The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP016937	Yersinia enterocolitica strain YE6 chromosome, complete genome	4807490	788745	869745	4807490	protease,bacteriocin,transposase	Enterobacterial_phage(25.0%)	54	NA	NA
WP_057618920.1|788745_788997_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_005162673.1|789279_789534_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_005162670.1|789846_790206_+	antitermination protein	NA	K7PGW2	Enterobacterial_phage	47.5	1.7e-21
WP_032904442.1|790308_791067_-	molecular chaperone	NA	NA	NA	NA	NA
WP_069008913.1|795181_795910_-	molecular chaperone	NA	NA	NA	NA	NA
WP_049525161.1|796054_797086_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_005165289.1|798028_798991_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_049528679.1|799024_799498_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_049528676.1|800746_801601_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_005165296.1|801829_802198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129019424.1|802261_802414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005166182.1|803860_805324_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_069008916.1|805556_806963_-	filamentous hemagglutinin N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_016266334.1|808926_809391_-	Large exoprotein involved in heme utilization or adhesion	NA	NA	NA	NA	NA
WP_014609275.1|809456_810131_-	filamentous hemagglutinin N-terminal domain-containing protein	NA	A0A0R6PJK4	Moraxella_phage	35.7	1.0e-14
WP_005166173.1|812058_813591_-	signal transduction histidine-protein kinase/phosphatase UhpB	NA	NA	NA	NA	NA
WP_049528662.1|813587_814178_-	transcriptional regulator UhpA	NA	NA	NA	NA	NA
WP_050127428.1|814289_815981_-	kdo(2)-lipid A phosphoethanolamine 7''-transferase	NA	NA	NA	NA	NA
WP_048618714.1|816240_816666_-	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
WP_023160836.1|817136_818156_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_069008919.1|818967_820575_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005157323.1|820857_821877_+	dipeptide ABC transporter permease DppB	NA	NA	NA	NA	NA
WP_049525223.1|821887_822790_+	dipeptide ABC transporter permease DppC	NA	NA	NA	NA	NA
WP_049525224.1|822805_823786_+	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.9	2.5e-14
WP_005157326.1|823800_824805_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.7	1.7e-18
WP_049525225.1|825147_826800_-	cellulose biosynthesis protein BcsG	NA	NA	NA	NA	NA
WP_005157335.1|826802_826991_-	cellulose biosynthesis protein BcsF	NA	NA	NA	NA	NA
WP_049525226.1|826987_828547_-	cellulose biosynthesis protein BcsE	NA	NA	NA	NA	NA
WP_005157340.1|828744_828936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013650602.1|828939_829677_+	cellulose synthase operon protein YhjQ	NA	NA	NA	NA	NA
WP_049525228.1|829673_832301_+	UDP-forming cellulose synthase catalytic subunit	NA	NA	NA	NA	NA
WP_049528808.1|832311_834615_+	cellulose biosynthesis cyclic di-GMP-binding regulatory protein BcsB	NA	NA	NA	NA	NA
WP_057618858.1|834620_835748_+	cellulase	NA	NA	NA	NA	NA
WP_069008921.1|835729_839104_+	cellulose biosynthesis protein BcsC	NA	NA	NA	NA	NA
WP_069008922.1|839367_840864_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_005157352.1|841588_842293_+	porin	NA	NA	NA	NA	NA
WP_005157353.1|842369_844088_+	pectate lyase	NA	NA	NA	NA	NA
WP_069008923.1|844212_844692_+	discoidin domain-containing protein	NA	NA	NA	NA	NA
WP_005157357.1|845069_846362_+	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_005157359.1|846776_848267_+	insulinase family protein	NA	NA	NA	NA	NA
WP_005157362.1|848426_849371_-	sugar kinase	NA	NA	NA	NA	NA
WP_004388926.1|849515_849716_-	4-oxalocrotonate tautomerase family protein	NA	NA	NA	NA	NA
WP_049525232.1|849954_850746_+	cyclic-guanylate-specific phosphodiesterase	NA	NA	NA	NA	NA
WP_049525233.1|853020_853785_-	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_049525234.1|853808_854798_-	inner membrane protein YhjD	NA	NA	NA	NA	NA
WP_069008925.1|855214_858457_+	autotransporter adhesin YapE	NA	NA	NA	NA	NA
WP_005157379.1|858815_860168_-	glutathione-disulfide reductase	NA	NA	NA	NA	NA
WP_049525236.1|860411_861254_-	23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ	NA	NA	NA	NA	NA
WP_023160901.1|861590_863633_+	oligopeptidase A	NA	NA	NA	NA	NA
WP_020283527.1|863636_864395_+	16S rRNA (guanine(1516)-N(2))-methyltransferase RsmJ	NA	NA	NA	NA	NA
WP_013650589.1|864461_865703_-|protease	metalloprotease	protease	NA	NA	NA	NA
WP_049525237.1|865925_867269_-	NADP-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_005157389.1|867532_867979_-	universal stress protein UspA	NA	NA	NA	NA	NA
WP_023160836.1|868725_869745_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP016937	Yersinia enterocolitica strain YE6 chromosome, complete genome	4807490	1146276	1255243	4807490	holin,tRNA,tail,terminase,integrase,head,transposase,protease,capsid	Cronobacter_phage(50.0%)	89	1145972:1146000	1233738:1233766
1145972:1146000	attL	CGCCATATATGGACGCTCCCAATAAACCA	NA	NA	NA	NA
WP_042663659.1|1146276_1147296_-|transposase	IS110-like element ISYen1 family transposase	transposase	NA	NA	NA	NA
WP_005174358.1|1147493_1148414_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	53.5	8.0e-79
WP_049525329.1|1148772_1150185_-	anion permease	NA	NA	NA	NA	NA
WP_005163087.1|1150694_1150907_-	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	80.0	4.4e-25
WP_005163090.1|1151178_1151391_-	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	80.0	1.7e-24
WP_005163093.1|1151772_1152243_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_002210061.1|1154116_1154413_-	DNA-binding transcriptional regulator Fis	NA	NA	NA	NA	NA
WP_005163099.1|1154433_1155399_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_005163101.1|1155841_1156723_-	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_049525330.1|1156814_1158269_-	sodium/pantothenate symporter	NA	NA	NA	NA	NA
WP_005163104.1|1158258_1158501_-	YhdT family protein	NA	NA	NA	NA	NA
WP_005163110.1|1158639_1159989_-	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_005163113.1|1160000_1160465_-	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_049525331.1|1160497_1160950_-	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_049525332.1|1161158_1161758_-	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_005163122.1|1161757_1162792_-	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_005163130.1|1162945_1163923_-	oxidoreductase	NA	NA	NA	NA	NA
WP_069008954.1|1164207_1166127_+	RNase E specificity factor CsrD	NA	NA	NA	NA	NA
WP_002228205.1|1166461_1167505_+	rod shape-determining protein MreB	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.0e-06
WP_005163136.1|1167604_1168591_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_005163138.1|1168587_1169076_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_005180107.1|1169089_1169683_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_049525335.1|1169672_1171142_+	ribonuclease G	NA	NA	NA	NA	NA
WP_069008956.1|1171343_1175219_+	AsmA2 domain-containing protein	NA	NA	NA	NA	NA
WP_005163159.1|1175215_1176076_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_049525337.1|1176087_1177533_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_069008958.1|1177586_1178873_-	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_013650506.1|1178869_1179148_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_005163183.1|1182717_1183077_-	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
WP_020282680.1|1183073_1183475_-	M15 family metallopeptidase	NA	A9DET4	Yersinia_phage	58.4	1.4e-40
WP_005163187.1|1183483_1183795_-|holin	holin	holin	R9W0A1	Serratia_phage	51.2	3.1e-19
WP_069008960.1|1183871_1188374_-	toxin	NA	NA	NA	NA	NA
WP_050127097.1|1188430_1191961_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005163194.1|1195631_1196543_-	HTH-type transcriptional activator AaeR	NA	NA	NA	NA	NA
WP_005163197.1|1196868_1197072_+	AaeX family protein	NA	NA	NA	NA	NA
WP_050127093.1|1197079_1198015_+	p-hydroxybenzoic acid efflux pump subunit AaeA	NA	NA	NA	NA	NA
WP_069008961.1|1198016_1199972_+	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
WP_049525342.1|1200093_1201587_+	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_049525343.1|1201684_1202158_+	ribonuclease	NA	NA	NA	NA	NA
WP_004392366.1|1202162_1202429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005163212.1|1202460_1203006_-	ribosome-associated protein	NA	NA	NA	NA	NA
WP_049525344.1|1203143_1204136_-|integrase	tyrosine-type recombinase/integrase	integrase	Q83VS6	Escherichia_phage	60.4	2.8e-109
WP_049525345.1|1204202_1204502_-	helix-turn-helix transcriptional regulator	NA	Q1JS29	Enterobacteria_phage	74.7	4.6e-36
WP_129019376.1|1204611_1204944_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049525347.1|1205070_1205292_+	DUF2724 domain-containing protein	NA	NA	NA	NA	NA
WP_049525348.1|1205306_1205663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049525349.1|1205735_1206002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049525350.1|1206001_1206898_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	E5G6L8	Salmonella_phage	51.0	2.8e-76
WP_049525351.1|1206894_1207932_+	phosphoadenosine phosphosulfate reductase family protein	NA	B7SYG0	Stenotrophomonas_phage	42.6	7.7e-62
WP_069008964.1|1207928_1210334_+	replication endonuclease	NA	F1BUS0	Erwinia_phage	49.9	1.2e-203
WP_049525352.1|1210379_1210640_-	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	64.3	1.3e-26
WP_069008967.1|1211717_1213505_-|terminase	terminase	terminase	F1BUM5	Cronobacter_phage	66.6	4.8e-237
WP_049525354.1|1213674_1214532_+|capsid	phage capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	48.1	2.7e-44
WP_049525355.1|1214597_1215629_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	76.4	3.6e-144
WP_049525356.1|1215638_1216337_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	53.9	4.5e-66
WP_046050145.1|1216396_1216885_+|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	56.0	1.1e-39
WP_049525357.1|1216881_1217370_+|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	44.8	4.2e-34
WP_049525359.1|1218861_1219317_+	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	60.9	9.8e-46
WP_049525360.1|1219326_1219617_+|holin	holin	holin	C7BGD7	Burkholderia_phage	50.6	6.7e-16
WP_049525361.1|1219613_1219955_+	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	82.2	1.4e-44
WP_049525362.1|1219954_1220296_+	hypothetical protein	NA	F1BUL2	Cronobacter_phage	41.8	4.4e-14
WP_004389570.1|1220445_1220712_+	hypothetical protein	NA	A5X9I7	Aeromonas_virus	53.7	5.1e-18
WP_057618720.1|1220899_1222876_+|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	48.5	1.9e-170
WP_049525364.1|1222875_1223208_+	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	67.3	1.7e-34
WP_049525365.1|1223200_1224385_+	phage protein	NA	F1BUK6	Cronobacter_phage	67.0	1.3e-153
WP_049525366.1|1224377_1224986_+	hypothetical protein	NA	F1BUK5	Cronobacter_phage	63.6	9.4e-68
WP_129019378.1|1226631_1226829_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049525367.1|1226839_1227313_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049525368.1|1227302_1228034_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	47.1	3.9e-44
WP_049525369.1|1230415_1230622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049525370.1|1230756_1231593_-	abortive infection family protein	NA	NA	NA	NA	NA
WP_069008969.1|1232128_1233469_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_042663659.1|1234018_1235038_-|transposase	IS110-like element ISYen1 family transposase	transposase	NA	NA	NA	NA
1233738:1233766	attR	CGCCATATATGGACGCTCCCAATAAACCA	NA	NA	NA	NA
WP_005162547.1|1235569_1235956_+	cytochrome b562	NA	NA	NA	NA	NA
WP_005162545.1|1236003_1236414_-	nucleoside diphosphate kinase regulator	NA	NA	NA	NA	NA
WP_005174305.1|1236945_1237290_+	glycine dehydrogenase	NA	NA	NA	NA	NA
WP_004392359.1|1237313_1237679_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005162543.1|1237678_1237975_+	DUF4312 family protein	NA	NA	NA	NA	NA
WP_005162542.1|1237987_1238764_+	DUF4311 domain-containing protein	NA	NA	NA	NA	NA
WP_013650492.1|1238785_1239436_+	DUF4310 family protein	NA	NA	NA	NA	NA
WP_049525373.1|1239519_1240689_+	amidohydrolase/deacetylase family metallohydrolase	NA	NA	NA	NA	NA
WP_013650491.1|1240672_1241785_+	DgaE family pyridoxal phosphate-dependent ammonia lyase	NA	NA	NA	NA	NA
WP_049525374.1|1241788_1242529_+	KDGP aldolase family protein	NA	NA	NA	NA	NA
WP_049525375.1|1244002_1245901_+	BglG family transcription antiterminator	NA	NA	NA	NA	NA
WP_049525376.1|1245972_1246278_-	HigA family addiction module antidote protein	NA	A0A2L1IV52	Escherichia_phage	66.3	1.5e-29
WP_005162526.1|1246277_1246556_-	plasmid maintenance system killer protein	NA	A0A2L1IV28	Escherichia_phage	77.2	6.0e-38
WP_049525377.1|1249859_1250807_+	HTH-type transcriptional regulator TreR	NA	NA	NA	NA	NA
WP_049525378.1|1252505_1254167_+	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_049525379.1|1254508_1255243_-|protease	proteasome-type protease	protease	NA	NA	NA	NA
>prophage 3
NZ_CP016937	Yersinia enterocolitica strain YE6 chromosome, complete genome	4807490	1750985	1797971	4807490	terminase,integrase,lysis,plate,protease,capsid	Edwardsiella_phage(26.42%)	75	1749590:1749603	1767976:1767989
1749590:1749603	attL	TCAGCGGCATTCAT	NA	NA	NA	NA
WP_050294021.1|1750985_1752257_-|integrase	site-specific integrase	integrase	Q8W658	Enterobacteria_phage	52.7	1.4e-126
WP_049525557.1|1752289_1752541_-	DUF1233 family excisionase	NA	A0A286S2A4	Klebsiella_phage	50.0	5.8e-16
WP_049525558.1|1752898_1753534_-	DNA methyltransferase	NA	I6PDF5	Cronobacter_phage	73.0	7.2e-87
WP_049525559.1|1753530_1753749_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164971240.1|1753748_1753925_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129019389.1|1754158_1754545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050128071.1|1754534_1754756_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049525779.1|1754780_1755050_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049525781.1|1755051_1755480_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057619046.1|1755476_1755884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049526811.1|1755925_1756108_-	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	59.6	1.3e-09
WP_057619042.1|1756104_1757040_-	recombinase RecT	NA	A0A193GYL3	Enterobacter_phage	62.5	2.4e-107
WP_069009644.1|1757032_1757851_-	exodeoxyribonuclease VIII	NA	E5AGE0	Erwinia_phage	74.1	2.6e-121
WP_049526808.1|1757850_1758144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129019391.1|1758247_1758379_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	NA	NA	NA	NA
WP_069009030.1|1758396_1759416_-	hypothetical protein	NA	K7P6J9	Enterobacteria_phage	64.4	1.2e-30
WP_049525794.1|1759504_1759798_-	hypothetical protein	NA	A0A0B4SK56	Proteus_phage	31.3	7.6e-07
WP_049525796.1|1760343_1760685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071828178.1|1760843_1761023_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154236085.1|1761227_1761386_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050344824.1|1761388_1761685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049528945.1|1762177_1762387_+	DUF2767 family protein	NA	I6R0R9	Salmonella_phage	47.5	5.9e-06
WP_049525800.1|1762431_1762875_-	hypothetical protein	NA	M1FPN8	Enterobacteria_phage	50.4	4.3e-30
WP_049525803.1|1762892_1763738_-	hypothetical protein	NA	M1FPD4	Enterobacteria_phage	44.3	4.6e-57
WP_012304433.1|1763867_1764590_-	LexA family transcriptional regulator	NA	A0A2R2X2B0	Escherichia_phage	55.5	2.3e-65
WP_042562436.1|1764694_1764889_+	Cro/Cl family transcriptional regulator	NA	K7PLQ6	Enterobacteria_phage	85.5	4.2e-22
WP_050296274.1|1765000_1765294_+	hypothetical protein	NA	A2SY75	Escherichia_phage	63.9	6.1e-25
WP_049526793.1|1765318_1765921_+	hypothetical protein	NA	M1F3E2	Salmonella_phage	41.6	1.6e-35
WP_069009033.1|1765917_1766757_+	replication protein	NA	A0A075B8J2	Enterobacteria_phage	61.9	3.2e-34
WP_050344860.1|1766753_1767608_+	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	57.5	2.2e-86
WP_129019429.1|1767748_1767946_+	hypothetical protein	NA	K7PHN9	Enterobacterial_phage	61.9	9.2e-17
WP_069009034.1|1767942_1768245_+	hypothetical protein	NA	NA	NA	NA	NA
1767976:1767989	attR	ATGAATGCCGCTGA	NA	NA	NA	NA
WP_049526787.1|1768241_1768736_+	DUF551 domain-containing protein	NA	E7C9P2	Salmonella_phage	32.5	4.5e-12
WP_049525574.1|1768735_1768933_+	hypothetical protein	NA	A0A2H4FUS3	Salmonella_phage	42.2	5.1e-07
WP_164971241.1|1768922_1769084_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049525575.1|1769076_1769547_+	recombination protein NinB	NA	I6R9D0	Salmonella_phage	53.9	2.6e-41
WP_049526784.1|1770168_1770459_+	DUF1364 domain-containing protein	NA	A0A220NQY2	Salmonella_phage	75.8	1.3e-38
WP_049526782.1|1770455_1770818_+	RusA family crossover junction endodeoxyribonuclease	NA	E5AGG1	Erwinia_phage	65.8	8.7e-37
WP_049526779.1|1771026_1771851_+	antitermination protein	NA	M9NZB0	Enterobacteria_phage	53.6	1.3e-75
WP_049525816.1|1772324_1772858_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049528949.1|1773075_1773357_+	hypothetical protein	NA	H6WRZ3	Salmonella_phage	54.3	1.1e-18
WP_049526777.1|1773356_1773869_+	lysozyme	NA	I6PBN2	Cronobacter_phage	59.9	2.4e-48
WP_049525819.1|1773853_1774315_+|lysis	lysis protein	lysis	A5LH84	Enterobacteria_phage	43.0	1.7e-21
WP_069009038.1|1774632_1775319_+	Rha family transcriptional regulator	NA	A0A192Y918	Salmonella_phage	86.0	6.5e-110
WP_155296413.1|1775321_1775495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069009040.1|1775561_1775786_+	hypothetical protein	NA	A0A127KNL9	Pseudomonas_phage	64.7	7.0e-05
WP_069009041.1|1775845_1776046_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069009044.1|1776049_1776241_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069009046.1|1776251_1776728_+|terminase	terminase	terminase	C7U0V7	Enterobacteria_phage	74.1	3.2e-55
WP_069009047.1|1776729_1778406_+|terminase	phage terminase large subunit	terminase	H9C191	Pectobacterium_phage	72.6	7.9e-242
WP_069009050.1|1778406_1779942_+	DUF1073 domain-containing protein	NA	A0A2R3UAL5	Myoviridae_environmental_samples	44.2	1.0e-102
WP_069009051.1|1779994_1780690_+|capsid	minor capsid protein	capsid	H9C0V1	Aeromonas_phage	54.9	1.3e-65
WP_069009052.1|1780686_1780875_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069009054.1|1780920_1782108_+	DUF2213 domain-containing protein	NA	A0A219YCD3	Aeromonas_phage	36.3	2.9e-57
WP_069009056.1|1782109_1782592_+	hypothetical protein	NA	A0A219YBF2	Aeromonas_phage	51.0	1.4e-34
WP_069009059.1|1782591_1783635_+	DUF2184 domain-containing protein	NA	A0A219YBB0	Aeromonas_phage	49.4	7.9e-83
WP_057627536.1|1783638_1783965_+	hypothetical protein	NA	H9C0V9	Aeromonas_phage	41.1	2.1e-10
WP_069009061.1|1783967_1784411_+	DUF4054 domain-containing protein	NA	Q2NPC6	Xanthomonas_phage	50.0	3.1e-20
WP_069009062.1|1784413_1784944_+	hypothetical protein	NA	A0A077KC03	Edwardsiella_phage	43.6	1.4e-27
WP_069009064.1|1784921_1785293_+	hypothetical protein	NA	A0A077KAW7	Edwardsiella_phage	61.0	5.0e-40
WP_049528954.1|1785490_1785808_+	hypothetical protein	NA	A0A077KC88	Edwardsiella_phage	67.3	9.6e-32
WP_049525848.1|1785804_1787292_+	DUF3383 domain-containing protein	NA	A0A077KGV4	Edwardsiella_phage	61.9	4.5e-164
WP_049525852.1|1787301_1787736_+	hypothetical protein	NA	A0A077K9T0	Edwardsiella_phage	67.1	1.6e-53
WP_049525854.1|1787735_1788143_+	hypothetical protein	NA	A0A077KC08	Edwardsiella_phage	60.7	8.3e-36
WP_049525857.1|1788357_1790118_+	lytic transglycosylase domain-containing protein	NA	A0A077KC92	Edwardsiella_phage	38.6	2.4e-100
WP_049525859.1|1790122_1790524_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049525861.1|1790600_1791059_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049525864.1|1791171_1791990_+	hypothetical protein	NA	A0A077KGW3	Edwardsiella_phage	57.9	4.8e-75
WP_049525866.1|1791986_1792292_+	hypothetical protein	NA	A0A077K9U4	Edwardsiella_phage	63.0	9.2e-32
WP_049525867.1|1792281_1793139_+	hypothetical protein	NA	A0A077KC17	Edwardsiella_phage	53.6	3.0e-80
WP_049525869.1|1793135_1793846_+|plate	phage baseplate assembly protein	plate	A0A077KAY0	Edwardsiella_phage	52.9	1.4e-59
WP_049525871.1|1793842_1794202_+	hypothetical protein	NA	A0A077KCA1	Edwardsiella_phage	73.7	1.2e-43
WP_069009065.1|1794198_1795440_+	hypothetical protein	NA	A0A077KGW9	Edwardsiella_phage	67.8	1.7e-156
WP_049525876.1|1795436_1796078_+	DUF2612 domain-containing protein	NA	A0A077K9U8	Edwardsiella_phage	73.6	1.1e-87
WP_129019393.1|1796255_1797971_+	hypothetical protein	NA	A9YX14	Burkholderia_phage	39.8	7.0e-52
>prophage 4
NZ_CP016937	Yersinia enterocolitica strain YE6 chromosome, complete genome	4807490	1997781	2119625	4807490	holin,tRNA,tail,terminase,integrase,portal,lysis,plate,coat,head,transposase,protease,capsid	Enterobacteria_phage(19.05%)	173	2004032:2004046	2054563:2054578
WP_005158258.1|1997781_1998417_-|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
WP_005158259.1|1998387_1999074_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.2	2.7e-31
WP_049525769.1|1999070_2001497_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_005158266.1|2001636_2002701_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_049525771.1|2002697_2003222_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	38.5	5.3e-19
WP_049525773.1|2003397_2004120_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
2004032:2004046	attL	GCTTCACGCTGGATA	NA	NA	NA	NA
WP_005158275.1|2004130_2004625_-	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
2004032:2004046	attL	GCTTCACGCTGGATA	NA	NA	NA	NA
WP_020283435.1|2004837_2006223_+|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	32.0	5.5e-39
WP_004390634.1|2006391_2006604_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_005158281.1|2006618_2007485_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	35.0	3.7e-33
WP_050344586.1|2007807_2008962_-|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	71.1	6.2e-161
WP_049525558.1|2009562_2010198_-	DNA methyltransferase	NA	I6PDF5	Cronobacter_phage	73.0	7.2e-87
WP_049525559.1|2010194_2010413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164971240.1|2010412_2010589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129019389.1|2010822_2011209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050128071.1|2011198_2011420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049525779.1|2011444_2011714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049525781.1|2011715_2012144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057619046.1|2012140_2012548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049526811.1|2012589_2012772_-	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	59.6	1.3e-09
WP_057619042.1|2012768_2013704_-	recombinase RecT	NA	A0A193GYL3	Enterobacter_phage	62.5	2.4e-107
WP_069009644.1|2013696_2014515_-	exodeoxyribonuclease VIII	NA	E5AGE0	Erwinia_phage	74.1	2.6e-121
WP_049526808.1|2014514_2014808_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129019391.1|2014911_2015043_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	NA	NA	NA	NA
WP_069009030.1|2015060_2016080_-	hypothetical protein	NA	K7P6J9	Enterobacteria_phage	64.4	1.2e-30
2015272:2015286	attR	GCTTCACGCTGGATA	NA	NA	NA	NA
WP_049525794.1|2016168_2016462_-	hypothetical protein	NA	A0A0B4SK56	Proteus_phage	31.3	7.6e-07
2015272:2015286	attR	GCTTCACGCTGGATA	NA	NA	NA	NA
WP_049525796.1|2017007_2017349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071828178.1|2017507_2017687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154236085.1|2017891_2018050_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049525565.1|2018052_2018337_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049611538.1|2018834_2019587_-	helix-turn-helix transcriptional regulator	NA	G8C7L8	Escherichia_phage	41.2	7.3e-30
WP_049611541.1|2019704_2019938_+	antirepressor	NA	A0A0P0ZDD7	Stx2-converting_phage	58.4	6.4e-17
WP_057619037.1|2020049_2020343_+	hypothetical protein	NA	A2SY75	Escherichia_phage	62.9	8.0e-25
WP_057619038.1|2020367_2021072_+	hypothetical protein	NA	Q71T76	Escherichia_phage	54.0	2.1e-63
WP_071890465.1|2021068_2021890_+	replication protein	NA	K7PL20	Enterobacteria_phage	64.3	5.5e-55
WP_069009079.1|2021886_2022741_+	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	57.3	8.2e-86
WP_129019430.1|2022881_2023079_+	hypothetical protein	NA	K7PHN9	Enterobacterial_phage	61.9	9.2e-17
WP_049525572.1|2023075_2023378_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050128082.1|2023374_2023875_+	DUF551 domain-containing protein	NA	NA	NA	NA	NA
WP_049525574.1|2023874_2024072_+	hypothetical protein	NA	A0A2H4FUS3	Salmonella_phage	42.2	5.1e-07
WP_164971241.1|2024061_2024223_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049525575.1|2024215_2024686_+	recombination protein NinB	NA	I6R9D0	Salmonella_phage	53.9	2.6e-41
WP_049526784.1|2025307_2025598_+	DUF1364 domain-containing protein	NA	A0A220NQY2	Salmonella_phage	75.8	1.3e-38
WP_049526782.1|2025594_2025957_+	RusA family crossover junction endodeoxyribonuclease	NA	E5AGG1	Erwinia_phage	65.8	8.7e-37
WP_049526779.1|2026165_2026990_+	antitermination protein	NA	M9NZB0	Enterobacteria_phage	53.6	1.3e-75
WP_050344746.1|2027463_2027997_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049525581.1|2028188_2028506_+|holin	holin	holin	E7C9S8	Salmonella_phage	57.6	8.4e-28
WP_049525582.1|2028492_2028891_+	M15 family metallopeptidase	NA	E7C9S9	Salmonella_phage	61.7	1.0e-38
WP_069009658.1|2028908_2029409_+	DUF2514 family protein	NA	Q7Y3V2	Yersinia_phage	86.7	1.8e-72
WP_049525583.1|2029419_2029830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129074823.1|2029848_2030127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049525585.1|2030337_2030571_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.1e-16
WP_049525586.1|2030647_2031292_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049525588.1|2031757_2032357_+	hypothetical protein	NA	NA	NA	NA	NA
WP_102970453.1|2032325_2034305_+|terminase	phage terminase large subunit family protein	terminase	G8EXZ6	Synechococcus_phage	46.0	3.1e-136
WP_005278866.1|2034313_2034577_+|head,tail	phage head-tail adapter protein	head,tail	NA	NA	NA	NA
WP_049525589.1|2034645_2036229_+|portal	phage portal protein	portal	A0A291AUL8	Sinorhizobium_phage	38.5	1.2e-98
WP_049525590.1|2036225_2037086_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	39.9	1.1e-50
WP_049525591.1|2037078_2037672_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049525592.1|2037671_2038073_+|head	head decoration protein	head	NA	NA	NA	NA
WP_049525593.1|2038182_2039229_+|capsid	major capsid protein	capsid	Q6UYI3	Burkholderia_phage	30.7	4.9e-40
WP_049525594.1|2039230_2039725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049525596.1|2039724_2040069_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049525598.1|2040065_2040611_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049525600.1|2040616_2040808_+	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_050156942.1|2040807_2042298_+|tail	phage tail protein	tail	B5TK67	Pseudomonas_phage	44.2	2.6e-103
WP_050319427.1|2042310_2042685_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_049525606.1|2042686_2042989_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_069009080.1|2043106_2044909_+	lytic transglycosylase domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	49.2	1.1e-23
WP_050879847.1|2044966_2046373_+	hypothetical protein	NA	Q8W619	Enterobacteria_phage	27.6	6.8e-21
WP_049525612.1|2046369_2047443_+|tail	tail protein	tail	M1PVV2	Vibrio_phage	30.1	5.5e-39
WP_049525614.1|2047439_2048033_+|plate	phage baseplate assembly protein	plate	NA	NA	NA	NA
WP_049525616.1|2048029_2048467_+	hypothetical protein	NA	A0A0C4UR04	Shigella_phage	45.4	3.4e-19
WP_069096335.1|2048470_2049607_+|plate	baseplate J/gp47 family protein	plate	A0A1E1GE19	Vibrio_phage	28.0	1.7e-09
WP_050107865.1|2049603_2050200_+	YmfQ family protein	NA	A0A2P9JZK7	Alteromonadaceae_phage	39.8	4.6e-35
WP_069009081.1|2051706_2051889_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057619001.1|2051995_2053096_+	acyltransferase	NA	A0A2H4JA46	uncultured_Caudovirales_phage	28.0	4.4e-23
WP_071890467.1|2053314_2054337_-|integrase	site-specific integrase	integrase	F1C5B2	Cronobacter_phage	67.1	2.8e-141
WP_046051422.1|2054354_2054702_-	helix-turn-helix domain-containing protein	NA	M1FJ59	Enterobacteria_phage	58.3	2.4e-28
WP_049525558.1|2055059_2055695_-	DNA methyltransferase	NA	I6PDF5	Cronobacter_phage	73.0	7.2e-87
WP_049525559.1|2055691_2055910_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164971240.1|2055909_2056086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129019389.1|2056319_2056706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050128071.1|2056695_2056917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049525779.1|2056941_2057211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049525781.1|2057212_2057641_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069009084.1|2057637_2058045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154236079.1|2058088_2058262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049525787.1|2058495_2059092_-	hypothetical protein	NA	K7PHD7	Enterobacteria_phage	51.6	3.0e-42
WP_049525790.1|2059088_2059769_-	AAA family ATPase	NA	A0A2D1GLT5	Escherichia_phage	69.0	2.6e-90
WP_049525792.1|2059740_2059989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154236080.1|2059985_2060159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049525794.1|2060424_2060718_-	hypothetical protein	NA	A0A0B4SK56	Proteus_phage	31.3	7.6e-07
WP_069009085.1|2060739_2061108_-	hypothetical protein	NA	B9UDG8	Salmonella_phage	50.0	2.1e-38
WP_049525796.1|2061217_2061559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071828178.1|2061717_2061897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154236085.1|2062101_2062260_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049525798.1|2062262_2062547_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049528945.1|2063045_2063255_+	DUF2767 family protein	NA	I6R0R9	Salmonella_phage	47.5	5.9e-06
WP_049525800.1|2063299_2063743_-	hypothetical protein	NA	M1FPN8	Enterobacteria_phage	50.4	4.3e-30
WP_049525803.1|2063760_2064606_-	hypothetical protein	NA	M1FPD4	Enterobacteria_phage	44.3	4.6e-57
WP_080347400.1|2064746_2065445_-	helix-turn-helix transcriptional regulator	NA	A0A2D1GM27	Escherichia_phage	63.9	2.6e-82
WP_049525807.1|2065603_2065834_+	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	47.1	5.0e-06
WP_049525808.1|2065949_2066243_+	hypothetical protein	NA	A2SY75	Escherichia_phage	62.9	1.2e-23
WP_049525811.1|2066252_2066789_+	hypothetical protein	NA	A0A291AXH9	Shigella_phage	53.6	1.2e-50
WP_049525571.1|2067035_2067938_+	replication protein	NA	C6ZR51	Salmonella_phage	56.0	2.2e-36
WP_049525813.1|2067937_2069275_+	AAA family ATPase	NA	A0A2I7REC3	Vibrio_phage	38.7	1.5e-81
WP_050128081.1|2069287_2069512_+	hypothetical protein	NA	A0A192Y6R5	Salmonella_phage	63.8	2.5e-18
WP_129019429.1|2069652_2069850_+	hypothetical protein	NA	K7PHN9	Enterobacterial_phage	61.9	9.2e-17
WP_049525572.1|2069846_2070149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050294067.1|2070145_2070544_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050294069.1|2070540_2070780_+	DUF4752 family protein	NA	T1S9K2	Salmonella_phage	58.7	4.5e-18
WP_050294071.1|2070783_2071233_+	DUF1367 family protein	NA	A0A0P0ZFW0	Escherichia_phage	70.5	5.3e-60
WP_050294074.1|2071452_2071836_+	HNH endonuclease	NA	A0A2R2Z2X9	Escherichia_phage	75.2	8.5e-51
WP_050294075.1|2071975_2072305_+	DUF2591 family protein	NA	R9VYJ6	Serratia_phage	52.8	3.3e-19
WP_050294079.1|2072306_2072957_+	serine/threonine protein phosphatase	NA	Q716B9	Shigella_phage	61.1	8.5e-75
WP_155295585.1|2073132_2073297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050156987.1|2073411_2074047_+	hypothetical protein	NA	H6WRY9	Salmonella_phage	44.9	1.9e-42
WP_050156985.1|2074043_2074235_+	protein ninH	NA	Q777W6	Enterobacteria_phage	59.3	1.1e-09
WP_050156984.1|2074231_2074720_+	antiterminator	NA	M1FPN0	Enterobacteria_phage	67.9	2.4e-58
WP_050344746.1|2075023_2075557_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042570178.1|2075754_2076069_+|holin	holin	holin	NA	NA	NA	NA
WP_050294008.1|2076071_2076515_+	lysozyme	NA	R9TMH8	Aeromonas_phage	57.3	2.1e-40
WP_050294009.1|2076511_2076970_+|lysis	lysis protein	lysis	A5LH84	Enterobacteria_phage	46.4	2.1e-24
WP_050127912.1|2077495_2078023_+	KilA-N domain-containing protein	NA	A0A1V0E5P7	Salmonella_phage	55.4	3.0e-46
WP_050127911.1|2078019_2078403_+	hypothetical protein	NA	A0A192Y658	Salmonella_phage	41.6	5.6e-18
WP_050127910.1|2078478_2078718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050127908.1|2078841_2079477_+	hypothetical protein	NA	H9C189	Pectobacterium_phage	71.0	4.7e-86
WP_050127906.1|2079510_2079960_+	DUF2280 domain-containing protein	NA	I6S1P9	Salmonella_phage	72.9	5.1e-47
WP_050127904.1|2079969_2081457_+	hypothetical protein	NA	A0A1W6JNY3	Morganella_phage	76.5	7.0e-226
WP_050156791.1|2081531_2082869_+	DUF4055 domain-containing protein	NA	A0A0S2SYJ5	Pseudomonas_phage	43.7	7.5e-94
WP_050156790.1|2082987_2083740_+	hypothetical protein	NA	G8C7P6	Escherichia_phage	47.6	3.2e-57
WP_050127902.1|2083755_2084880_+|coat	P22 coat - protein 5 family protein	coat	W6EBZ8	Rhizobium_phage	56.7	9.1e-101
WP_154236072.1|2084930_2085101_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050156786.1|2085100_2085493_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050127901.1|2085495_2086134_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050127899.1|2086135_2086939_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050127897.1|2086955_2087150_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050294010.1|2087210_2088764_+|tail	phage tail protein	tail	B3GAJ6	uncultured_virus	44.8	2.1e-95
WP_050127893.1|2088813_2089245_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050127891.1|2089265_2089643_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050127914.1|2089818_2090304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050127890.1|2090362_2090698_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_071890470.1|2090805_2090970_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_050294012.1|2091843_2092620_+	hypothetical protein	NA	A0A077SL47	Escherichia_phage	44.3	2.4e-39
WP_050127887.1|2092739_2093087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050127885.1|2093157_2095296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154236071.1|2095379_2095739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050294015.1|2096120_2097110_+	hypothetical protein	NA	S5MNM1	Brevibacillus_phage	35.0	1.3e-13
WP_050127882.1|2097112_2098228_+	type IV secretion protein Rhs	NA	NA	NA	NA	NA
WP_050127881.1|2098224_2098851_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050127880.1|2098858_2099224_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080357946.1|2099285_2100356_+|plate	baseplate protein	plate	B3GAJ9	uncultured_virus	40.4	2.6e-52
WP_050127878.1|2100356_2101019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129019401.1|2101091_2103266_+	hypothetical protein	NA	A9YX14	Burkholderia_phage	40.0	5.2e-52
WP_049525621.1|2103262_2103478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005158292.1|2105142_2105328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069009664.1|2106043_2107141_+	Fic family protein	NA	NA	NA	NA	NA
WP_080478647.1|2107581_2108148_-	potassium-transporting ATPase subunit A	NA	Q7M2A8	Enterobacteria_phage	44.8	9.4e-38
WP_080478635.1|2108377_2109775_-	hypothetical protein	NA	Q8LTT9	Enterobacteria_phage	47.4	4.8e-59
WP_049525217.1|2110074_2110398_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164971237.1|2110390_2110543_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049525216.1|2110556_2110757_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_005158310.1|2110971_2111304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005158312.1|2111664_2112030_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020283429.1|2112254_2112902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005158316.1|2112886_2113225_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049525882.1|2113718_2113949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049525883.1|2114351_2114834_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038892054.1|2114940_2115321_+	DNA polymerase V	NA	K7P6F7	Enterobacteria_phage	68.0	6.9e-45
WP_049528964.1|2116471_2117161_-	heavy metal response regulator transcription factor	NA	W8CYM9	Bacillus_phage	34.7	8.8e-30
WP_049525886.1|2117396_2118446_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_023160836.1|2118605_2119625_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP016937	Yersinia enterocolitica strain YE6 chromosome, complete genome	4807490	2588194	2600857	4807490		Vaccinia_virus(16.67%)	8	NA	NA
WP_049526354.1|2588194_2591347_-	beta-galactosidase	NA	B9U1H7	Vaccinia_virus	62.9	0.0e+00
WP_005164513.1|2591525_2592560_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	50.3	1.4e-84
WP_002210893.1|2593041_2593254_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	80.0	2.0e-25
WP_071530598.1|2593462_2593699_+	protein DsrB	NA	NA	NA	NA	NA
WP_013649692.1|2593832_2595572_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.4	1.1e-09
WP_005177868.1|2596436_2596676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049526360.1|2597239_2597938_+	MgtC family protein	NA	G3MA03	Bacillus_virus	41.8	3.6e-15
WP_069009161.1|2598154_2600857_+	magnesium-translocating P-type ATPase	NA	M1HM40	Paramecium_bursaria_Chlorella_virus	25.2	9.4e-43
>prophage 6
NZ_CP016937	Yersinia enterocolitica strain YE6 chromosome, complete genome	4807490	2708496	2774119	4807490	holin,tRNA,tail,lysis,transposase	Salmonella_phage(17.65%)	61	NA	NA
WP_049526451.1|2708496_2708943_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	47.3	9.4e-33
WP_049526452.1|2708939_2709407_-|tail	phage tail protein	tail	F1BUP9	Erwinia_phage	56.6	1.3e-40
WP_069009185.1|2709508_2709925_-|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	40.6	8.8e-17
WP_013649751.1|2709937_2710333_-	M15 family metallopeptidase	NA	A9DET4	Yersinia_phage	71.0	5.9e-47
WP_013649752.1|2710319_2710499_-|holin	holin	holin	NA	NA	NA	NA
WP_071598556.1|2710492_2710795_-	hypothetical protein	NA	A0A077KEQ8	Ralstonia_phage	68.7	2.6e-26
WP_049526453.1|2711596_2713033_-|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	39.1	2.9e-83
WP_049526455.1|2713339_2714548_-	MFS transporter	NA	NA	NA	NA	NA
WP_069009186.1|2714650_2715568_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013649756.1|2716173_2716593_-	helix-turn-helix domain-containing protein	NA	A0A0M4REM4	Salmonella_phage	31.1	9.8e-16
WP_049526459.1|2716993_2717638_+	CatB-related O-acetyltransferase	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	31.3	8.0e-17
WP_005161392.1|2717780_2717963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049529016.1|2718387_2718804_+	antitermination protein Q	NA	K7PGW2	Enterobacterial_phage	63.0	8.1e-39
WP_005161372.1|2718980_2719157_-	GhoT/OrtT family toxin	NA	NA	NA	NA	NA
WP_005161370.1|2719383_2719560_+	hypothetical protein	NA	B6SD15	Bacteriophage	60.7	2.2e-14
WP_049526462.1|2719561_2720044_+	lysozyme	NA	A0A2H4JCH1	uncultured_Caudovirales_phage	63.1	2.7e-54
WP_049526464.1|2720416_2721301_+	triacylglycerol lipase	NA	NA	NA	NA	NA
WP_005161358.1|2721602_2722259_+	DUF533 domain-containing protein	NA	NA	NA	NA	NA
WP_013649759.1|2722365_2723250_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_049529017.1|2723384_2724551_+	class C beta-lactamase	NA	NA	NA	NA	NA
WP_049526465.1|2724697_2725789_-	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_005161346.1|2726056_2726515_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049526468.1|2726569_2727163_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_005161340.1|2727494_2727767_+	stress-induced protein YchH	NA	NA	NA	NA	NA
WP_004390739.1|2728252_2729200_-	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	38.2	2.7e-45
WP_049526470.1|2729397_2730279_-	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_049526472.1|2730280_2730904_-	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_005161325.1|2731209_2732472_+|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_005161322.1|2732503_2733586_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	42.1	5.6e-07
WP_005161319.1|2733585_2734440_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_013649766.1|2734457_2734859_+	SirB2 family protein	NA	NA	NA	NA	NA
WP_049526475.1|2734855_2735665_+	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_049526477.1|2735809_2736664_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	39.3	2.2e-46
WP_049526479.1|2736737_2738438_-	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	24.3	4.0e-23
WP_005161308.1|2738993_2740112_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.4	1.5e-18
WP_050127634.1|2742008_2742950_+	glyoxylate/hydroxypyruvate reductase GhrA	NA	NA	NA	NA	NA
WP_049526481.1|2743098_2743836_+	phosphatase	NA	NA	NA	NA	NA
WP_005161295.1|2743899_2744460_+	molecular chaperone	NA	NA	NA	NA	NA
WP_005161292.1|2744497_2745061_-	lipoprotein	NA	NA	NA	NA	NA
WP_005161289.1|2745277_2746483_-	multidrug efflux MFS transporter MdtH	NA	NA	NA	NA	NA
WP_005161286.1|2747157_2747475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050293987.1|2747486_2748221_-	DUF4225 domain-containing protein	NA	NA	NA	NA	NA
WP_049526484.1|2748897_2749482_+	ribosomal protein S5-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_014608990.1|2749489_2750131_+	YceH family protein	NA	NA	NA	NA	NA
WP_112999213.1|2750141_2751083_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_049526486.1|2751221_2752757_+	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_005178667.1|2753076_2754186_-	sodium-potassium/proton antiporter ChaA	NA	NA	NA	NA	NA
WP_049526488.1|2754406_2755243_-	siderophore-interacting protein	NA	NA	NA	NA	NA
WP_049526492.1|2755431_2756598_-	MFS transporter	NA	NA	NA	NA	NA
WP_069017988.1|2757093_2758113_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_049526495.1|2759516_2761298_-	nitrate/nitrite two-component system sensor histidine kinase NarX	NA	NA	NA	NA	NA
WP_005178681.1|2761362_2761524_-	DUF2474 domain-containing protein	NA	NA	NA	NA	NA
WP_005161249.1|2761524_2762532_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_005161246.1|2762534_2763983_-	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_005161245.1|2764167_2765601_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_049526497.1|2766193_2767438_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	28.0	1.2e-24
WP_005161241.1|2767480_2768518_+	arginine N-succinyltransferase	NA	NA	NA	NA	NA
WP_049526499.1|2768514_2769996_+	succinylglutamate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_049526500.1|2770038_2771382_+	N-succinylarginine dihydrolase	NA	NA	NA	NA	NA
WP_005161236.1|2771446_2772439_+	succinylglutamate desuccinylase	NA	NA	NA	NA	NA
WP_023160836.1|2773099_2774119_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP016937	Yersinia enterocolitica strain YE6 chromosome, complete genome	4807490	2850687	2910152	4807490	coat,protease,tRNA,transposase	Bacillus_phage(28.57%)	55	NA	NA
WP_005164931.1|2850687_2851245_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_049526568.1|2851256_2851814_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_069009194.1|2851819_2852356_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_049526570.1|2852683_2854105_-	MFS transporter	NA	NA	NA	NA	NA
WP_049526572.1|2854232_2855153_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_049526574.1|2855165_2857796_-	PqiB family protein	NA	NA	NA	NA	NA
WP_049526576.1|2857764_2859012_-	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_013649820.1|2859252_2859750_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_005170218.1|2859845_2860574_+	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_005164944.1|2860593_2862669_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	35.4	4.3e-88
WP_005164945.1|2862965_2863847_+|protease	protease HtpX	protease	NA	NA	NA	NA
WP_049526580.1|2863881_2864007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005164950.1|2865724_2866891_+	oligogalacturonate lyase	NA	NA	NA	NA	NA
WP_005164952.1|2867077_2867869_+	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
WP_005164953.1|2868144_2868996_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1W6DX33	Sphingobium_phage	29.5	4.3e-10
WP_005161706.1|2870686_2871235_-	metal-dependent hydrolase	NA	A0A127AVX7	Bacillus_phage	33.3	2.9e-07
WP_049526582.1|2871318_2871519_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013649825.1|2871592_2872291_-	porin	NA	NA	NA	NA	NA
WP_049526584.1|2872600_2873893_-	carbohydrate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005161697.1|2873908_2875036_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.5	3.0e-11
WP_005161693.1|2875049_2875967_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_005161668.1|2875959_2876850_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_069009197.1|2876890_2878558_-	pectate lyase	NA	NA	NA	NA	NA
WP_069009678.1|2878885_2879647_-	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.9	4.5e-19
WP_013649826.1|2879758_2880595_-	5-dehydro-4-deoxy-D-glucuronate isomerase	NA	NA	NA	NA	NA
WP_005170147.1|2880832_2881165_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_049526590.1|2881269_2882472_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	71.0	5.8e-77
WP_005161643.1|2882581_2883247_-	hexitol phosphatase HxpB	NA	NA	NA	NA	NA
WP_005170142.1|2883496_2884051_+	yfeABCD regulator yfeE	NA	NA	NA	NA	NA
WP_049526592.1|2884259_2885150_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_049526593.1|2885146_2886628_-	succinate CoA transferase	NA	NA	NA	NA	NA
WP_005161631.1|2886653_2887439_-	methylmalonyl-CoA decarboxylase	NA	NA	NA	NA	NA
WP_013649829.1|2887452_2888448_-	methylmalonyl Co-A mutase-associated GTPase MeaB	NA	NA	NA	NA	NA
WP_049526595.1|2890862_2891732_-	fructosamine kinase family protein	NA	NA	NA	NA	NA
WP_049526597.1|2892363_2893239_-	iron/manganese ABC transporter permease subunit YfeD	NA	NA	NA	NA	NA
WP_049526599.1|2893235_2894120_-	iron/manganese ABC transporter permease subunit YfeC	NA	NA	NA	NA	NA
WP_049526600.1|2894119_2895010_-	iron/manganese ABC transporter ATP-binding protein YfeB	NA	W8CYL7	Bacillus_phage	29.7	7.7e-10
WP_049526602.1|2895006_2895975_-	iron/manganese ABC transporter substrate-binding protein YfeA	NA	NA	NA	NA	NA
WP_005161592.1|2896186_2896849_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_005161586.1|2897211_2897895_-	MarC family NAAT transporter	NA	NA	NA	NA	NA
WP_005161584.1|2898335_2898587_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005161581.1|2899059_2899296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049526607.1|2899361_2899541_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005161576.1|2900065_2900779_+	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_005161573.1|2900898_2901111_-	KTSC domain-containing protein	NA	A0A0K1LMB5	Caulobacter_phage	42.0	9.9e-09
WP_049526612.1|2901434_2903363_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.2	8.8e-128
WP_011816226.1|2903366_2903918_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.7	3.4e-16
WP_004713020.1|2904014_2904212_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_004393357.1|2904249_2904606_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_152414234.1|2904674_2904722_+	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_005161570.1|2905070_2906054_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	5.8e-35
WP_049526614.1|2906068_2908456_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	27.8	1.1e-07
WP_002211830.1|2908460_2908757_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	4.2e-13
WP_071828211.1|2908969_2909140_-	NINE protein	NA	M4ZS56	Bacillus_phage	62.5	1.0e-08
WP_049525161.1|2909120_2910152_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP016937	Yersinia enterocolitica strain YE6 chromosome, complete genome	4807490	3117408	3148111	4807490	lysis,terminase	Escherichia_phage(34.48%)	43	NA	NA
WP_049526752.1|3117408_3118134_-	hypothetical protein	NA	A0A0U2JGI7	Escherichia_phage	35.9	5.1e-28
WP_069009220.1|3118133_3119954_-	hypothetical protein	NA	A0A2R3UAN6	Myoviridae_environmental_samples	42.7	1.7e-19
WP_049526756.1|3120077_3120653_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069009223.1|3120656_3121094_-	hypothetical protein	NA	A0A0U2S616	Escherichia_phage	39.6	2.0e-24
WP_049526761.1|3121097_3122492_-	hypothetical protein	NA	A0A0U2KD19	Escherichia_phage	36.4	2.6e-65
WP_049526763.1|3122496_3123438_-	hypothetical protein	NA	A0A0U2SH76	Escherichia_phage	37.3	1.3e-52
WP_049526765.1|3123421_3123856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049526766.1|3123852_3124281_-	hypothetical protein	NA	A0A0U2S646	Escherichia_phage	39.1	7.1e-22
WP_049526768.1|3124281_3124761_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057619021.1|3124829_3125861_-	hypothetical protein	NA	A0A0U2QQI2	Escherichia_phage	46.6	5.1e-74
WP_057619022.1|3125877_3126744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069009681.1|3126759_3128361_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_049526771.1|3128395_3129217_-	hypothetical protein	NA	A0A0U2I1R8	Escherichia_phage	41.4	4.0e-53
WP_050293991.1|3129213_3130629_-	DUF1073 domain-containing protein	NA	A0A0U2S5X9	Escherichia_phage	37.3	1.4e-85
WP_049526775.1|3130641_3131964_-|terminase	terminase	terminase	A0A0U2JTW9	Escherichia_phage	59.7	4.9e-154
WP_049529053.1|3131965_3132688_-	hypothetical protein	NA	A0A1I9KFG9	Aeromonas_phage	29.3	2.6e-16
WP_049525819.1|3132833_3133295_-|lysis	lysis protein	lysis	A5LH84	Enterobacteria_phage	43.0	1.7e-21
WP_049526777.1|3133279_3133792_-	lysozyme	NA	I6PBN2	Cronobacter_phage	59.9	2.4e-48
WP_049528949.1|3133791_3134073_-	hypothetical protein	NA	H6WRZ3	Salmonella_phage	54.3	1.1e-18
WP_049525816.1|3134290_3134824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049525578.1|3135232_3135838_-	hypothetical protein	NA	Q8HA89	Salmonella_phage	40.7	1.4e-39
WP_049525577.1|3135834_3136443_-	protein ninG	NA	K7PHP1	Enterobacterial_phage	60.9	1.0e-53
WP_049525575.1|3137064_3137535_-	recombination protein NinB	NA	I6R9D0	Salmonella_phage	53.9	2.6e-41
WP_164971241.1|3137527_3137689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049525574.1|3137678_3137876_-	hypothetical protein	NA	A0A2H4FUS3	Salmonella_phage	42.2	5.1e-07
WP_049526787.1|3137875_3138370_-	DUF551 domain-containing protein	NA	E7C9P2	Salmonella_phage	32.5	4.5e-12
WP_069009034.1|3138366_3138669_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129019429.1|3138665_3138863_-	hypothetical protein	NA	K7PHN9	Enterobacterial_phage	61.9	9.2e-17
WP_049526791.1|3139003_3139858_-	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	57.3	2.2e-86
WP_069009228.1|3139854_3140679_-	replication protein	NA	A0A075B8J2	Enterobacteria_phage	52.7	7.5e-36
WP_050156967.1|3140675_3141278_-	hypothetical protein	NA	M1F3E2	Salmonella_phage	42.1	5.5e-36
WP_049526795.1|3141302_3141596_-	hypothetical protein	NA	A2SY75	Escherichia_phage	62.9	1.4e-24
WP_049526797.1|3141710_3141929_-	helix-turn-helix transcriptional regulator	NA	I6S1U2	Salmonella_phage	62.7	3.7e-19
WP_049526799.1|3142035_3142701_+	LexA family transcriptional regulator	NA	A0A286S2B2	Klebsiella_phage	61.5	1.6e-73
WP_049526801.1|3142788_3143352_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049526803.1|3143348_3144101_+	DUF1828 domain-containing protein	NA	NA	NA	NA	NA
WP_049529057.1|3144156_3144366_-	DUF2767 family protein	NA	I6R0R9	Salmonella_phage	47.5	1.3e-05
WP_049525565.1|3144864_3145149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154236085.1|3145151_3145310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071828178.1|3145514_3145694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049525796.1|3145852_3146194_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049525794.1|3146709_3147003_+	hypothetical protein	NA	A0A0B4SK56	Proteus_phage	31.3	7.6e-07
WP_050293951.1|3147091_3148111_+	hypothetical protein	NA	K7P6J9	Enterobacteria_phage	65.3	1.8e-31
>prophage 9
NZ_CP016937	Yersinia enterocolitica strain YE6 chromosome, complete genome	4807490	3709887	3753945	4807490	protease,transposase	Shigella_phage(16.67%)	32	NA	NA
WP_049527252.1|3709887_3711090_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	72.0	1.5e-77
WP_013650139.1|3711157_3711808_-	DUF1120 domain-containing protein	NA	NA	NA	NA	NA
WP_023160793.1|3712186_3712498_+|transposase	IS3 family transposase	transposase	Q716C1	Shigella_phage	72.2	3.0e-30
WP_023160794.1|3712542_3712947_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	62.7	2.2e-36
WP_049527255.1|3714412_3715444_+	methyltransferase	NA	NA	NA	NA	NA
WP_069009350.1|3715754_3716489_-	carbonic anhydrase	NA	NA	NA	NA	NA
WP_049527261.1|3716764_3718201_-	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
WP_049527265.1|3718304_3719831_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_049527267.1|3719996_3720737_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_049527270.1|3720828_3721200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164971243.1|3721286_3721454_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013650148.1|3721506_3721836_-	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
WP_049527272.1|3721836_3722151_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013650150.1|3722261_3722741_-	antitermination protein Q	NA	K7PGW2	Enterobacterial_phage	59.2	1.4e-34
WP_005159354.1|3723014_3723638_+	helix-turn-helix domain-containing protein	NA	F1C599	Cronobacter_phage	53.2	1.6e-51
WP_005159352.1|3723984_3724227_+	DinI family protein	NA	K7PKM2	Enterobacterial_phage	70.9	5.1e-25
WP_049527276.1|3724391_3725327_+|protease	omptin family outer membrane protease	protease	NA	NA	NA	NA
WP_049527278.1|3725652_3727440_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	48.9	6.2e-11
WP_049527280.1|3727509_3728499_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_049527284.1|3728912_3730439_+	MFS transporter	NA	NA	NA	NA	NA
WP_005171542.1|3730618_3731761_+	D-alanyl-D-alanine- carboxypeptidase/endopeptidase AmpH	NA	NA	NA	NA	NA
WP_049527286.1|3732275_3733379_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	58.3	3.0e-112
WP_013650153.1|3735827_3736982_+	MFS transporter	NA	NA	NA	NA	NA
WP_013650154.1|3737004_3739698_+	phosphotransferase RcsD	NA	NA	NA	NA	NA
WP_005159308.1|3739700_3740348_+	transcriptional regulator RcsB	NA	NA	NA	NA	NA
WP_069009695.1|3740609_3743477_-	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	28.4	9.9e-43
WP_013650157.1|3743594_3746252_-	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	A0A172JHV7	Bacillus_phage	30.9	1.0e-102
WP_049527294.1|3746455_3747184_+	bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG	NA	NA	NA	NA	NA
WP_013650159.1|3747700_3749986_+	ribonucleoside-diphosphate reductase subunit alpha	NA	I3UMG3	Colwellia_phage	65.1	9.3e-286
WP_005159298.1|3750071_3751202_+	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	79.4	4.0e-173
WP_020283002.1|3751846_3752353_+|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_158506293.1|3752439_3753945_-|protease	calcium-dependent protease	protease	NA	NA	NA	NA
>prophage 10
NZ_CP016937	Yersinia enterocolitica strain YE6 chromosome, complete genome	4807490	4375748	4440878	4807490	tRNA,integrase,transposase,protease	Bacillus_phage(13.33%)	56	4385405:4385458	4399446:4399499
WP_042663659.1|4375748_4376768_+|transposase	IS110-like element ISYen1 family transposase	transposase	NA	NA	NA	NA
WP_049527926.1|4377186_4378431_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	33.9	3.1e-17
WP_005166615.1|4378513_4378909_-	SgcJ/EcaC family oxidoreductase	NA	NA	NA	NA	NA
WP_049527931.1|4380245_4380446_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_049527934.1|4380588_4381791_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	72.0	1.5e-77
WP_049527936.1|4381867_4382296_-	type II toxin-antitoxin system MqsA family antitoxin	NA	NA	NA	NA	NA
WP_005166025.1|4382295_4382592_-	type II toxin-antitoxin system MqsR family toxin	NA	NA	NA	NA	NA
WP_005166026.1|4382748_4383111_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005166028.1|4383176_4383437_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A1S5NR91	Burkholderia_phage	36.0	2.5e-06
4385405:4385458	attL	TGGAGCGGGTGAAGGGAATCGAACCCTCGTATAGAGCTTGGGAAGCTCTCGTTC	NA	NA	NA	NA
WP_049527941.1|4385520_4386741_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_049527943.1|4386816_4387191_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049527946.1|4387187_4387397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069009460.1|4389020_4389413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_084738254.1|4389821_4390874_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049527955.1|4390923_4391196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049527956.1|4392429_4392672_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049527959.1|4393314_4393638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049527961.1|4393999_4394200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049527964.1|4394226_4395750_-	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_154295071.1|4395770_4395923_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069009462.1|4397043_4397304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049527969.1|4397307_4397538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049527972.1|4398154_4398703_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A141E0P1	Streptococcus_phage	34.4	1.2e-21
WP_013649344.1|4399689_4401207_-|tRNA	lysine--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	37.6	2.3e-86
4399446:4399499	attR	TGGAGCGGGTGAAGGGAATCGAACCCTCGTATAGAGCTTGGGAAGCTCTCGTTC	NA	NA	NA	NA
WP_020282590.1|4401216_4402315_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	5.4e-05
WP_005166036.1|4402760_4404494_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	29.7	1.6e-64
WP_013649342.1|4404500_4405217_-	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_005166040.1|4405265_4406165_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	30.2	2.1e-31
WP_005166042.1|4406271_4406790_+	flavodoxin FldB	NA	NA	NA	NA	NA
WP_049527976.1|4406848_4408270_-	cell envelope integrity protein CreD	NA	NA	NA	NA	NA
WP_049527980.1|4408361_4409789_-	two-component system sensor histidine kinase CreC	NA	NA	NA	NA	NA
WP_005166045.1|4409799_4410498_-	two-component system response regulator CreB	NA	NA	NA	NA	NA
WP_005166047.1|4410497_4410923_-	membrane protein	NA	NA	NA	NA	NA
WP_004390965.1|4410903_4411170_-	FAD assembly factor SdhE	NA	NA	NA	NA	NA
WP_049527983.1|4411436_4412429_+|tRNA	tRNA-modifying protein YgfZ	tRNA	NA	NA	NA	NA
WP_084738255.1|4412624_4413644_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_050155820.1|4414054_4414738_-	hemolysin III family protein	NA	NA	NA	NA	NA
WP_069009466.1|4414968_4415571_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_013649334.1|4415583_4416333_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.5	2.6e-27
WP_049527993.1|4416348_4416786_-	lipocalin-like domain-containing protein	NA	NA	NA	NA	NA
WP_049527996.1|4417119_4420008_-	aminomethyl-transferring glycine dehydrogenase	NA	M4QFZ1	Prochlorococcus_phage	52.7	4.2e-267
WP_005164125.1|4420107_4420494_-	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_013649331.1|4420560_4421658_-	glycine cleavage system aminomethyltransferase GcvT	NA	NA	NA	NA	NA
WP_023160249.1|4422050_4423265_-	FAD-dependent 2-octaprenylphenol hydroxylase	NA	NA	NA	NA	NA
WP_050126799.1|4423352_4424522_-	2-octaprenyl-6-methoxyphenyl hydroxylase	NA	NA	NA	NA	NA
WP_069009468.1|4424525_4425839_-	Xaa-Pro aminopeptidase	NA	NA	NA	NA	NA
WP_005164114.1|4425893_4426472_-	YecA family protein	NA	NA	NA	NA	NA
WP_004706812.1|4426927_4427257_+	cell division protein ZapA	NA	NA	NA	NA	NA
WP_005164106.1|4427760_4428357_+	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_005164105.1|4428502_4429798_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	58.0	2.2e-130
WP_013649329.1|4429877_4431515_-	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.7	1.6e-154
WP_013649328.1|4431726_4432563_-	nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_005164102.1|4432850_4435085_-	GTP diphosphokinase	NA	NA	NA	NA	NA
WP_049528014.1|4435094_4436426_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	27.4	5.1e-34
WP_049528017.1|4436482_4439347_+	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	29.2	2.7e-48
WP_013649325.1|4439441_4440878_-|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	31.0	5.0e-27
>prophage 11
NZ_CP016937	Yersinia enterocolitica strain YE6 chromosome, complete genome	4807490	4761453	4765942	4807490	transposase	uncultured_Caudovirales_phage(66.67%)	6	NA	NA
WP_050294038.1|4761453_4762152_-	arsenic resistance NADPH-dependent reductase ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	68.1	4.2e-88
WP_013749489.1|4762237_4762558_+	As(III)-sensing metalloregulatory transcriptional repressor ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	46.7	1.7e-20
WP_057618950.1|4762603_4763893_+	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	70.4	7.1e-166
WP_010891244.1|4763905_4764331_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	5.6e-51
WP_050294040.1|4764348_4764930_-	recombinase family protein	NA	A0A219Y9V9	Aeromonas_phage	34.8	1.1e-20
WP_071890451.1|4765105_4765942_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	68.1	2.9e-51
>prophage 1
NZ_CP016938	Yersinia enterocolitica strain YE6 plasmid unnamed1, complete sequence	115648	6963	53984	115648	transposase,integrase	Escherichia_phage(35.71%)	30	40471:40485	56956:56970
WP_129019443.1|6963_7737_+|integrase	tyrosine-type recombinase/integrase	integrase	I3WFA4	Macacine_betaherpesvirus	81.4	6.1e-48
WP_050127681.1|7920_8559_+	recombinase family protein	NA	NA	NA	NA	NA
WP_057618893.1|9195_11142_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_164971253.1|11387_13085_+	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	A0A0R6PI85	Moraxella_phage	28.3	9.7e-38
WP_050127682.1|13121_13841_+	filamentous hemagglutinin N-terminal domain-containing protein	NA	A0A0R6PJK4	Moraxella_phage	43.7	2.5e-35
WP_071891490.1|16010_16385_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069009764.1|16583_17231_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.0	7.3e-10
WP_050128091.1|17511_18147_+	ParA family protein	NA	NA	NA	NA	NA
WP_050128092.1|18209_18503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129019436.1|19956_20653_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	1.9e-40
WP_050128033.1|20667_20910_-|transposase	IS3 family transposase	transposase	Q716C1	Shigella_phage	64.7	3.3e-16
WP_069017906.1|21166_26017_+	hypothetical protein	NA	A0A1W5K0N1	Bacteriophage	33.8	2.1e-178
WP_069009758.1|26239_28963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164971249.1|30927_31464_+	CaiF/GrlA family transcriptional regulator	NA	NA	NA	NA	NA
WP_129019437.1|31915_32613_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	5.5e-40
WP_057619012.1|32698_34306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050128037.1|34321_35743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050128036.1|35809_36478_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057619010.1|36526_39487_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069009830.1|39563_40358_-	hypothetical protein	NA	B6SD27	Bacteriophage	34.6	1.1e-23
40471:40485	attL	TAACATGTTGTTTTT	NA	NA	NA	NA
WP_129019438.1|40623_41320_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	43.6	2.9e-41
WP_164971250.1|41794_42115_-	CaiF/GrlA family transcriptional regulator	NA	NA	NA	NA	NA
WP_071891488.1|42844_43735_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_129019439.1|43874_44571_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	43.6	1.0e-41
WP_050128083.1|44808_47616_-	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_129019440.1|48048_48742_-|transposase	IS6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	36.4	1.4e-35
WP_069009821.1|48939_49443_+	Dabb family protein	NA	NA	NA	NA	NA
WP_129019439.1|49801_50498_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	43.6	1.0e-41
WP_069009811.1|51100_51829_-	DUF4145 domain-containing protein	NA	NA	NA	NA	NA
WP_057618936.1|53213_53984_+|integrase	tyrosine-type recombinase/integrase	integrase	I3WFA4	Macacine_betaherpesvirus	52.0	8.9e-23
56956:56970	attR	AAAAACAACATGTTA	NA	NA	NA	NA
