The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP016945	Yersinia enterocolitica strain YE1 chromosome, complete genome	4668139	93607	181578	4668139	integrase,transposase,bacteriocin	Enterobacterial_phage(33.33%)	58	178558:178574	196015:196031
WP_057618920.1|93607_93859_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_005162673.1|94141_94396_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_005162670.1|94708_95068_+	antitermination protein	NA	K7PGW2	Enterobacterial_phage	47.5	1.7e-21
WP_032904442.1|95170_95929_-	molecular chaperone	NA	NA	NA	NA	NA
WP_069008913.1|100043_100772_-	molecular chaperone	NA	NA	NA	NA	NA
WP_049525161.1|100916_101948_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_005165289.1|102890_103853_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_049528679.1|103886_104360_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_049528676.1|105608_106463_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_005165296.1|106691_107060_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129019424.1|107123_107276_-	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_005166182.1|108722_110186_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_069008916.1|110418_111825_-	filamentous hemagglutinin N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_016266334.1|113788_114253_-	Large exoprotein involved in heme utilization or adhesion	NA	NA	NA	NA	NA
WP_005166173.1|116921_118454_-	signal transduction histidine-protein kinase/phosphatase UhpB	NA	NA	NA	NA	NA
WP_049528662.1|118450_119041_-	transcriptional regulator UhpA	NA	NA	NA	NA	NA
WP_050127428.1|119152_120844_-	kdo(2)-lipid A phosphoethanolamine 7''-transferase	NA	NA	NA	NA	NA
WP_048618714.1|121103_121529_-	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
WP_023160836.1|121999_123019_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_069008919.1|123830_125438_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005157323.1|125720_126740_+	dipeptide ABC transporter permease DppB	NA	NA	NA	NA	NA
WP_049525223.1|126750_127653_+	dipeptide ABC transporter permease DppC	NA	NA	NA	NA	NA
WP_049525224.1|127668_128649_+	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.9	2.5e-14
WP_005157326.1|128663_129668_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.7	1.7e-18
WP_049525225.1|130010_131663_-	cellulose biosynthesis protein BcsG	NA	NA	NA	NA	NA
WP_005157335.1|131665_131854_-	cellulose biosynthesis protein BcsF	NA	NA	NA	NA	NA
WP_049525226.1|131850_133410_-	cellulose biosynthesis protein BcsE	NA	NA	NA	NA	NA
WP_005157340.1|133607_133799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013650602.1|133802_134540_+	cellulose synthase operon protein YhjQ	NA	NA	NA	NA	NA
WP_049525228.1|134536_137164_+	UDP-forming cellulose synthase catalytic subunit	NA	NA	NA	NA	NA
WP_049528808.1|137174_139478_+	cellulose biosynthesis cyclic di-GMP-binding regulatory protein BcsB	NA	NA	NA	NA	NA
WP_057618858.1|139483_140611_+	cellulase	NA	NA	NA	NA	NA
WP_069008921.1|140592_143967_+	cellulose biosynthesis protein BcsC	NA	NA	NA	NA	NA
WP_069008922.1|144230_145727_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_005157352.1|146451_147156_+	porin	NA	NA	NA	NA	NA
WP_005157353.1|147232_148951_+	pectate lyase	NA	NA	NA	NA	NA
WP_069008923.1|149075_149555_+	discoidin domain-containing protein	NA	NA	NA	NA	NA
WP_005157357.1|149932_151225_+	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_005157359.1|151639_153130_+	insulinase family protein	NA	NA	NA	NA	NA
WP_005157362.1|153289_154234_-	sugar kinase	NA	NA	NA	NA	NA
WP_004388926.1|154378_154579_-	4-oxalocrotonate tautomerase family protein	NA	NA	NA	NA	NA
WP_049525232.1|154817_155609_+	cyclic-guanylate-specific phosphodiesterase	NA	NA	NA	NA	NA
WP_049525233.1|157883_158648_-	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_049525234.1|158671_159661_-	inner membrane protein YhjD	NA	NA	NA	NA	NA
WP_069008925.1|160077_163320_+	autotransporter adhesin YapE	NA	NA	NA	NA	NA
WP_005157379.1|163678_165031_-	glutathione-disulfide reductase	NA	NA	NA	NA	NA
WP_049525236.1|165274_166117_-	23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ	NA	NA	NA	NA	NA
WP_023160901.1|166453_168496_+	oligopeptidase A	NA	NA	NA	NA	NA
WP_020283527.1|168499_169258_+	16S rRNA (guanine(1516)-N(2))-methyltransferase RsmJ	NA	NA	NA	NA	NA
WP_013650589.1|169324_170566_-	M10 family metallopeptidase	NA	NA	NA	NA	NA
WP_049525237.1|170788_172132_-	NADP-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_005157389.1|172395_172842_-	universal stress protein UspA	NA	NA	NA	NA	NA
WP_023160836.1|173588_174608_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_005157391.1|175094_175430_+	universal stress protein UspB	NA	NA	NA	NA	NA
WP_005157393.1|175536_177033_-	inorganic phosphate transporter PitA	NA	NA	NA	NA	NA
WP_069008927.1|177344_178580_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
178558:178574	attL	AGACAATAAAGTTTGTC	NA	NA	NA	NA
WP_049525240.1|178628_179456_+	TnsA endonuclease N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_084743391.1|179523_181578_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
196015:196031	attR	GACAAACTTTATTGTCT	NA	NA	NA	NA
>prophage 2
NZ_CP016945	Yersinia enterocolitica strain YE1 chromosome, complete genome	4668139	451140	583151	4668139	terminase,tRNA,tail,head,transposase,protease,capsid,integrase,plate,holin	Cronobacter_phage(39.47%)	113	450836:450864	538603:538631
450836:450864	attL	CGCCATATATGGACGCTCCCAATAAACCA	NA	NA	NA	NA
WP_042663659.1|451140_452160_-|transposase	IS110-like element ISYen1 family transposase	transposase	NA	NA	NA	NA
WP_005174358.1|452357_453278_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	53.5	8.0e-79
WP_049525329.1|453636_455049_-	anion permease	NA	NA	NA	NA	NA
WP_005163087.1|455558_455771_-	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	80.0	4.4e-25
WP_005163090.1|456042_456255_-	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	80.0	1.7e-24
WP_005163093.1|456636_457107_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_002210061.1|458980_459277_-	DNA-binding transcriptional regulator Fis	NA	NA	NA	NA	NA
WP_005163099.1|459297_460263_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_005163101.1|460705_461587_-	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_049525330.1|461678_463133_-	sodium/pantothenate symporter	NA	NA	NA	NA	NA
WP_005163104.1|463122_463365_-	YhdT family protein	NA	NA	NA	NA	NA
WP_005163110.1|463503_464853_-	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_005163113.1|464864_465329_-	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_049525331.1|465361_465814_-	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_049525332.1|466022_466622_-	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_005163122.1|466621_467656_-	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_005163130.1|467809_468787_-	oxidoreductase	NA	NA	NA	NA	NA
WP_069008954.1|469071_470991_+	RNase E specificity factor CsrD	NA	NA	NA	NA	NA
WP_002228205.1|471325_472369_+	rod shape-determining protein MreB	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.0e-06
WP_005163136.1|472468_473455_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_005163138.1|473451_473940_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_005180107.1|473953_474547_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_049525335.1|474536_476006_+	ribonuclease G	NA	NA	NA	NA	NA
WP_069008956.1|476207_480083_+	AsmA2 domain-containing protein YhdP	NA	NA	NA	NA	NA
WP_005163159.1|480079_480940_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_049525337.1|480951_482397_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_069008958.1|482450_483737_-	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_013650506.1|483733_484012_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_005163183.1|487581_487941_-	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
WP_020282680.1|487937_488339_-	M15 family metallopeptidase	NA	A9DET4	Yersinia_phage	58.4	1.4e-40
WP_005163187.1|488347_488659_-|holin	phage holin family protein	holin	R9W0A1	Serratia_phage	51.2	3.1e-19
WP_069008960.1|488735_493238_-	toxin	NA	NA	NA	NA	NA
WP_050127097.1|493294_496825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005163194.1|500495_501407_-	HTH-type transcriptional activator AaeR	NA	NA	NA	NA	NA
WP_005163197.1|501732_501936_+	AaeX family protein	NA	NA	NA	NA	NA
WP_050127093.1|501943_502879_+	p-hydroxybenzoic acid efflux pump subunit AaeA	NA	NA	NA	NA	NA
WP_069008961.1|502880_504836_+	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
WP_049525342.1|504957_506451_+	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_049525343.1|506548_507022_+	ribonuclease	NA	NA	NA	NA	NA
WP_004392366.1|507026_507293_+	barstar family protein	NA	NA	NA	NA	NA
WP_005163212.1|507324_507870_-	ribosome-associated protein	NA	NA	NA	NA	NA
WP_049525344.1|508007_509000_-|integrase	tyrosine-type recombinase/integrase	integrase	Q83VS6	Escherichia_phage	60.4	2.8e-109
WP_049525345.1|509066_509366_-	helix-turn-helix transcriptional regulator	NA	Q1JS29	Enterobacteria_phage	74.7	4.6e-36
WP_129019376.1|509475_509808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049525347.1|509934_510156_+	DUF2724 domain-containing protein	NA	NA	NA	NA	NA
WP_049525348.1|510170_510527_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049525349.1|510599_510866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049525350.1|510865_511762_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	E5G6L8	Salmonella_phage	51.0	2.8e-76
WP_049525351.1|511758_512796_+	phosphoadenosine phosphosulfate reductase family protein	NA	B7SYG0	Stenotrophomonas_phage	42.6	7.7e-62
WP_069008964.1|512792_515198_+	replication endonuclease	NA	F1BUS0	Erwinia_phage	49.9	1.2e-203
WP_049525352.1|515243_515504_-	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	64.3	1.3e-26
WP_069008967.1|516581_518369_-|terminase	terminase	terminase	F1BUM5	Cronobacter_phage	66.6	4.8e-237
WP_049525354.1|518538_519396_+|capsid	GPO family capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	48.1	2.7e-44
WP_049525355.1|519461_520493_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	76.4	3.6e-144
WP_049525356.1|520502_521201_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	53.9	4.5e-66
WP_072087891.1|521296_521749_+|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	56.0	1.4e-39
WP_049525357.1|521745_522234_+|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	44.8	4.2e-34
WP_049525359.1|523725_524181_+	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	60.9	9.8e-46
WP_049525360.1|524190_524481_+|holin	phage holin family protein	holin	C7BGD7	Burkholderia_phage	50.6	6.7e-16
WP_049525361.1|524477_524819_+	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	82.2	1.4e-44
WP_049525362.1|524818_525160_+	hypothetical protein	NA	F1BUL2	Cronobacter_phage	41.8	4.4e-14
WP_004389570.1|525309_525576_+|tail	putative phage tail assembly chaperone	tail	A5X9I7	Aeromonas_virus	53.7	5.1e-18
WP_057618720.1|525763_527740_+|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	48.5	1.9e-170
WP_049525364.1|527739_528072_+	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	67.3	1.7e-34
WP_049525365.1|528064_529249_+|plate	baseplate J/gp47 family protein	plate	F1BUK6	Cronobacter_phage	67.0	1.3e-153
WP_049525366.1|529241_529850_+	hypothetical protein	NA	F1BUK5	Cronobacter_phage	63.6	9.4e-68
WP_049525367.1|531704_532178_+|tail	tail fiber assembly protein	tail	NA	NA	NA	NA
WP_049525368.1|532167_532899_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	47.1	3.9e-44
WP_049525369.1|535280_535487_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049525370.1|535621_536458_-	abortive infection family protein	NA	NA	NA	NA	NA
WP_069008969.1|536993_538334_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_042663659.1|538883_539903_-|transposase	IS110-like element ISYen1 family transposase	transposase	NA	NA	NA	NA
538603:538631	attR	CGCCATATATGGACGCTCCCAATAAACCA	NA	NA	NA	NA
WP_005162547.1|540434_540821_+	cytochrome b562	NA	NA	NA	NA	NA
WP_005162545.1|540868_541279_-	nucleoside diphosphate kinase regulator	NA	NA	NA	NA	NA
WP_005174305.1|541810_542155_+	glycine dehydrogenase	NA	NA	NA	NA	NA
WP_004392359.1|542178_542544_+	glycine-rich SFCGS family protein	NA	NA	NA	NA	NA
WP_005162543.1|542543_542840_+	DUF4312 family protein	NA	NA	NA	NA	NA
WP_005162542.1|542852_543629_+	DUF4311 domain-containing protein	NA	NA	NA	NA	NA
WP_013650492.1|543650_544301_+	DUF4310 family protein	NA	NA	NA	NA	NA
WP_049525373.1|544384_545554_+	amidohydrolase/deacetylase family metallohydrolase	NA	NA	NA	NA	NA
WP_013650491.1|545537_546650_+	DgaE family pyridoxal phosphate-dependent ammonia lyase	NA	NA	NA	NA	NA
WP_049525374.1|546653_547394_+	KDGP aldolase family protein	NA	NA	NA	NA	NA
WP_072079298.1|548837_550766_+	BglG family transcription antiterminator	NA	NA	NA	NA	NA
WP_049525376.1|550837_551143_-	HigA family addiction module antidote protein	NA	A0A2L1IV52	Escherichia_phage	66.3	1.5e-29
WP_005162526.1|551142_551421_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2L1IV28	Escherichia_phage	77.2	6.0e-38
WP_049525377.1|554724_555672_+	HTH-type transcriptional regulator TreR	NA	NA	NA	NA	NA
WP_049525378.1|557370_559032_+	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_049525379.1|559373_560108_-|protease	proteasome-type protease	protease	NA	NA	NA	NA
WP_005162507.1|560131_560953_-	transglutaminase family protein	NA	NA	NA	NA	NA
WP_005162503.1|560949_561879_-	alpha-E domain-containing protein	NA	NA	NA	NA	NA
WP_011817265.1|561872_563309_-	circularly permuted type 2 ATP-grasp protein	NA	NA	NA	NA	NA
WP_005162498.1|563576_563963_-	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_005162495.1|564456_564921_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_049525380.1|564932_565868_-	aspartate carbamoyltransferase	NA	A7RB08	Paramecium_bursaria_Chlorella_virus	40.2	2.7e-50
WP_005162489.1|566994_567267_-	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_005162486.1|567267_568119_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	29.3	1.9e-05
WP_005162484.1|568197_568680_-	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_005162480.1|568850_569138_-	ribosome hibernation promoting factor	NA	NA	NA	NA	NA
WP_049525381.1|569161_570595_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_004392029.1|570798_571524_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.4	1.6e-21
WP_049525382.1|571530_572076_-	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_049525383.1|572059_572623_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_049525384.1|572619_573183_-	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	79.3	6.9e-57
WP_019080048.1|573196_574201_-	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	29.5	7.5e-38
WP_005162453.1|575371_576175_+	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	31.7	1.3e-19
WP_069008970.1|576189_576972_+	lipid asymmetry maintenance ABC transporter permease subunit MlaE	NA	NA	NA	NA	NA
WP_005162449.1|576976_577537_+	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_005162447.1|577549_578176_+	phospholipid-binding protein MlaC	NA	NA	NA	NA	NA
WP_005180174.1|578178_578520_+	lipid asymmetry maintenance protein MlaB	NA	NA	NA	NA	NA
WP_005162441.1|578694_578949_+	BolA family iron metabolism protein IbaG	NA	NA	NA	NA	NA
WP_005162439.1|579070_580339_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_069009633.1|580600_581689_-	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	33.8	1.4e-10
WP_050127209.1|581777_583151_-|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	29.0	6.0e-22
>prophage 3
NZ_CP016945	Yersinia enterocolitica strain YE1 chromosome, complete genome	4668139	1055868	1102854	4668139	terminase,protease,capsid,lysis,integrase,plate	Edwardsiella_phage(25.93%)	76	1054473:1054486	1072859:1072872
1054473:1054486	attL	TCAGCGGCATTCAT	NA	NA	NA	NA
WP_050294021.1|1055868_1057140_-|integrase	site-specific integrase	integrase	Q8W658	Enterobacteria_phage	52.7	1.4e-126
WP_049525557.1|1057172_1057424_-	excisionase family protein	NA	A0A286S2A4	Klebsiella_phage	50.0	5.8e-16
WP_049525558.1|1057781_1058417_-	DNA methyltransferase	NA	I6PDF5	Cronobacter_phage	73.0	7.2e-87
WP_049525559.1|1058413_1058632_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164971240.1|1058631_1058808_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129019389.1|1059041_1059428_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050128071.1|1059417_1059639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049525779.1|1059663_1059933_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049525781.1|1059934_1060363_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057619046.1|1060359_1060767_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049526811.1|1060808_1060991_-	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	59.6	1.3e-09
WP_057619042.1|1060987_1061923_-	recombinase RecT	NA	A0A193GYL3	Enterobacter_phage	62.5	2.4e-107
WP_069009644.1|1061915_1062734_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	E5AGE0	Erwinia_phage	74.1	2.6e-121
WP_049526808.1|1062733_1063027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129019391.1|1063130_1063262_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	NA	NA	NA	NA
WP_069009030.1|1063279_1064299_-	hypothetical protein	NA	K7P6J9	Enterobacteria_phage	64.4	1.2e-30
WP_049525794.1|1064387_1064681_-	hypothetical protein	NA	A0A0B4SK56	Proteus_phage	31.3	7.6e-07
WP_049525796.1|1065226_1065568_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071828178.1|1065726_1065906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154236085.1|1066110_1066269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050344824.1|1066271_1066568_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049528945.1|1067060_1067270_+	DUF2767 family protein	NA	I6R0R9	Salmonella_phage	47.5	5.9e-06
WP_049525800.1|1067314_1067758_-	hypothetical protein	NA	M1FPN8	Enterobacteria_phage	50.4	4.3e-30
WP_049525803.1|1067775_1068621_-	hypothetical protein	NA	M1FPD4	Enterobacteria_phage	44.3	4.6e-57
WP_012304433.1|1068750_1069473_-	LexA family transcriptional regulator	NA	A0A2R2X2B0	Escherichia_phage	55.5	2.3e-65
WP_042562436.1|1069577_1069772_+	Cro/Cl family transcriptional regulator	NA	K7PLQ6	Enterobacteria_phage	85.5	4.2e-22
WP_050296274.1|1069883_1070177_+	hypothetical protein	NA	A2SY75	Escherichia_phage	63.9	6.1e-25
WP_049526793.1|1070201_1070804_+	hypothetical protein	NA	M1F3E2	Salmonella_phage	41.6	1.6e-35
WP_069009033.1|1070800_1071640_+	replication protein	NA	A0A075B8J2	Enterobacteria_phage	61.9	3.2e-34
WP_050344860.1|1071636_1072491_+	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	57.5	2.2e-86
WP_129019429.1|1072631_1072829_+	hypothetical protein	NA	K7PHN9	Enterobacterial_phage	61.9	9.2e-17
WP_069009034.1|1072825_1073128_+	hypothetical protein	NA	NA	NA	NA	NA
1072859:1072872	attR	ATGAATGCCGCTGA	NA	NA	NA	NA
WP_049526787.1|1073124_1073619_+	DUF551 domain-containing protein	NA	E7C9P2	Salmonella_phage	32.5	4.5e-12
WP_049525574.1|1073618_1073816_+	hypothetical protein	NA	A0A2H4FUS3	Salmonella_phage	42.2	5.1e-07
WP_164971241.1|1073805_1073967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049525575.1|1073959_1074430_+	recombination protein NinB	NA	I6R9D0	Salmonella_phage	53.9	2.6e-41
WP_049525576.1|1074569_1074950_+	hypothetical protein	NA	A0A1B0VBU7	Salmonella_phage	46.7	1.5e-26
WP_049526784.1|1075051_1075342_+	DUF1364 domain-containing protein	NA	A0A220NQY2	Salmonella_phage	75.8	1.3e-38
WP_049526782.1|1075338_1075701_+	RusA family crossover junction endodeoxyribonuclease	NA	E5AGG1	Erwinia_phage	65.8	8.7e-37
WP_049526779.1|1075909_1076734_+	antitermination protein	NA	M9NZB0	Enterobacteria_phage	53.6	1.3e-75
WP_049525816.1|1077207_1077741_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049528949.1|1077958_1078240_+	hypothetical protein	NA	H6WRZ3	Salmonella_phage	54.3	1.1e-18
WP_049526777.1|1078239_1078752_+	lysozyme	NA	I6PBN2	Cronobacter_phage	59.9	2.4e-48
WP_049525819.1|1078736_1079198_+|lysis	lysis protein	lysis	A5LH84	Enterobacteria_phage	43.0	1.7e-21
WP_069009038.1|1079515_1080202_+	Rha family transcriptional regulator	NA	A0A192Y918	Salmonella_phage	86.0	6.5e-110
WP_155296413.1|1080204_1080378_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069009040.1|1080444_1080669_+	hypothetical protein	NA	A0A127KNL9	Pseudomonas_phage	64.7	7.0e-05
WP_069009041.1|1080728_1080929_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069009044.1|1080932_1081124_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069009046.1|1081134_1081611_+|terminase	terminase	terminase	C7U0V7	Enterobacteria_phage	74.1	3.2e-55
WP_069009047.1|1081612_1083289_+|terminase	phage terminase large subunit	terminase	H9C191	Pectobacterium_phage	72.6	7.9e-242
WP_069009050.1|1083289_1084825_+	DUF1073 domain-containing protein	NA	A0A2R3UAL5	Myoviridae_environmental_samples	44.2	1.0e-102
WP_069009051.1|1084877_1085573_+|capsid	minor capsid protein	capsid	H9C0V1	Aeromonas_phage	54.9	1.3e-65
WP_069009052.1|1085569_1085758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069009054.1|1085803_1086991_+	DUF2213 domain-containing protein	NA	A0A219YCD3	Aeromonas_phage	36.3	2.9e-57
WP_069009056.1|1086992_1087475_+	hypothetical protein	NA	A0A219YBF2	Aeromonas_phage	51.0	1.4e-34
WP_069009059.1|1087474_1088518_+	DUF2184 domain-containing protein	NA	A0A219YBB0	Aeromonas_phage	49.4	7.9e-83
WP_057627536.1|1088521_1088848_+	hypothetical protein	NA	H9C0V9	Aeromonas_phage	41.1	2.1e-10
WP_069009061.1|1088850_1089294_+	DUF4054 domain-containing protein	NA	Q2NPC6	Xanthomonas_phage	50.0	3.1e-20
WP_069009062.1|1089296_1089827_+	hypothetical protein	NA	A0A077KC03	Edwardsiella_phage	43.6	1.4e-27
WP_069009064.1|1089804_1090176_+	hypothetical protein	NA	A0A077KAW7	Edwardsiella_phage	61.0	5.0e-40
WP_049528954.1|1090373_1090691_+	hypothetical protein	NA	A0A077KC88	Edwardsiella_phage	67.3	9.6e-32
WP_049525848.1|1090687_1092175_+	DUF3383 domain-containing protein	NA	A0A077KGV4	Edwardsiella_phage	61.9	4.5e-164
WP_049525852.1|1092184_1092619_+	hypothetical protein	NA	A0A077K9T0	Edwardsiella_phage	67.1	1.6e-53
WP_049525854.1|1092618_1093026_+	hypothetical protein	NA	A0A077KC08	Edwardsiella_phage	60.7	8.3e-36
WP_049525857.1|1093240_1095001_+	lytic transglycosylase domain-containing protein	NA	A0A077KC92	Edwardsiella_phage	38.6	2.4e-100
WP_049525859.1|1095005_1095407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049525861.1|1095483_1095942_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049525864.1|1096054_1096873_+	hypothetical protein	NA	A0A077KGW3	Edwardsiella_phage	57.9	4.8e-75
WP_049525866.1|1096869_1097175_+	hypothetical protein	NA	A0A077K9U4	Edwardsiella_phage	63.0	9.2e-32
WP_049525867.1|1097164_1098022_+	hypothetical protein	NA	A0A077KC17	Edwardsiella_phage	53.6	3.0e-80
WP_049525869.1|1098018_1098729_+|plate	phage baseplate assembly protein	plate	A0A077KAY0	Edwardsiella_phage	52.9	1.4e-59
WP_049525871.1|1098725_1099085_+	hypothetical protein	NA	A0A077KCA1	Edwardsiella_phage	73.7	1.2e-43
WP_069009065.1|1099081_1100323_+|plate	baseplate J/gp47 family protein	plate	A0A077KGW9	Edwardsiella_phage	67.8	1.7e-156
WP_049525876.1|1100319_1100961_+	DUF2612 domain-containing protein	NA	A0A077K9U8	Edwardsiella_phage	73.6	1.1e-87
WP_129019393.1|1101138_1102854_+	hypothetical protein	NA	A9YX14	Burkholderia_phage	39.8	7.0e-52
>prophage 4
NZ_CP016945	Yersinia enterocolitica strain YE1 chromosome, complete genome	4668139	1302660	1424474	4668139	terminase,tRNA,tail,head,portal,transposase,coat,protease,capsid,lysis,integrase,plate,holin	Salmonella_phage(18.6%)	175	1308911:1308925	1359412:1359427
WP_005158258.1|1302660_1303296_-|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
WP_005158259.1|1303266_1303953_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.2	2.7e-31
WP_049525769.1|1303949_1306376_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_005158266.1|1306515_1307580_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_049525771.1|1307576_1308101_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	38.5	5.3e-19
WP_049525773.1|1308276_1308999_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
1308911:1308925	attL	GCTTCACGCTGGATA	NA	NA	NA	NA
WP_005158275.1|1309009_1309504_-	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
1308911:1308925	attL	GCTTCACGCTGGATA	NA	NA	NA	NA
WP_020283435.1|1309716_1311102_+|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	32.0	5.5e-39
WP_004390634.1|1311270_1311483_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_005158281.1|1311497_1312364_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	35.0	3.7e-33
WP_050344586.1|1312686_1313841_-|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	71.1	6.2e-161
WP_049525558.1|1314441_1315077_-	DNA methyltransferase	NA	I6PDF5	Cronobacter_phage	73.0	7.2e-87
WP_049525559.1|1315073_1315292_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164971240.1|1315291_1315468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129019389.1|1315701_1316088_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050128071.1|1316077_1316299_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049525779.1|1316323_1316593_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049525781.1|1316594_1317023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057619046.1|1317019_1317427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049526811.1|1317468_1317651_-	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	59.6	1.3e-09
WP_057619042.1|1317647_1318583_-	recombinase RecT	NA	A0A193GYL3	Enterobacter_phage	62.5	2.4e-107
WP_069009644.1|1318575_1319394_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	E5AGE0	Erwinia_phage	74.1	2.6e-121
WP_049526808.1|1319393_1319687_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129019391.1|1319790_1319922_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	NA	NA	NA	NA
WP_050293951.1|1319939_1320959_-	hypothetical protein	NA	K7P6J9	Enterobacteria_phage	65.3	1.8e-31
1320151:1320165	attR	GCTTCACGCTGGATA	NA	NA	NA	NA
WP_049525794.1|1321047_1321341_-	hypothetical protein	NA	A0A0B4SK56	Proteus_phage	31.3	7.6e-07
1320151:1320165	attR	GCTTCACGCTGGATA	NA	NA	NA	NA
WP_049525796.1|1321856_1322198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071828178.1|1322356_1322536_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154236085.1|1322740_1322899_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049525565.1|1322901_1323186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049611538.1|1323683_1324436_-	helix-turn-helix transcriptional regulator	NA	G8C7L8	Escherichia_phage	41.2	7.3e-30
WP_049611541.1|1324553_1324787_+	antirepressor	NA	A0A0P0ZDD7	Stx2-converting_phage	58.4	6.4e-17
WP_057619037.1|1324898_1325192_+	hypothetical protein	NA	A2SY75	Escherichia_phage	62.9	8.0e-25
WP_057619038.1|1325216_1325921_+	hypothetical protein	NA	Q71T76	Escherichia_phage	54.0	2.1e-63
WP_071890465.1|1325917_1326739_+	replication protein	NA	K7PL20	Enterobacteria_phage	64.3	5.5e-55
WP_069009079.1|1326735_1327590_+	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	57.3	8.2e-86
WP_129019430.1|1327730_1327928_+	hypothetical protein	NA	K7PHN9	Enterobacterial_phage	61.9	9.2e-17
WP_049525572.1|1327924_1328227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050128082.1|1328223_1328724_+	DUF551 domain-containing protein	NA	NA	NA	NA	NA
WP_049525574.1|1328723_1328921_+	hypothetical protein	NA	A0A2H4FUS3	Salmonella_phage	42.2	5.1e-07
WP_164971241.1|1328910_1329072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049525575.1|1329064_1329535_+	recombination protein NinB	NA	I6R9D0	Salmonella_phage	53.9	2.6e-41
WP_049525576.1|1329674_1330055_+	hypothetical protein	NA	A0A1B0VBU7	Salmonella_phage	46.7	1.5e-26
WP_049526784.1|1330156_1330447_+	DUF1364 domain-containing protein	NA	A0A220NQY2	Salmonella_phage	75.8	1.3e-38
WP_049526782.1|1330443_1330806_+	RusA family crossover junction endodeoxyribonuclease	NA	E5AGG1	Erwinia_phage	65.8	8.7e-37
WP_049526779.1|1331014_1331839_+	antitermination protein	NA	M9NZB0	Enterobacteria_phage	53.6	1.3e-75
WP_050344746.1|1332312_1332846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049525581.1|1333037_1333355_+|holin	phage holin family protein	holin	E7C9S8	Salmonella_phage	57.6	8.4e-28
WP_049525582.1|1333341_1333740_+	M15 family metallopeptidase	NA	E7C9S9	Salmonella_phage	61.7	1.0e-38
WP_069009658.1|1333757_1334258_+	DUF2514 family protein	NA	Q7Y3V2	Yersinia_phage	86.7	1.8e-72
WP_049525583.1|1334268_1334679_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129019398.1|1334709_1334976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049525585.1|1335186_1335420_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.1e-16
WP_049525586.1|1335496_1336141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049525588.1|1336606_1337206_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080347399.1|1337177_1339154_+|terminase	phage terminase large subunit family protein	terminase	G8EXZ6	Synechococcus_phage	46.0	3.1e-136
WP_005278866.1|1339162_1339426_+|head,tail	phage head-tail adapter protein	head,tail	NA	NA	NA	NA
WP_049525589.1|1339494_1341078_+|portal	phage portal protein	portal	A0A291AUL8	Sinorhizobium_phage	38.5	1.2e-98
WP_049525590.1|1341074_1341935_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	39.9	1.1e-50
WP_049525591.1|1341927_1342521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049525592.1|1342520_1342922_+|head	head decoration protein	head	NA	NA	NA	NA
WP_049525593.1|1343031_1344078_+|capsid	major capsid protein	capsid	Q6UYI3	Burkholderia_phage	30.7	4.9e-40
WP_049525594.1|1344079_1344574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049525596.1|1344573_1344918_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049525598.1|1344914_1345460_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049525600.1|1345465_1345657_+	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_050156942.1|1345656_1347147_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	B5TK67	Pseudomonas_phage	44.2	2.6e-103
WP_050319427.1|1347159_1347534_+|tail	phage tail tube protein	tail	NA	NA	NA	NA
WP_049525606.1|1347535_1347838_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_069009080.1|1347955_1349758_+	lytic transglycosylase domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	49.2	1.1e-23
WP_050879847.1|1349815_1351222_+	DNA circularization protein	NA	Q8W619	Enterobacteria_phage	27.6	6.8e-21
WP_049525612.1|1351218_1352292_+|tail	tail protein	tail	M1PVV2	Vibrio_phage	30.1	5.5e-39
WP_049525614.1|1352288_1352882_+|plate	phage baseplate assembly protein	plate	NA	NA	NA	NA
WP_049525616.1|1352878_1353316_+	phage GP46 family protein	NA	A0A0C4UR04	Shigella_phage	45.4	3.4e-19
WP_050156966.1|1353319_1354456_+|plate	baseplate J/gp47 family protein	plate	A0A1E1GE19	Vibrio_phage	28.0	1.7e-09
WP_050107865.1|1354452_1355049_+	YmfQ family protein	NA	A0A2P9JZK7	Alteromonadaceae_phage	39.8	4.6e-35
WP_186834340.1|1355098_1356559_+	hypothetical protein	NA	A9YX14	Burkholderia_phage	35.1	6.0e-52
WP_069009081.1|1356555_1356738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057619001.1|1356844_1357945_+	acyltransferase	NA	A0A2H4JA46	uncultured_Caudovirales_phage	28.0	4.4e-23
WP_071890467.1|1358163_1359186_-|integrase	site-specific integrase	integrase	F1C5B2	Cronobacter_phage	67.1	2.8e-141
WP_046051422.1|1359203_1359551_-	helix-turn-helix domain-containing protein	NA	M1FJ59	Enterobacteria_phage	58.3	2.4e-28
WP_049525558.1|1359908_1360544_-	DNA methyltransferase	NA	I6PDF5	Cronobacter_phage	73.0	7.2e-87
WP_049525559.1|1360540_1360759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164971240.1|1360758_1360935_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129019389.1|1361168_1361555_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050128071.1|1361544_1361766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049525779.1|1361790_1362060_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049525781.1|1362061_1362490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069009084.1|1362486_1362894_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154236079.1|1362937_1363111_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049525787.1|1363344_1363941_-	hypothetical protein	NA	K7PHD7	Enterobacteria_phage	51.6	3.0e-42
WP_049525790.1|1363937_1364618_-	AAA family ATPase	NA	A0A2D1GLT5	Escherichia_phage	69.0	2.6e-90
WP_049525792.1|1364589_1364838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154236080.1|1364834_1365008_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049525794.1|1365273_1365567_-	hypothetical protein	NA	A0A0B4SK56	Proteus_phage	31.3	7.6e-07
WP_069009085.1|1365588_1365957_-	hypothetical protein	NA	B9UDG8	Salmonella_phage	50.0	2.1e-38
WP_049525796.1|1366066_1366408_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071828178.1|1366566_1366746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154236085.1|1366950_1367109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049525798.1|1367111_1367396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049528945.1|1367894_1368104_+	DUF2767 family protein	NA	I6R0R9	Salmonella_phage	47.5	5.9e-06
WP_049525800.1|1368148_1368592_-	hypothetical protein	NA	M1FPN8	Enterobacteria_phage	50.4	4.3e-30
WP_049525803.1|1368609_1369455_-	hypothetical protein	NA	M1FPD4	Enterobacteria_phage	44.3	4.6e-57
WP_080347400.1|1369595_1370294_-	helix-turn-helix transcriptional regulator	NA	A0A2D1GM27	Escherichia_phage	63.9	2.6e-82
WP_049525807.1|1370452_1370683_+	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	47.1	5.0e-06
WP_049525808.1|1370798_1371092_+	hypothetical protein	NA	A2SY75	Escherichia_phage	62.9	1.2e-23
WP_049525811.1|1371101_1371638_+	hypothetical protein	NA	A0A291AXH9	Shigella_phage	53.6	1.2e-50
WP_049525571.1|1371884_1372787_+	replication protein	NA	C6ZR51	Salmonella_phage	56.0	2.2e-36
WP_049525813.1|1372786_1374124_+	AAA family ATPase	NA	A0A2I7REC3	Vibrio_phage	38.7	1.5e-81
WP_050128081.1|1374136_1374361_+	hypothetical protein	NA	A0A192Y6R5	Salmonella_phage	63.8	2.5e-18
WP_129019429.1|1374501_1374699_+	hypothetical protein	NA	K7PHN9	Enterobacterial_phage	61.9	9.2e-17
WP_049525572.1|1374695_1374998_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050294067.1|1374994_1375393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050294069.1|1375389_1375629_+	DUF4752 family protein	NA	T1S9K2	Salmonella_phage	58.7	4.5e-18
WP_050294071.1|1375632_1376082_+	DUF1367 family protein	NA	A0A0P0ZFW0	Escherichia_phage	70.5	5.3e-60
WP_050294074.1|1376301_1376685_+	HNH endonuclease	NA	A0A2R2Z2X9	Escherichia_phage	75.2	8.5e-51
WP_050294075.1|1376824_1377154_+	DUF2591 family protein	NA	R9VYJ6	Serratia_phage	52.8	3.3e-19
WP_050294079.1|1377155_1377806_+	metallophosphoesterase	NA	Q716B9	Shigella_phage	61.1	8.5e-75
WP_155295585.1|1377981_1378146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050156987.1|1378260_1378896_+	recombination protein NinG	NA	H6WRY9	Salmonella_phage	44.9	1.9e-42
WP_050156985.1|1378892_1379084_+	protein ninH	NA	Q777W6	Enterobacteria_phage	59.3	1.1e-09
WP_050156984.1|1379080_1379569_+	antiterminator	NA	M1FPN0	Enterobacteria_phage	67.9	2.4e-58
WP_050344746.1|1379872_1380406_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042570178.1|1380603_1380918_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_050294008.1|1380920_1381364_+	lysozyme	NA	R9TMH8	Aeromonas_phage	57.3	2.1e-40
WP_050294009.1|1381360_1381819_+|lysis	lysis protein	lysis	A5LH84	Enterobacteria_phage	46.4	2.1e-24
WP_050127912.1|1382344_1382872_+	KilA-N domain-containing protein	NA	A0A1V0E5P7	Salmonella_phage	55.4	3.0e-46
WP_050127911.1|1382868_1383252_+	hypothetical protein	NA	A0A192Y658	Salmonella_phage	41.6	5.6e-18
WP_050127910.1|1383327_1383567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050127908.1|1383690_1384326_+	hypothetical protein	NA	H9C189	Pectobacterium_phage	71.0	4.7e-86
WP_050127906.1|1384359_1384809_+	DUF2280 domain-containing protein	NA	I6S1P9	Salmonella_phage	72.9	5.1e-47
WP_050127904.1|1384818_1386306_+	hypothetical protein	NA	A0A1W6JNY3	Morganella_phage	76.5	7.0e-226
WP_050156791.1|1386380_1387718_+	DUF4055 domain-containing protein	NA	A0A0S2SYJ5	Pseudomonas_phage	43.7	7.5e-94
WP_050156790.1|1387836_1388589_+	hypothetical protein	NA	G8C7P6	Escherichia_phage	47.6	3.2e-57
WP_050127902.1|1388604_1389729_+|coat	P22 coat - protein 5 family protein	coat	W6EBZ8	Rhizobium_phage	56.7	9.1e-101
WP_154236072.1|1389779_1389950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050156786.1|1389949_1390342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050127901.1|1390344_1390983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050127899.1|1390984_1391788_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050127897.1|1391804_1391999_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050294010.1|1392059_1393613_+|tail	phage tail protein	tail	B3GAJ6	uncultured_virus	44.8	2.1e-95
WP_050127893.1|1393662_1394094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050127891.1|1394114_1394492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050127914.1|1394667_1395153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050127890.1|1395211_1395547_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_071890470.1|1395654_1395819_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_050294012.1|1396692_1397469_+	phage antirepressor KilAC domain-containing protein	NA	A0A077SL47	Escherichia_phage	44.3	2.4e-39
WP_050127887.1|1397588_1397936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050127885.1|1398006_1400145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154236071.1|1400228_1400588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050294015.1|1400969_1401959_+	hypothetical protein	NA	S5MNM1	Brevibacillus_phage	35.0	1.3e-13
WP_050127882.1|1401961_1403077_+	type IV secretion protein Rhs	NA	NA	NA	NA	NA
WP_050127881.1|1403073_1403700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050127880.1|1403707_1404073_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080357946.1|1404134_1405205_+|plate	baseplate J/gp47 family protein	plate	B3GAJ9	uncultured_virus	40.4	2.6e-52
WP_050127878.1|1405205_1405868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129019401.1|1405940_1408115_+	hypothetical protein	NA	A9YX14	Burkholderia_phage	40.0	5.2e-52
WP_049525621.1|1408111_1408327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005158292.1|1409991_1410177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_084738242.1|1410886_1411990_+	Fic family protein	NA	NA	NA	NA	NA
WP_080478647.1|1412430_1412997_-	potassium-transporting ATPase subunit A	NA	Q7M2A8	Enterobacteria_phage	44.8	9.4e-38
WP_080478635.1|1413226_1414624_-	toprim domain-containing protein	NA	Q8LTT9	Enterobacteria_phage	47.4	4.8e-59
WP_049525217.1|1414923_1415247_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_164971237.1|1415239_1415392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049525216.1|1415405_1415606_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_005158310.1|1415820_1416153_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005158312.1|1416513_1416879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020283429.1|1417103_1417751_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005158316.1|1417735_1418074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049525882.1|1418567_1418798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049525883.1|1419200_1419683_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038892054.1|1419789_1420170_+	DNA polymerase V	NA	K7P6F7	Enterobacteria_phage	68.0	6.9e-45
WP_049528964.1|1421320_1422010_-	heavy metal response regulator transcription factor	NA	W8CYM9	Bacillus_phage	34.7	8.8e-30
WP_049525886.1|1422245_1423295_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_023160836.1|1423454_1424474_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP016945	Yersinia enterocolitica strain YE1 chromosome, complete genome	4668139	1954768	2017869	4668139	tail,transposase,capsid,lysis,integrase,holin	Salmonella_phage(27.27%)	52	1954645:1954663	1956739:1956757
1954645:1954663	attL	ACGTTATGAATATGGGTGT	NA	NA	NA	NA
WP_038892112.1|1954768_1954882_-|integrase	integrase	integrase	Q8W658	Enterobacteria_phage	83.3	1.7e-07
WP_013649708.1|1955719_1956115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005160360.1|1956757_1957360_-	DNA-3-methyladenine glycosylase 2 family protein	NA	NA	NA	NA	NA
1956739:1956757	attR	ACGTTATGAATATGGGTGT	NA	NA	NA	NA
WP_049526403.1|1957446_1960407_-	metal-dependent phosphohydrolase	NA	NA	NA	NA	NA
WP_005160357.1|1960734_1961604_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005160355.1|1961877_1962240_-	flagella biosynthesis regulatory protein FliT	NA	NA	NA	NA	NA
WP_069009163.1|1962251_1962650_-	flagellar export chaperone FliS	NA	NA	NA	NA	NA
WP_020283290.1|1962660_1964061_-	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
WP_049526408.1|1964329_1965439_+	flagellin FliC	NA	NA	NA	NA	NA
WP_049526410.1|1965628_1966774_+	FliC/FljB family flagellin	NA	NA	NA	NA	NA
WP_005160341.1|1968321_1969044_+	RNA polymerase sigma factor FliA	NA	NA	NA	NA	NA
WP_069009166.1|1969099_1969609_+	flagella biosynthesis regulatory protein FliZ	NA	NA	NA	NA	NA
WP_013649714.1|1969987_1970980_+	D-cysteine desulfhydrase	NA	NA	NA	NA	NA
WP_049526413.1|1971098_1971899_+	cystine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005160319.1|1971898_1972561_+	cystine ABC transporter permease	NA	NA	NA	NA	NA
WP_005160316.1|1972563_1973319_+	L-cystine ABC transporter ATP-binding protein YecC	NA	W8CYL7	Bacillus_phage	33.7	1.5e-14
WP_005160301.1|1973390_1973762_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013649717.1|1973761_1974055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050128020.1|1974354_1978344_-	trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_049526417.1|1978870_1980355_+	sodium/proline symporter PutP	NA	NA	NA	NA	NA
WP_005160269.1|1981839_1982169_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069009170.1|1982172_1983240_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049526419.1|1984015_1984876_+	FTR1 family protein	NA	NA	NA	NA	NA
WP_049526421.1|1984892_1986023_+	iron uptake system protein EfeO	NA	NA	NA	NA	NA
WP_049526423.1|1986031_1987333_+	deferrochelatase/peroxidase EfeB	NA	NA	NA	NA	NA
WP_005160258.1|1987534_1988134_-	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_049526425.1|1988303_1988786_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_049526426.1|1989119_1990298_+	N-acetylneuraminate epimerase	NA	NA	NA	NA	NA
WP_005178006.1|1991913_1992462_-	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	64.5	1.9e-27
WP_049526428.1|1992511_1993102_-	malonic semialdehyde reductase	NA	NA	NA	NA	NA
WP_049526430.1|1993113_1993950_-	pyrimidine utilization protein D	NA	NA	NA	NA	NA
WP_069009175.1|1993982_1994348_-	pyrimidine utilization protein C	NA	NA	NA	NA	NA
WP_049526435.1|1995739_1996408_+	HTH-type transcriptional regulator RutR	NA	NA	NA	NA	NA
WP_186834344.1|1996465_1997887_-	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_049526442.1|1999969_2000704_-	class I SAM-dependent methyltransferase	NA	A0A1X9I6N4	Streptococcus_phage	39.9	2.0e-48
WP_049526444.1|2001107_2001605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005160200.1|2001686_2002016_-	DHCW motif cupin fold protein	NA	NA	NA	NA	NA
WP_013649731.1|2002160_2003660_+	alpha-amylase	NA	NA	NA	NA	NA
WP_013649732.1|2003911_2004166_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005160193.1|2004196_2004535_-	GlpM family protein	NA	NA	NA	NA	NA
WP_049526446.1|2004645_2004870_-	DUF2594 family protein	NA	NA	NA	NA	NA
WP_005160181.1|2005563_2006220_+	UvrY/SirA/GacA family response regulator transcription factor	NA	NA	NA	NA	NA
WP_049526448.1|2006212_2008045_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_005160174.1|2008103_2008652_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_013649733.1|2009316_2009532_-	ogr/Delta-like zinc finger family protein	NA	S4TNZ3	Salmonella_phage	60.6	1.1e-18
WP_049526451.1|2013332_2013779_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	47.3	9.4e-33
WP_049526452.1|2013775_2014243_-|tail	phage tail protein	tail	F1BUP9	Erwinia_phage	56.6	1.3e-40
WP_069009185.1|2014344_2014761_-|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	40.6	8.8e-17
WP_013649751.1|2014773_2015169_-	M15 family metallopeptidase	NA	A9DET4	Yersinia_phage	71.0	5.9e-47
WP_013649752.1|2015155_2015335_-|holin	holin	holin	NA	NA	NA	NA
WP_071598556.1|2015328_2015631_-|capsid	P2 family phage major capsid protein	capsid	A0A077KEQ8	Ralstonia_phage	68.7	2.6e-26
WP_049526453.1|2016432_2017869_-|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	39.1	2.9e-83
>prophage 6
NZ_CP016945	Yersinia enterocolitica strain YE1 chromosome, complete genome	4668139	2155579	2215044	4668139	tRNA,transposase,coat,protease	Bacillus_phage(28.57%)	54	NA	NA
WP_005164931.1|2155579_2156137_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_049526568.1|2156148_2156706_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_069009194.1|2156711_2157248_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_049526570.1|2157575_2158997_-	MFS transporter	NA	NA	NA	NA	NA
WP_049526572.1|2159124_2160045_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_049526574.1|2160057_2162688_-	PqiB family protein	NA	NA	NA	NA	NA
WP_049526576.1|2162656_2163904_-	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_013649820.1|2164144_2164642_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_005170218.1|2164737_2165466_+	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_005164944.1|2165485_2167561_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	35.4	4.3e-88
WP_005164945.1|2167857_2168739_+|protease	protease HtpX	protease	NA	NA	NA	NA
WP_049526580.1|2168773_2168899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005164950.1|2170616_2171783_+	oligogalacturonate lyase	NA	NA	NA	NA	NA
WP_005164952.1|2171969_2172761_+	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
WP_005164953.1|2173036_2173888_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1W6DX33	Sphingobium_phage	29.5	4.3e-10
WP_005161706.1|2175578_2176127_-	metal-dependent hydrolase	NA	A0A127AVX7	Bacillus_phage	33.3	2.9e-07
WP_013649825.1|2176484_2177183_-	porin	NA	NA	NA	NA	NA
WP_049526584.1|2177492_2178785_-	carbohydrate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005161697.1|2178800_2179928_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.5	3.0e-11
WP_005161693.1|2179941_2180859_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_005161668.1|2180851_2181742_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_069009197.1|2181782_2183450_-	pectate lyase	NA	NA	NA	NA	NA
WP_069009678.1|2183777_2184539_-	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.9	4.5e-19
WP_013649826.1|2184650_2185487_-	5-dehydro-4-deoxy-D-glucuronate isomerase	NA	NA	NA	NA	NA
WP_005170147.1|2185724_2186057_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_049526590.1|2186161_2187364_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	71.0	5.8e-77
WP_005161643.1|2187473_2188139_-	hexitol phosphatase HxpB	NA	NA	NA	NA	NA
WP_005170142.1|2188388_2188943_+	YniB family protein	NA	NA	NA	NA	NA
WP_049526592.1|2189151_2190042_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_049526593.1|2190038_2191520_-	succinate CoA transferase	NA	NA	NA	NA	NA
WP_005161631.1|2191545_2192331_-	methylmalonyl-CoA decarboxylase	NA	NA	NA	NA	NA
WP_013649829.1|2192344_2193340_-	methylmalonyl Co-A mutase-associated GTPase MeaB	NA	NA	NA	NA	NA
WP_049526595.1|2195754_2196624_-	fructosamine kinase family protein	NA	NA	NA	NA	NA
WP_049526597.1|2197255_2198131_-	iron/manganese ABC transporter permease subunit YfeD	NA	NA	NA	NA	NA
WP_049526599.1|2198127_2199012_-	iron/manganese ABC transporter permease subunit YfeC	NA	NA	NA	NA	NA
WP_049526600.1|2199011_2199902_-	iron/manganese ABC transporter ATP-binding protein YfeB	NA	W8CYL7	Bacillus_phage	29.7	7.7e-10
WP_049526602.1|2199898_2200867_-	iron/manganese ABC transporter substrate-binding protein YfeA	NA	NA	NA	NA	NA
WP_005161592.1|2201078_2201741_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_172397673.1|2202103_2202778_-	MarC family NAAT transporter	NA	NA	NA	NA	NA
WP_005161584.1|2203227_2203479_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005161581.1|2203951_2204188_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049526607.1|2204253_2204433_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005161576.1|2204957_2205671_+	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_005161573.1|2205790_2206003_-	KTSC domain-containing protein	NA	A0A0K1LMB5	Caulobacter_phage	42.0	9.9e-09
WP_049526612.1|2206326_2208255_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.2	8.8e-128
WP_011816226.1|2208258_2208810_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.7	3.4e-16
WP_004713020.1|2208906_2209104_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_004393357.1|2209141_2209498_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_152414234.1|2209566_2209614_+	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_005161570.1|2209962_2210946_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	5.8e-35
WP_049526614.1|2210960_2213348_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	27.8	1.1e-07
WP_002211830.1|2213352_2213649_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	4.2e-13
WP_071828211.1|2213861_2214032_-	NINE protein	NA	M4ZS56	Bacillus_phage	62.5	1.0e-08
WP_049525161.1|2214012_2215044_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP016945	Yersinia enterocolitica strain YE1 chromosome, complete genome	4668139	2422294	2458369	4668139	terminase,protease,lysis	Escherichia_phage(29.41%)	52	NA	NA
WP_049526752.1|2422294_2423020_-	hypothetical protein	NA	A0A0U2JGI7	Escherichia_phage	35.9	5.1e-28
WP_069009220.1|2423019_2424840_-	hypothetical protein	NA	A0A2R3UAN6	Myoviridae_environmental_samples	42.7	1.7e-19
WP_049526756.1|2424963_2425539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069009223.1|2425542_2425980_-	hypothetical protein	NA	A0A0U2S616	Escherichia_phage	39.6	2.0e-24
WP_049526761.1|2425983_2427378_-	hypothetical protein	NA	A0A0U2KD19	Escherichia_phage	36.4	2.6e-65
WP_049526763.1|2427382_2428324_-	hypothetical protein	NA	A0A0U2SH76	Escherichia_phage	37.3	1.3e-52
WP_049526765.1|2428307_2428742_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049526766.1|2428738_2429167_-	hypothetical protein	NA	A0A0U2S646	Escherichia_phage	39.1	7.1e-22
WP_049526768.1|2429167_2429647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057619021.1|2429715_2430747_-	hypothetical protein	NA	A0A0U2QQI2	Escherichia_phage	46.6	5.1e-74
WP_057619022.1|2430763_2431630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069009681.1|2431645_2433247_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_049526771.1|2433281_2434103_-	hypothetical protein	NA	A0A0U2I1R8	Escherichia_phage	41.4	4.0e-53
WP_050293991.1|2434099_2435515_-	DUF1073 domain-containing protein	NA	A0A0U2S5X9	Escherichia_phage	37.3	1.4e-85
WP_049526775.1|2435527_2436850_-|terminase	terminase	terminase	A0A0U2JTW9	Escherichia_phage	59.7	4.9e-154
WP_049529053.1|2436851_2437574_-	hypothetical protein	NA	A0A1I9KFG9	Aeromonas_phage	29.3	2.6e-16
WP_049525819.1|2437719_2438181_-|lysis	lysis protein	lysis	A5LH84	Enterobacteria_phage	43.0	1.7e-21
WP_049526777.1|2438165_2438678_-	lysozyme	NA	I6PBN2	Cronobacter_phage	59.9	2.4e-48
WP_049528949.1|2438677_2438959_-	hypothetical protein	NA	H6WRZ3	Salmonella_phage	54.3	1.1e-18
WP_049525816.1|2439176_2439710_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049525578.1|2440118_2440724_-	hypothetical protein	NA	Q8HA89	Salmonella_phage	40.7	1.4e-39
WP_049525577.1|2440720_2441329_-	recombination protein NinG	NA	K7PHP1	Enterobacterial_phage	60.9	1.0e-53
WP_049525576.1|2441430_2441811_-	hypothetical protein	NA	A0A1B0VBU7	Salmonella_phage	46.7	1.5e-26
WP_049525575.1|2441950_2442421_-	recombination protein NinB	NA	I6R9D0	Salmonella_phage	53.9	2.6e-41
WP_164971241.1|2442413_2442575_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049525574.1|2442564_2442762_-	hypothetical protein	NA	A0A2H4FUS3	Salmonella_phage	42.2	5.1e-07
WP_049526787.1|2442761_2443256_-	DUF551 domain-containing protein	NA	E7C9P2	Salmonella_phage	32.5	4.5e-12
WP_069009034.1|2443252_2443555_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129019429.1|2443551_2443749_-	hypothetical protein	NA	K7PHN9	Enterobacterial_phage	61.9	9.2e-17
WP_049526791.1|2443889_2444744_-	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	57.3	2.2e-86
WP_069009228.1|2444740_2445565_-	replication protein	NA	A0A075B8J2	Enterobacteria_phage	52.7	7.5e-36
WP_050156967.1|2445561_2446164_-	hypothetical protein	NA	M1F3E2	Salmonella_phage	42.1	5.5e-36
WP_049526795.1|2446188_2446482_-	hypothetical protein	NA	A2SY75	Escherichia_phage	62.9	1.4e-24
WP_049526797.1|2446596_2446815_-	helix-turn-helix transcriptional regulator	NA	I6S1U2	Salmonella_phage	62.7	3.7e-19
WP_049526799.1|2446921_2447587_+	LexA family transcriptional regulator	NA	A0A286S2B2	Klebsiella_phage	61.5	1.6e-73
WP_049526801.1|2447674_2448238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049526803.1|2448234_2448987_+	DUF1828 domain-containing protein	NA	NA	NA	NA	NA
WP_049529057.1|2449042_2449252_-	DUF2767 family protein	NA	I6R0R9	Salmonella_phage	47.5	1.3e-05
WP_049525565.1|2449750_2450035_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154236085.1|2450037_2450196_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071828178.1|2450400_2450580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049525796.1|2450738_2451080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049525794.1|2451595_2451889_+	hypothetical protein	NA	A0A0B4SK56	Proteus_phage	31.3	7.6e-07
WP_050293951.1|2451977_2452997_+	hypothetical protein	NA	K7P6J9	Enterobacteria_phage	65.3	1.8e-31
WP_129019391.1|2453014_2453146_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	NA	NA	NA	NA
WP_049526808.1|2453249_2453543_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057619043.1|2453542_2454361_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	E5AGE0	Erwinia_phage	74.4	1.2e-121
WP_069009232.1|2454353_2455289_+	recombinase RecT	NA	A0A193GYL3	Enterobacter_phage	62.5	5.4e-107
WP_071890482.1|2455285_2455450_+	DUF1317 family protein	NA	NA	NA	NA	NA
WP_049526813.1|2455459_2455906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049526815.1|2455905_2456196_+	hypothetical protein	NA	S0A2L4	Cellulophaga_phage	44.3	8.3e-06
WP_069009233.1|2456434_2458369_+	exoribonuclease II	NA	A0A2H4UVB7	Bodo_saltans_virus	21.4	1.1e-08
>prophage 8
NZ_CP016945	Yersinia enterocolitica strain YE1 chromosome, complete genome	4668139	2570252	2648242	4668139	tRNA,transposase,integrase,tail	Escherichia_phage(22.22%)	60	2619697:2619714	2648948:2648965
WP_069009262.1|2570252_2571983_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	35.3	3.5e-91
WP_069009268.1|2572074_2573511_+|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.8	4.9e-83
WP_049526892.1|2573646_2574435_-	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	73.8	1.2e-88
WP_005164388.1|2574963_2575671_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_049526894.1|2575886_2576354_-	poly-beta-1,6-N-acetyl-D-glucosamine biosynthesis protein PgaD	NA	NA	NA	NA	NA
WP_049526896.1|2576350_2577685_-	poly-beta-1,6 N-acetyl-D-glucosamine synthase	NA	NA	NA	NA	NA
WP_069009273.1|2582859_2584077_-	M24 family metallopeptidase	NA	NA	NA	NA	NA
WP_049526898.1|2584127_2584898_-	siderophore-iron reductase FhuF	NA	NA	NA	NA	NA
WP_005164398.1|2585055_2585682_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049526901.1|2586753_2587623_-	SAM-dependent methyltransferase TehB	NA	NA	NA	NA	NA
WP_005164402.1|2587767_2588082_-	cytochrome c	NA	NA	NA	NA	NA
WP_069009280.1|2588081_2588570_-	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_049526903.1|2588559_2589273_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	31.7	1.4e-17
WP_005179185.1|2590422_2591715_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_049526908.1|2591717_2593121_-	DUF2318 domain-containing protein	NA	NA	NA	NA	NA
WP_004390794.1|2593256_2593784_-	iron transporter	NA	NA	NA	NA	NA
WP_014608895.1|2593864_2595802_-	FTR1 family iron permease	NA	NA	NA	NA	NA
WP_020283107.1|2595975_2596494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049526912.1|2598363_2599371_-	glutaminase A	NA	NA	NA	NA	NA
WP_023160703.1|2599936_2600716_-	hydroxypyruvate isomerase family protein	NA	NA	NA	NA	NA
WP_049526915.1|2600718_2601342_-	aldolase	NA	A0A077SK32	Escherichia_phage	77.7	2.0e-89
WP_069009288.1|2601338_2602601_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	60.3	1.5e-136
WP_005164436.1|2603123_2603903_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	63.9	1.7e-82
WP_005164439.1|2604147_2605824_+	two-component system sensor histidine kinase DcuS	NA	NA	NA	NA	NA
WP_005164442.1|2605816_2606536_+	two-component system response regulator DcuR	NA	NA	NA	NA	NA
WP_050156560.1|2606951_2608310_-	2-hydroxycarboxylate transporter family protein	NA	A0A140XAH4	Dickeya_phage	68.8	5.6e-28
WP_049526922.1|2609363_2610878_+	L-asparagine permease	NA	NA	NA	NA	NA
WP_005164450.1|2611026_2611380_-	DUF488 family protein	NA	NA	NA	NA	NA
WP_049526924.1|2611665_2612691_+	ROK family protein	NA	NA	NA	NA	NA
WP_049526926.1|2612927_2614100_+	MFS transporter	NA	NA	NA	NA	NA
WP_020283100.1|2614280_2615099_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_005177551.1|2616156_2617359_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	72.0	1.5e-77
WP_013649992.1|2617551_2618073_-	ricin-type beta-trefoil lectin domain protein	NA	NA	NA	NA	NA
WP_005166647.1|2618210_2618867_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
2619697:2619714	attL	TTTAAAAAATCATTACAA	NA	NA	NA	NA
WP_049526932.1|2619708_2620920_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	71.4	9.9e-77
WP_013649995.1|2621911_2623225_-	cytosine permease	NA	NA	NA	NA	NA
WP_005163571.1|2623428_2624193_+	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_005163578.1|2626327_2626780_+|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	63.2	2.7e-48
WP_020283095.1|2626776_2627919_+	phage late control D family protein	NA	A0A218M4J7	Erwinia_phage	67.9	6.5e-147
WP_005163580.1|2628011_2628233_+	DNA-binding transcriptional regulator	NA	Q37973	Salmonella_virus	67.6	4.3e-23
WP_005163581.1|2628317_2629133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164971242.1|2629373_2630444_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4S6G4	Salmonella_phage	58.6	1.7e-120
WP_005163587.1|2630770_2631112_-	YebY family protein	NA	NA	NA	NA	NA
WP_005163602.1|2631208_2632093_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_005170441.1|2632094_2632481_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_013650000.1|2632873_2633383_-	non-heme ferritin	NA	NA	NA	NA	NA
WP_004389928.1|2633766_2634000_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	58.8	1.7e-14
WP_020283091.1|2634049_2635006_-	prolyl aminopeptidase	NA	NA	NA	NA	NA
WP_013650001.1|2635515_2636178_+	exodeoxyribonuclease X	NA	A0A1W5PTR6	Pseudoalteromonas_phage	30.7	2.2e-17
WP_049526938.1|2636189_2638244_-	prolyl oligopeptidase family serine peptidase	NA	NA	NA	NA	NA
WP_049526939.1|2638433_2638790_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005163608.1|2638895_2639204_-	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_005163610.1|2639243_2639564_-	YebG family protein	NA	NA	NA	NA	NA
WP_049526941.1|2639659_2641042_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	30.6	1.1e-52
WP_049526943.1|2641295_2642477_+	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_005163637.1|2642544_2642802_-	YoaH family protein	NA	NA	NA	NA	NA
WP_049526945.1|2642984_2644355_+	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	37.9	1.5e-36
WP_172665132.1|2644382_2644955_+	CoA pyrophosphatase	NA	NA	NA	NA	NA
WP_005163643.1|2645407_2646772_+	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_023160836.1|2647222_2648242_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
2648948:2648965	attR	TTGTAATGATTTTTTAAA	NA	NA	NA	NA
>prophage 9
NZ_CP016945	Yersinia enterocolitica strain YE1 chromosome, complete genome	4668139	3680479	3718375	4668139	capsid,integrase,transposase,tRNA	Bacillus_phage(25.0%)	37	3690136:3690189	3704177:3704230
WP_042663659.1|3680479_3681499_+|transposase	IS110-like element ISYen1 family transposase	transposase	NA	NA	NA	NA
WP_049527926.1|3681917_3683162_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.9	3.1e-17
WP_005166615.1|3683244_3683640_-	SgcJ/EcaC family oxidoreductase	NA	NA	NA	NA	NA
WP_049527931.1|3684976_3685177_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_049527934.1|3685319_3686522_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	72.0	1.5e-77
WP_049527936.1|3686598_3687027_-	type II toxin-antitoxin system MqsA family antitoxin	NA	NA	NA	NA	NA
WP_005166025.1|3687026_3687323_-	type II toxin-antitoxin system MqsR family toxin	NA	NA	NA	NA	NA
WP_005166026.1|3687479_3687842_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005166028.1|3687907_3688168_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A1S5NR91	Burkholderia_phage	36.0	2.5e-06
3690136:3690189	attL	TGGAGCGGGTGAAGGGAATCGAACCCTCGTATAGAGCTTGGGAAGCTCTCGTTC	NA	NA	NA	NA
WP_049527941.1|3690251_3691472_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_049527943.1|3691547_3691922_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049527946.1|3691918_3692128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_186834336.1|3692315_3693836_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069009460.1|3693751_3694144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_084738254.1|3694552_3695605_-|capsid	major capsid protein	capsid	NA	NA	NA	NA
WP_049527955.1|3695654_3695927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049527956.1|3697160_3697403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049527959.1|3698045_3698369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049527961.1|3698730_3698931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049527964.1|3698957_3700481_-	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_154295071.1|3700501_3700654_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069009462.1|3701774_3702035_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049527969.1|3702038_3702269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049527972.1|3702885_3703434_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A141E0P1	Streptococcus_phage	34.4	1.2e-21
WP_013649344.1|3704420_3705938_-|tRNA	lysine--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	37.6	2.3e-86
3704177:3704230	attR	TGGAGCGGGTGAAGGGAATCGAACCCTCGTATAGAGCTTGGGAAGCTCTCGTTC	NA	NA	NA	NA
WP_020282590.1|3705947_3707046_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	5.4e-05
WP_005166036.1|3707491_3709225_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	29.7	1.6e-64
WP_013649342.1|3709231_3709948_-	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_005166040.1|3709996_3710896_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	30.2	2.1e-31
WP_005166042.1|3711002_3711521_+	flavodoxin FldB	NA	NA	NA	NA	NA
WP_049527976.1|3711579_3713001_-	cell envelope integrity protein CreD	NA	NA	NA	NA	NA
WP_049527980.1|3713092_3714520_-	two-component system sensor histidine kinase CreC	NA	NA	NA	NA	NA
WP_005166045.1|3714530_3715229_-	two-component system response regulator CreB	NA	NA	NA	NA	NA
WP_005166047.1|3715228_3715654_-	protein YgfX	NA	NA	NA	NA	NA
WP_004390965.1|3715634_3715901_-	FAD assembly factor SdhE	NA	NA	NA	NA	NA
WP_049527983.1|3716167_3717160_+|tRNA	tRNA-modifying protein YgfZ	tRNA	NA	NA	NA	NA
WP_084738255.1|3717355_3718375_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP016946	Yersinia enterocolitica strain YE1 plasmid unnamed1, complete sequence	73029	25683	33465	73029	transposase	uncultured_Caudovirales_phage(57.14%)	9	NA	NA
WP_050294038.1|25683_26382_-	arsenic resistance NADPH-dependent reductase ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	68.1	4.2e-88
WP_013749489.1|26467_26788_+	As(III)-sensing metalloregulatory transcriptional repressor ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	46.7	1.7e-20
WP_057618950.1|26833_28123_+	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	70.4	7.1e-166
WP_010891244.1|28135_28561_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	5.6e-51
WP_050294040.1|28578_29160_-	recombinase family protein	NA	A0A219YA40	Aeromonas_phage	35.5	3.3e-22
WP_050294041.1|29320_30172_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	36.9	1.8e-16
WP_010891241.1|30327_30780_+	PprA	NA	NA	NA	NA	NA
WP_013749484.1|31101_31977_-	DMT family transporter	NA	NA	NA	NA	NA
WP_050294042.1|32046_33465_-	trimeric autotransporter adhesin YadA	NA	Q9MCI8	Enterobacteria_phage	55.6	2.6e-12
>prophage 1
NZ_CP016947	Yersinia enterocolitica strain YE1 plasmid unnamed2, complete sequence	100794	1692	54499	100794	transposase,integrase	Escherichia_phage(25.0%)	38	3859:3873	49729:49743
WP_129019437.1|1692_2389_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	5.5e-40
WP_164971249.1|2841_3378_-	CaiF/GrlA family transcriptional regulator	NA	NA	NA	NA	NA
3859:3873	attL	TGGCGAATTTTTAAT	NA	NA	NA	NA
WP_069009758.1|5342_8066_-	Ig-like domain-containing protein	NA	NA	NA	NA	NA
WP_069009759.1|8623_13138_-	RHS repeat-associated core domain-containing protein	NA	A0A1W5K0N1	Bacteriophage	33.8	2.0e-178
WP_050128033.1|13394_13637_+|transposase	IS3 family transposase	transposase	Q716C1	Shigella_phage	64.7	3.3e-16
WP_129019436.1|13650_14348_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	1.9e-40
WP_050128092.1|15801_16095_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050128091.1|16157_16793_-	ParA family protein	NA	NA	NA	NA	NA
WP_069009764.1|17073_17721_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.0	7.3e-10
WP_071891490.1|17919_18294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050127682.1|20463_21183_-	filamentous hemagglutinin N-terminal domain-containing protein	NA	A0A0R6PJK4	Moraxella_phage	43.7	2.5e-35
WP_164971253.1|21219_22917_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	A0A0R6PI85	Moraxella_phage	28.3	9.7e-38
WP_057618893.1|23162_25109_-	pertactin family autotransporter	NA	NA	NA	NA	NA
WP_050127681.1|25745_26384_-	recombinase family protein	NA	NA	NA	NA	NA
WP_129019443.1|26567_27341_-|integrase	tyrosine-type recombinase/integrase	integrase	I3WFA4	Macacine_betaherpesvirus	81.4	6.1e-48
WP_050156624.1|27441_28359_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069009769.1|31763_32729_-	conjugal transfer protein TraG N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_069009775.1|32725_34102_-	conjugal transfer protein TraH	NA	NA	NA	NA	NA
WP_102778917.1|34111_34900_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_050156618.1|34984_35383_-	PEGA domain-containing protein	NA	NA	NA	NA	NA
WP_069009780.1|35414_35879_-	S26 family signal peptidase	NA	NA	NA	NA	NA
WP_050127685.1|35878_36466_-	conjugal transfer protein TrbC	NA	NA	NA	NA	NA
WP_050127668.1|36597_38181_-	TraU family protein	NA	NA	NA	NA	NA
WP_164971252.1|38334_40077_-	conjugal transfer protein TraN	NA	NA	NA	NA	NA
WP_080357812.1|40090_42136_-	conjugal transfer protein TraN	NA	NA	NA	NA	NA
WP_080357814.1|42137_44687_-	TraC family protein	NA	NA	NA	NA	NA
WP_050127664.1|44710_45217_-	TraV family lipoprotein	NA	NA	NA	NA	NA
WP_069009838.1|45240_46488_-	TraB/VirB10 family protein	NA	NA	NA	NA	NA
WP_012291411.1|46487_47276_-	type-F conjugative transfer system secretin TraK	NA	NA	NA	NA	NA
WP_050127663.1|47277_47928_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050127662.1|48227_48596_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050156626.1|48649_49516_-	DsbC family protein	NA	NA	NA	NA	NA
WP_050127661.1|49520_49838_-	hypothetical protein	NA	NA	NA	NA	NA
49729:49743	attR	ATTAAAAATTCGCCA	NA	NA	NA	NA
WP_012291420.1|50050_50371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050156614.1|50481_50835_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050127659.1|50934_51210_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129019442.1|51364_52798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071891480.1|53293_54499_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
