The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP015308	Lactiplantibacillus plantarum strain LY-78 chromosome, complete genome	3119435	159523	245125	3119435	portal,protease,terminase,holin,tail,tRNA,integrase,head,transposase	Lactobacillus_phage(73.47%)	93	152573:152590	219526:219543
152573:152590	attL	ATGGAAAAAGCCGTTGAC	NA	NA	NA	NA
WP_069137004.1|159523_160687_-|integrase	site-specific integrase	integrase	O64373	Lactobacillus_phage	34.3	3.9e-54
WP_069137005.1|160986_161973_-	DUF3644 domain-containing protein	NA	A0A0N9RUA4	Staphylococcus_phage	52.0	9.5e-86
WP_003641358.1|162365_162566_-	hypothetical protein	NA	E9LUS6	Lactobacillus_phage	100.0	4.9e-26
WP_069137006.1|162757_162940_-	hypothetical protein	NA	A0A2P0ZL93	Lactobacillus_phage	66.7	6.7e-14
WP_069137007.1|163066_163309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069137008.1|163311_164061_-	potassium channel family protein	NA	A0A1B0Y2S3	Lactobacillus_phage	53.9	9.2e-41
WP_069137009.1|164118_164556_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A1C8E988	Bacillus_phage	30.6	4.9e-10
WP_069137010.1|164567_164987_-	helix-turn-helix transcriptional regulator	NA	A0A0M4QX29	Bacillus_phage	47.9	7.0e-30
WP_069137011.1|165243_165447_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_069137012.1|165462_166170_+	Rha family transcriptional regulator	NA	D2IYT0	Enterococcus_phage	58.6	3.6e-63
WP_069137013.1|166181_166391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069137014.1|166403_166631_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025015699.1|166646_166868_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003641367.1|166925_167186_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003641368.1|167779_168070_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003641369.1|168235_168439_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003641370.1|168451_168700_+	hypothetical protein	NA	E9LUT6	Lactobacillus_phage	76.1	2.7e-29
WP_003641371.1|168702_168903_+	hypothetical protein	NA	E9LUT7	Lactobacillus_phage	89.4	1.0e-26
WP_187337690.1|168914_169079_+	hypothetical protein	NA	E9LUT8	Lactobacillus_phage	78.8	4.2e-15
WP_187337691.1|169081_169252_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069137015.1|169251_169509_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069137016.1|169610_170354_+	replisome organizer	NA	E9LUM6	Lactobacillus_phage	57.3	2.7e-40
WP_069137017.1|170353_171139_+	ATP-binding protein	NA	E9LUN6	Lactobacillus_phage	90.8	7.0e-132
WP_063722553.1|171274_171583_+	hypothetical protein	NA	E9LUN7	Lactobacillus_phage	93.1	1.2e-47
WP_106904767.1|171575_171734_+	hypothetical protein	NA	A0A2P0ZLB5	Lactobacillus_phage	92.3	3.3e-17
WP_187337692.1|171736_171895_+	hypothetical protein	NA	O03920	Lactobacillus_phage	96.2	8.4e-21
WP_080475537.1|171910_172324_+	hypothetical protein	NA	O03921	Lactobacillus_phage	61.9	1.7e-36
WP_069137018.1|172320_172686_+	hypothetical protein	NA	A0A291I9N7	Lactobacillus_phage	69.3	4.0e-42
WP_069137371.1|172685_173153_+	DUF1642 domain-containing protein	NA	A0A2P0ZLB8	Lactobacillus_phage	55.8	2.9e-37
WP_080475538.1|173149_173320_+	hypothetical protein	NA	E9LUP4	Lactobacillus_phage	91.1	2.9e-19
WP_022638818.1|173300_173726_+	phage transcriptional activator RinA	NA	E9LUP5	Lactobacillus_phage	81.6	3.1e-62
WP_069137019.1|173938_174607_+	HNH endonuclease	NA	B8R694	Lactobacillus_phage	39.0	1.7e-22
WP_080475539.1|174798_175233_+|terminase	phage terminase small subunit P27 family	terminase	B8R648	Lactobacillus_phage	37.7	1.8e-17
WP_069137020.1|175219_177136_+|terminase	terminase large subunit	terminase	A0A0M7RDK9	Lactobacillus_phage	41.3	3.7e-134
WP_069137373.1|177374_178493_+|portal	phage portal protein	portal	Q9AZM4	Lactococcus_phage	40.6	5.0e-67
WP_069137021.1|178464_179070_+|head,protease	HK97 family phage prohead protease	head,protease	B8R651	Lactobacillus_phage	49.1	1.1e-39
WP_069137024.1|180827_181175_+|head	phage head closure protein	head	A0A2P0ZLF0	Lactobacillus_phage	93.0	4.0e-55
WP_069137025.1|181177_181585_+	HK97 gp10 family phage protein	NA	A0A2P0ZLE6	Lactobacillus_phage	87.1	3.3e-61
WP_069137026.1|181584_181965_+	DUF806 family protein	NA	A0A2P0ZLF4	Lactobacillus_phage	88.9	3.2e-58
WP_069137027.1|181980_182634_+|tail	phage tail protein	tail	A0A2P0ZLH1	Lactobacillus_phage	88.9	1.3e-107
WP_063488422.1|182709_183084_+|tail	phage tail assembly chaperone	tail	A0A2P0ZLH4	Lactobacillus_phage	94.4	4.6e-57
WP_069137028.1|183128_183314_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069137029.1|183345_187704_+	C40 family peptidase	NA	A0A2P0ZLG0	Lactobacillus_phage	72.6	0.0e+00
WP_069137030.1|187777_189547_+|tail	phage tail family protein	tail	E9LUR2	Lactobacillus_phage	91.5	0.0e+00
WP_069137031.1|189613_191992_+|tail	phage tail protein	tail	E9LUR3	Lactobacillus_phage	89.8	0.0e+00
WP_069137032.1|191984_194750_+	hypothetical protein	NA	A0A2P0ZL34	Lactobacillus_phage	50.1	3.5e-194
WP_069137033.1|194742_194994_+	hypothetical protein	NA	A0A2K9VDF6	Lactobacillus_phage	95.8	9.3e-30
WP_187337693.1|194997_195159_+	hypothetical protein	NA	A0A2P0ZLG1	Lactobacillus_phage	96.2	8.0e-19
WP_069137034.1|195142_196171_+	hypothetical protein	NA	A0A2P0ZLF6	Lactobacillus_phage	87.8	9.0e-63
WP_069137375.1|196476_197592_+	LysM peptidoglycan-binding domain-containing protein	NA	O03950	Lactobacillus_phage	65.7	1.9e-45
WP_069137035.1|197592_197889_+	hypothetical protein	NA	A0A1I9KK55	Lactobacillus_phage	76.5	7.6e-39
WP_069137036.1|197875_198253_+|holin	holin	holin	A0A2K9VCG4	Lactobacillus_phage	70.0	2.1e-17
WP_003644508.1|199496_200708_+	FtsW/RodA/SpoVE family cell cycle protein	NA	NA	NA	NA	NA
WP_053338923.1|202946_203738_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.8	4.5e-30
WP_003644505.1|203718_204903_+	LCP family protein	NA	NA	NA	NA	NA
WP_003645636.1|205054_205627_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_053338920.1|206378_207320_-	glycosyltransferase family 2 protein	NA	V9QJB1	Oenococcus_phage	49.0	5.3e-78
WP_003644503.1|207765_208158_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003640750.1|208321_208714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053338919.1|208749_209919_+	hydroxymethylglutaryl-CoA synthase	NA	NA	NA	NA	NA
WP_069137037.1|209968_210598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089178220.1|210901_211132_+	DNA alkylation repair protein	NA	NA	NA	NA	NA
WP_003640747.1|211221_211854_-	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	56.2	2.3e-16
WP_003644501.1|212005_212245_+	DUF896 domain-containing protein	NA	NA	NA	NA	NA
WP_003640745.1|212342_212579_+	YneF family protein	NA	NA	NA	NA	NA
WP_003645630.1|212635_213271_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_003644499.1|213382_214141_+|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_003640742.1|214124_214430_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_003640741.1|214514_215513_+	D-2-hydroxyacid dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	34.9	2.3e-47
WP_069137038.1|215499_217179_-|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	41.5	4.7e-93
WP_003640740.1|217573_218296_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_003640739.1|218520_219324_+	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_003644498.1|219426_220305_+	elongation factor Ts	NA	NA	NA	NA	NA
219526:219543	attR	ATGGAAAAAGCCGTTGAC	NA	NA	NA	NA
WP_003640737.1|220505_221228_+	UMP kinase	NA	NA	NA	NA	NA
WP_003640736.1|221229_221793_+	ribosome recycling factor	NA	NA	NA	NA	NA
WP_003640735.1|221912_222692_+	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	43.1	1.1e-23
WP_003640734.1|222707_223493_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_003640733.1|223530_224808_+|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_069137039.1|224847_226557_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003640729.1|227050_231364_+	DNA polymerase III subunit alpha	NA	A0A1X9SH08	Bradyrhizobium_phage	34.0	1.0e-14
WP_003640728.1|231659_232136_+	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_069137040.1|232156_233374_+	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_003640726.1|233418_233718_+	YlxR family protein	NA	NA	NA	NA	NA
WP_003640725.1|233707_234013_+	ribosomal L7Ae/L30e/S12e/Gadd45 family protein	NA	NA	NA	NA	NA
WP_003645962.1|234027_236604_+	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	23.3	9.6e-21
WP_003640723.1|236626_236980_+	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_069137041.1|237628_239083_+	MFS transporter	NA	NA	NA	NA	NA
WP_013355607.1|239075_240245_+	chorismate synthase	NA	NA	NA	NA	NA
WP_069137042.1|240253_240781_+	amino acid biosynthesis protein	NA	NA	NA	NA	NA
WP_015825651.1|240794_242093_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_015825650.1|242095_243193_+	prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_027821257.1|243195_243717_+	shikimate kinase	NA	NA	NA	NA	NA
WP_027821256.1|244201_245125_+|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
>prophage 2
NZ_CP015308	Lactiplantibacillus plantarum strain LY-78 chromosome, complete genome	3119435	747549	754910	3119435		Lactobacillus_phage(83.33%)	7	NA	NA
WP_003645220.1|747549_748545_-	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	38.8	3.1e-52
WP_015380221.1|749171_749309_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_011101401.1|749404_749845_+	nucleoside 2-deoxyribosyltransferase	NA	A0A2P0ZL88	Lactobacillus_phage	98.6	3.0e-76
WP_003643095.1|749915_750476_-	hypothetical protein	NA	A0A2P0ZL75	Lactobacillus_phage	100.0	2.7e-101
WP_069137079.1|750563_753002_-	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	99.1	0.0e+00
WP_003643097.1|753004_753619_-	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	100.0	6.3e-112
WP_003643099.1|753962_754910_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	100.0	2.7e-178
>prophage 3
NZ_CP015308	Lactiplantibacillus plantarum strain LY-78 chromosome, complete genome	3119435	1361368	1369993	3119435		Streptococcus_phage(66.67%)	11	NA	NA
WP_053338713.1|1361368_1362364_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	37.9	1.0e-50
WP_069137131.1|1362502_1363288_-	acyl-ACP thioesterase	NA	NA	NA	NA	NA
WP_053338711.1|1363291_1364188_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	55.7	1.7e-81
WP_003640967.1|1364286_1364634_-	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	33.3	2.4e-12
WP_003640966.1|1364658_1365678_-	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	33.5	2.1e-32
WP_003640965.1|1365694_1366024_-	cyclic-di-AMP receptor	NA	NA	NA	NA	NA
WP_003644908.1|1366020_1366686_-	dTMP kinase	NA	M1PSC7	Streptococcus_phage	52.7	1.4e-53
WP_003640957.1|1367084_1367336_-	YaaL family protein	NA	NA	NA	NA	NA
WP_003637790.1|1367350_1367950_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_003640956.1|1367965_1368274_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_069137132.1|1368295_1369993_-	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	37.0	3.9e-55
>prophage 4
NZ_CP015308	Lactiplantibacillus plantarum strain LY-78 chromosome, complete genome	3119435	1510188	1607211	3119435	bacteriocin,tRNA,protease,transposase	uncultured_Mediterranean_phage(15.38%)	87	NA	NA
WP_054397570.1|1510188_1511460_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	43.7	3.4e-96
WP_003642042.1|1511926_1513540_-	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	49.9	1.2e-143
WP_003642041.1|1513712_1514321_-	DNA-directed RNA polymerase subunit delta	NA	NA	NA	NA	NA
WP_069137145.1|1514365_1514806_-	DUF1934 domain-containing protein	NA	NA	NA	NA	NA
WP_069137146.1|1515170_1516103_+	lipoate--protein ligase family protein	NA	NA	NA	NA	NA
WP_187337697.1|1516111_1517470_+	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	32.9	2.3e-26
WP_063731239.1|1517489_1518299_+	sugar-phosphatase	NA	NA	NA	NA	NA
WP_054397561.1|1518464_1519451_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054397559.1|1519533_1520556_-	YdcF family protein	NA	NA	NA	NA	NA
WP_003643830.1|1520843_1521824_-	ribose-phosphate diphosphokinase	NA	A0A2K9L8D8	Tupanvirus	36.3	4.9e-42
WP_069137383.1|1522177_1523002_-	serine hydrolase	NA	NA	NA	NA	NA
WP_054397557.1|1523228_1524611_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A2K9L140	Tupanvirus	32.8	1.3e-27
WP_069137148.1|1524679_1525516_-	pur operon repressor	NA	NA	NA	NA	NA
WP_063723574.1|1525871_1526669_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_003642023.1|1526661_1527360_-	ABC transporter ATP-binding protein	NA	A0A1V0SGN0	Hokovirus	27.8	1.2e-15
WP_021356652.1|1527626_1528571_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_045352037.1|1528880_1529747_-	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_003642020.1|1529879_1530131_-	Veg family protein	NA	NA	NA	NA	NA
WP_069137149.1|1530235_1531126_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_063723569.1|1531122_1531686_-	ribonuclease M5	NA	NA	NA	NA	NA
WP_069137150.1|1531672_1532449_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_063723567.1|1532571_1533756_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_069137151.1|1533988_1536040_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	35.6	7.7e-90
WP_003646492.1|1536361_1536751_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_003642012.1|1537347_1538190_-	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_003642011.1|1538189_1538894_-	NAD-dependent protein deacylase	NA	NA	NA	NA	NA
WP_003642010.1|1538915_1539875_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003642009.1|1539867_1541142_-	hydroxymethylglutaryl-CoA reductase, degradative	NA	NA	NA	NA	NA
WP_011101010.1|1541187_1542105_-	Ppx/GppA family phosphatase	NA	NA	NA	NA	NA
WP_027822753.1|1542547_1543561_-|tRNA	tRNA-dihydrouridine synthase family protein	tRNA	NA	NA	NA	NA
WP_003642004.1|1543673_1544420_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_080475553.1|1544569_1545466_-	ROK family protein	NA	NA	NA	NA	NA
WP_069137152.1|1545586_1547023_-	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	25.3	2.8e-30
WP_003643816.1|1547040_1548396_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_003642000.1|1548618_1549041_-	DUF3284 domain-containing protein	NA	NA	NA	NA	NA
WP_003641999.1|1549030_1549219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069137153.1|1549225_1550587_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_003641997.1|1550659_1551370_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_069137154.1|1551866_1552808_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.2	4.6e-21
WP_069137155.1|1552788_1553922_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.4	1.2e-15
WP_106904656.1|1553893_1554832_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_069137156.1|1554833_1556324_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_069137157.1|1556396_1558358_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003643815.1|1558705_1559722_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_069137158.1|1560161_1560938_-	carbon-nitrogen family hydrolase	NA	NA	NA	NA	NA
WP_069137159.1|1561192_1563502_+	ATP-binding domain-containing protein	NA	NA	NA	NA	NA
WP_069137160.1|1563596_1563800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069137161.1|1563937_1564624_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_065080250.1|1564717_1565398_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_069137162.1|1565484_1566153_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_069137163.1|1566219_1566909_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_069137164.1|1566998_1568375_-	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_015825125.1|1568390_1570541_-	peptide cleavage/export ABC transporter	NA	W8CYL7	Bacillus_phage	27.9	6.1e-45
WP_003641985.1|1570807_1570978_+|bacteriocin	two-peptide bacteriocin plantaricin EF subunit PlnE	bacteriocin	NA	NA	NA	NA
WP_003643811.1|1571002_1571161_+|bacteriocin	two-peptide bacteriocin plantaricin EF subunit PlnF	bacteriocin	NA	NA	NA	NA
WP_021356666.1|1571259_1572033_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_069137165.1|1572337_1573081_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_063724134.1|1573199_1573943_-	LytTR family transcriptional regulator DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_069137166.1|1573943_1575272_-	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_046947768.1|1575462_1575609_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_069137167.1|1576869_1577538_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_027821506.1|1578479_1578659_-|bacteriocin	class IIb bacteriocin, lactobin A/cerein 7B family	bacteriocin	NA	NA	NA	NA
WP_011100995.1|1579222_1580407_-	cation:proton antiporter	NA	NA	NA	NA	NA
WP_069137168.1|1580451_1581828_-	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
WP_069137169.1|1582353_1583169_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_069137170.1|1583328_1584201_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_069137171.1|1584271_1585063_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_069137172.1|1585066_1586221_+	MFS transporter	NA	NA	NA	NA	NA
WP_015379760.1|1586224_1586842_+	sugar O-acetyltransferase	NA	NA	NA	NA	NA
WP_097558290.1|1587037_1587837_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_074029678.1|1587917_1588640_-	aquaporin family protein	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	31.9	5.4e-30
WP_003643774.1|1588654_1590484_-	type 1 glycerol-3-phosphate oxidase	NA	NA	NA	NA	NA
WP_063731274.1|1590498_1592016_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_063731276.1|1592479_1593811_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_054397376.1|1593888_1594860_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.7	1.7e-23
WP_069137174.1|1594860_1596387_-	ABC transporter permease/substrate-binding protein	NA	NA	NA	NA	NA
WP_063724647.1|1596624_1597071_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069137175.1|1597806_1598718_-	oxidoreductase	NA	NA	NA	NA	NA
WP_063724646.1|1598854_1599775_+	ribonucleoside hydrolase RihC	NA	NA	NA	NA	NA
WP_063724645.1|1599928_1600486_-	acetyl-CoA carboxylase biotin carboxyl carrier protein subunit	NA	NA	NA	NA	NA
WP_063724644.1|1600589_1601045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069137176.1|1601642_1602839_+	DUF2075 domain-containing protein	NA	NA	NA	NA	NA
WP_003641932.1|1602869_1603379_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_003643763.1|1603490_1603859_-	DUF1304 domain-containing protein	NA	NA	NA	NA	NA
WP_069137177.1|1604122_1605628_-	multicopper oxidase domain-containing protein	NA	NA	NA	NA	NA
WP_024002428.1|1605785_1606454_-	ribose 5-phosphate isomerase A	NA	NA	NA	NA	NA
WP_063724637.1|1606647_1607211_+|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
>prophage 5
NZ_CP015308	Lactiplantibacillus plantarum strain LY-78 chromosome, complete genome	3119435	2754097	2762608	3119435		Synechococcus_phage(33.33%)	9	NA	NA
WP_003645861.1|2754097_2754580_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	41.0	2.3e-16
WP_053339078.1|2754563_2755694_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_069137325.1|2755696_2756428_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	M4SM18	Cyanophage	37.3	3.5e-37
WP_003642588.1|2756429_2756684_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_011101895.1|2756683_2757364_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_069137326.1|2757356_2759576_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	39.1	2.7e-144
WP_003642591.1|2759560_2761015_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.0	2.5e-50
WP_069137327.1|2761011_2762037_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	41.3	2.1e-59
WP_003645867.1|2762029_2762608_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	33.9	1.3e-21
>prophage 6
NZ_CP015308	Lactiplantibacillus plantarum strain LY-78 chromosome, complete genome	3119435	2958156	2970420	3119435	capsid,portal,terminase,integrase,head	Staphylococcus_phage(25.0%)	14	2957959:2957980	2972105:2972126
2957959:2957980	attL	TTGGCTGTCCTTTTGGCTGACT	NA	NA	NA	NA
WP_069137346.1|2958156_2959314_-|integrase	site-specific integrase	integrase	Q938N9	Temperate_phage	35.1	1.0e-54
WP_069137347.1|2959372_2959939_-	helix-turn-helix transcriptional regulator	NA	A0A1P8BMN9	Lactococcus_phage	50.0	5.9e-08
WP_016511388.1|2960097_2960277_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_069137348.1|2960545_2960776_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069137349.1|2960789_2961590_+	bifunctional DNA primase/polymerase	NA	NA	NA	NA	NA
WP_069137350.1|2961589_2962984_+	virulence protein	NA	Q4ZD27	Staphylococcus_phage	36.1	1.6e-70
WP_069137351.1|2963128_2963548_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064578496.1|2963571_2963757_+	sporulation protein Cse60	NA	NA	NA	NA	NA
WP_069137352.1|2963766_2964105_+|head	phage head closure protein	head	A0A2P0ZLF0	Lactobacillus_phage	34.7	1.3e-07
WP_069137353.1|2964097_2964487_+	HNH endonuclease	NA	A0A1J0MFT4	Staphylococcus_phage	45.2	1.0e-19
WP_069137354.1|2965453_2965927_+|terminase	phage terminase small subunit P27 family	terminase	NA	NA	NA	NA
WP_069137355.1|2965923_2967627_+|terminase	terminase large subunit	terminase	A0A2H4JBN3	uncultured_Caudovirales_phage	40.3	1.4e-121
WP_057705764.1|2967781_2968882_+|portal	phage portal protein	portal	A0A2H4J9Q5	uncultured_Caudovirales_phage	34.0	8.8e-48
WP_069137357.1|2968878_2970420_+|capsid	phage major capsid protein	capsid	B8R651	Lactobacillus_phage	26.2	8.8e-46
2972105:2972126	attR	TTGGCTGTCCTTTTGGCTGACT	NA	NA	NA	NA
