containing protein	NA	NA	NA	NA	NA
WP_046663835.1|3586570_3588274_-	solute carrier 26 family protein	NA	NA	NA	NA	NA
WP_046663041.1|3588573_3590538_-	flavin-dependent dehydrogenase	NA	NA	NA	NA	NA
WP_046663042.1|3590683_3590926_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046663043.1|3590933_3591749_+	DUF2993 domain-containing protein	NA	NA	NA	NA	NA
WP_046663045.1|3592745_3593807_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_080949780.1|3593835_3594318_+	cytochrome c	NA	NA	NA	NA	NA
WP_046663046.1|3594657_3596811_+	O-linked N-acetylglucosamine transferase	NA	NA	NA	NA	NA
WP_046663047.1|3596828_3598994_+	O-linked N-acetylglucosamine transferase	NA	NA	NA	NA	NA
WP_103672725.1|3599578_3600470_+|transposase	IS630 family transposase	transposase	A0A2H4UV16	Bodo_saltans_virus	29.2	9.7e-21
WP_046661002.1|3600794_3602021_-|transposase	ISL3 family transposase	transposase	A9YX10	Burkholderia_phage	26.8	1.6e-26
WP_046660896.1|3607916_3609065_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_046660474.1|3610024_3611521_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_046663050.1|3613727_3614000_-	CRISPR-associated endonuclease Cas2	NA	NA	NA	NA	NA
WP_066030106.1|3614012_3615017_-	type I-D CRISPR-associated endonuclease Cas1	NA	NA	NA	NA	NA
WP_066030107.1|3615022_3615616_-	CRISPR-associated protein Cas4	NA	NA	NA	NA	NA
WP_046663053.1|3615618_3616452_-	CRISPR-associated endoribonuclease Cas6	NA	NA	NA	NA	NA
WP_046663054.1|3616451_3617018_-	Uma2 family endonuclease	NA	NA	NA	NA	NA
WP_046663055.1|3617058_3619794_-	CRISPR-associated helicase Cas3'	NA	NA	NA	NA	NA
WP_046663056.1|3619786_3620611_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012266052.1|3620614_3621508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066030108.1|3621510_3624042_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158657265.1|3624129_3624294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066030109.1|3624829_3625687_+	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_008197426.1|3626892_3627276_+	DUF4346 domain-containing protein	NA	NA	NA	NA	NA
WP_046663062.1|3627561_3628425_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_046663063.1|3628695_3629205_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_046663064.1|3629201_3630329_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_046663065.1|3630464_3631403_-	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_066030110.1|3631544_3632657_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0R8V9X2	Thermobifida_phage	61.0	1.1e-122
>prophage 6
NZ_CP012375	Microcystis aeruginosa NIES-2481 chromosome, complete genome	4293006	4207007	4270036	4293006	transposase,protease	Staphylococcus_phage(11.76%)	56	NA	NA
WP_046663482.1|4207007_4208252_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0R8V9X2	Thermobifida_phage	44.2	6.2e-74
WP_046663483.1|4208762_4209248_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046663484.1|4209321_4210695_+	YvcK family protein	NA	A1IMD5	Streptococcus_phage	35.5	3.5e-46
WP_046663485.1|4211220_4211511_-	DUF2288 family protein	NA	NA	NA	NA	NA
WP_046663486.1|4211646_4212219_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_066030208.1|4212250_4213534_+	biotin/lipoyl-binding protein	NA	NA	NA	NA	NA
WP_046663488.1|4213541_4214714_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_046663489.1|4214732_4215452_+	DevA family ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	68.3	8.4e-84
WP_046663490.1|4215808_4217731_-	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_046663491.1|4218153_4218588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046663492.1|4218584_4218998_-	SnoaL-like domain-containing protein	NA	NA	NA	NA	NA
WP_046663493.1|4219053_4220163_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	27.2	3.7e-30
WP_046663494.1|4220630_4221263_+	restriction endonuclease subunit R	NA	NA	NA	NA	NA
WP_046663495.1|4221482_4222613_+	SpoIID/LytB domain-containing protein	NA	NA	NA	NA	NA
WP_066030209.1|4222744_4226308_+	methionine synthase	NA	NA	NA	NA	NA
WP_066030210.1|4226541_4227144_+	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_066030211.1|4227146_4228148_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002749933.1|4228380_4229439_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_046663499.1|4229496_4230240_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046663500.1|4230306_4231983_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase RibB/GTP cyclohydrolase II RibA	NA	A0A2H4PQS2	Staphylococcus_phage	47.7	3.0e-100
WP_002736362.1|4232120_4232999_-	photosystem I reaction center subunit XII	NA	NA	NA	NA	NA
WP_046663501.1|4233267_4233756_-	phycocyanin subunit alpha	NA	NA	NA	NA	NA
WP_002771747.1|4233822_4234341_-	phycocyanin subunit beta	NA	NA	NA	NA	NA
WP_046663502.1|4234954_4236178_+	amidohydrolase	NA	NA	NA	NA	NA
WP_046663503.1|4236256_4237144_+	acetylglutamate kinase	NA	NA	NA	NA	NA
WP_002759020.1|4237312_4237534_+	DUF4327 family protein	NA	NA	NA	NA	NA
WP_046663504.1|4237577_4238798_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_046663506.1|4239221_4239830_+|transposase	IS607 family transposase	transposase	A0A7Q0	Microcystis_virus	98.5	4.6e-107
WP_046663507.1|4239807_4240980_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A7P9	Microcystis_virus	97.7	2.0e-215
WP_066030212.1|4241047_4242721_+	DNA methyltransferase	NA	A0A2L1IZ21	Streptomyces_phage	43.6	8.7e-124
WP_046663509.1|4243882_4244206_+	iron-sulfur cluster assembly accessory protein	NA	NA	NA	NA	NA
WP_066030213.1|4244206_4245274_-	phospho-N-acetylmuramoyl-pentapeptide- transferase	NA	NA	NA	NA	NA
WP_002735746.1|4245319_4245583_-	DUF3134 domain-containing protein	NA	NA	NA	NA	NA
WP_046663511.1|4245579_4246002_-	8-oxo-dGTP diphosphatase MutT	NA	NA	NA	NA	NA
WP_002760450.1|4246105_4246429_+	30S ribosomal protein PSRP-3	NA	NA	NA	NA	NA
WP_046663512.1|4246649_4247066_-	F0F1 ATP synthase subunit epsilon	NA	NA	NA	NA	NA
WP_066030214.1|4247140_4248589_-	F0F1 ATP synthase subunit beta	NA	NA	NA	NA	NA
WP_158657269.1|4249151_4249310_-	PEP-CTERM sorting domain-containing protein	NA	NA	NA	NA	NA
WP_046663515.1|4250130_4251756_-	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	54.7	7.1e-155
WP_002737272.1|4251802_4252114_-	co-chaperone GroES	NA	A0A221S386	uncultured_virus	53.3	5.9e-18
WP_002804204.1|4252970_4253399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066030217.1|4253900_4256222_-	DNA helicase PcrA	NA	A7KV33	Bacillus_phage	36.9	4.9e-117
WP_066030218.1|4256547_4257798_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	54.1	5.7e-120
WP_066030219.1|4258343_4258898_-	phycobiliprotein lyase	NA	NA	NA	NA	NA
WP_066030220.1|4258925_4259909_-	glycosyltransferase family 2 protein	NA	A0A2H5BFL1	Salmonella_phage	48.2	7.3e-78
WP_081310282.1|4259939_4261157_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_046663519.1|4261159_4262119_-	GDP-mannose 4,6-dehydratase	NA	A0A0E3F1J3	Synechococcus_phage	46.6	1.5e-72
WP_046663520.1|4262133_4263054_-	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	26.7	6.9e-06
WP_046663521.1|4263319_4264303_+	glycosyltransferase family 2 protein	NA	A0A0F7L2F7	uncultured_marine_virus	28.2	6.5e-10
WP_046663522.1|4264435_4264792_+	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_046663523.1|4264778_4265321_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_002759792.1|4265482_4265809_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002804258.1|4265805_4266414_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_046663524.1|4266429_4267689_-|transposase	transposase	transposase	A0A1L2BWU7	Bacteriophage	46.4	2.6e-88
WP_046663525.1|4268288_4268945_-	endonuclease III	NA	NA	NA	NA	NA
WP_046663526.1|4268944_4270036_-|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
>prophage 1
NZ_CP025929	Microcystis aeruginosa NIES-2481 plasmid p1, complete sequence	147539	79284	127548	147539	transposase	Microcystis_virus(21.43%)	59	NA	NA
WP_103672798.1|79284_80397_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0R8V9X2	Thermobifida_phage	59.1	7.8e-121
WP_103672799.1|80522_80894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103672801.1|81275_81593_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103672802.1|81589_82000_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_103672803.1|81980_82850_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103672804.1|83024_83249_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103672805.1|83475_83661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103672806.1|83775_84426_+	DUF1295 domain-containing protein	NA	NA	NA	NA	NA
WP_158657277.1|84520_85120_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_158657278.1|85136_85907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162496093.1|86019_86250_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103672809.1|86183_86423_-	DUF1830 domain-containing protein	NA	NA	NA	NA	NA
WP_103672810.1|86489_86675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103672811.1|86881_88555_+	GMC oxidoreductase	NA	NA	NA	NA	NA
WP_103672813.1|89052_89586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158657279.1|89687_89846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103672814.1|90025_90532_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158657280.1|90579_90771_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103672816.1|90820_91147_+	hypothetical protein	NA	A0A7S2	Microcystis_virus	62.0	2.3e-33
WP_103672817.1|91205_91442_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103672818.1|91482_91857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149976704.1|91923_92130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149976705.1|92306_92627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103672820.1|93523_93736_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158657286.1|93853_95191_+	hypothetical protein	NA	K9RZE6	Philosamia_cynthia_ricini_nucleopolyhedrovirus	41.0	2.1e-11
WP_046660896.1|95205_96354_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_103672821.1|96334_97954_+	hypothetical protein	NA	E7DNC5	Pneumococcus_phage	29.7	1.2e-24
WP_103672822.1|97950_98214_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103672880.1|98203_98551_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158657281.1|98867_99677_+	HTH domain-containing protein	NA	NA	NA	NA	NA
WP_103672825.1|99828_103542_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158657282.1|103538_103688_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103672826.1|103767_104319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103672827.1|104333_105062_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103672881.1|107220_109008_-|transposase	transposase	transposase	A0A2H4PB66	Aphanizomenon_phage	34.9	5.4e-55
WP_103672829.1|109432_110119_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103672830.1|110124_110316_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103672833.1|112166_112508_+	DUF4326 domain-containing protein	NA	U5XK15	Phormidium_phage	40.4	1.2e-16
WP_103672834.1|112579_113662_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103672835.1|113724_114096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103672836.1|114649_115000_+	DUF2493 domain-containing protein	NA	A0A2I7S0C0	Vibrio_phage	51.8	1.4e-28
WP_103672882.1|115458_115932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103672837.1|116112_116778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103672838.1|117281_117548_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103672839.1|117614_118514_+	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	32.1	1.4e-35
WP_103672840.1|118639_119311_+	hypothetical protein	NA	A0A2H4GYA3	Pseudomonas_phage	42.3	8.0e-44
WP_103672841.1|119434_120262_+	SAM-dependent methyltransferase	NA	A8HNV9	Thalassomonas_phage	40.4	1.4e-18
WP_103672842.1|120252_121425_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A7P9	Microcystis_virus	97.4	4.4e-215
WP_046663506.1|121402_122011_-|transposase	IS607 family transposase	transposase	A0A7Q0	Microcystis_virus	98.5	4.6e-107
WP_103672843.1|122073_122328_+	hypothetical protein	NA	A8HNV9	Thalassomonas_phage	39.3	1.3e-10
WP_103672844.1|122474_122804_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158657283.1|122874_123048_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103672845.1|123123_123501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103672846.1|123621_123840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103672847.1|124173_124533_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158657284.1|124638_124818_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103672849.1|125021_125543_+	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_103672850.1|125603_125867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103672851.1|126414_127548_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1L2BWN4	Bacteriophage	56.9	1.5e-114
