The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP014168	Sphingomonas panacis strain DCY99 chromosome, complete genome	5003808	235065	248653	5003808	head,tail,protease,capsid,portal	Gordonia_phage(20.0%)	17	NA	NA
WP_069203339.1|235065_237228_-	hypothetical protein	NA	A0A0K0PWS5	Roseobacter_phage	31.6	6.4e-18
WP_069203340.1|237229_237622_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069203341.1|237618_238428_-	DUF2163 domain-containing protein	NA	Q5DN21	Alphaproteobacteria_virus	37.6	7.9e-22
WP_069203342.1|238424_240719_-	DUF2460 domain-containing protein	NA	A0A0P1KKK5	Acinetobacter_phage	30.1	2.0e-46
WP_069203343.1|240726_241296_-|tail	tail tape measure protein	tail	D6PEW0	uncultured_phage	30.1	7.3e-06
WP_069203344.1|241288_241489_-|tail	phage tail assembly chaperone	tail	NA	NA	NA	NA
WP_069203345.1|241485_241800_-	gene transfer agent family protein	NA	NA	NA	NA	NA
WP_069203346.1|241796_242204_-|tail	phage major tail protein, TP901-1 family	tail	I3UM07	Rhodobacter_phage	34.8	7.5e-13
WP_069203347.1|242234_242618_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_069203348.1|242614_242812_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069206910.1|242805_243369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069203349.1|243472_244528_-|capsid	phage major capsid protein	capsid	A0A2D1GNH4	Pseudomonas_phage	46.1	1.2e-78
WP_069206911.1|244602_244965_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4P9T7	Gordonia_phage	37.6	1.1e-07
WP_069203350.1|245066_245375_-	hypothetical protein	NA	K4I011	Acidithiobacillus_phage	45.1	1.9e-08
WP_069203351.1|245371_246505_-|portal	phage portal protein	portal	W8ECU7	Geobacillus_phage	35.6	9.6e-50
WP_069203352.1|246593_247265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069203353.1|247330_248653_-	DNA-packaging protein	NA	A0A0K0N6T3	Gordonia_phage	39.3	1.0e-66
>prophage 2
NZ_CP014168	Sphingomonas panacis strain DCY99 chromosome, complete genome	5003808	1380847	1433219	5003808	head,tail,capsid,integrase,tRNA,portal,plate	Burkholderia_phage(20.0%)	60	1374682:1374702	1430923:1430943
1374682:1374702	attL	CCCCAACAACCCGACCGGCAC	NA	NA	NA	NA
WP_069204182.1|1380847_1381657_-	DNA adenine methylase	NA	A0A219VHB5	Ochrobactrum_phage	56.2	1.9e-84
WP_069204183.1|1381808_1382876_-|portal	phage portal protein	portal	A4PE27	Ralstonia_virus	53.8	2.5e-100
WP_069207085.1|1382875_1384666_-	oxidoreductase	NA	E5FFI8	Burkholderia_phage	56.6	6.6e-186
WP_069204184.1|1384856_1385681_+|capsid	GPO family capsid scaffolding protein	capsid	E5E3W9	Burkholderia_phage	37.5	4.1e-34
WP_069204185.1|1385730_1386783_+|capsid	phage major capsid protein, P2 family	capsid	Q9ZXM3	Pseudomonas_virus	47.7	4.7e-83
WP_083224527.1|1386831_1387752_+	hypothetical protein	NA	A4PE31	Ralstonia_virus	38.1	6.9e-38
WP_083224528.1|1387947_1388589_+|head	head completion/stabilization protein	head	A4PE32	Ralstonia_virus	46.2	9.0e-29
WP_069204188.1|1388588_1388804_+|tail	phage tail protein	tail	K4PAW7	Burkholderia_phage	52.2	1.6e-09
WP_069204189.1|1388806_1389154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069204190.1|1389150_1389669_+	glycoside hydrolase family protein	NA	A0A1J0GVQ7	Pseudoalteromonas_phage	38.6	4.7e-20
WP_069204191.1|1389665_1390184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069204192.1|1390155_1390437_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069207087.1|1390433_1390931_+|tail	phage tail protein	tail	A0A1S5NPS3	Burkholderia_phage	53.0	8.6e-27
WP_083224529.1|1390923_1391592_+	phage virion morphogenesis protein	NA	R4JJX8	Burkholderia_phage	30.9	4.2e-13
WP_069207089.1|1391800_1392718_+|plate	baseplate J/gp47 family protein	plate	A0A088FQL4	Escherichia_phage	47.3	1.8e-62
WP_069204193.1|1392704_1393361_+|tail	phage tail protein I	tail	V9IQK7	Stenotrophomonas_phage	41.5	3.6e-33
WP_069204194.1|1393360_1394848_+	hypothetical protein	NA	V9IQX0	Stenotrophomonas_phage	39.8	1.0e-22
WP_150126838.1|1394850_1395330_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069204196.1|1395333_1396056_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069204197.1|1396052_1397633_+	hypothetical protein	NA	A0A222ZJQ9	Arthrobacter_phage	32.2	2.2e-28
WP_150126839.1|1397636_1398548_+	hypothetical protein	NA	D4P7M2	Rhodococcus_phage	37.3	9.5e-32
WP_069204199.1|1398952_1399504_+|plate	phage baseplate assembly protein V	plate	NA	NA	NA	NA
WP_069204200.1|1399500_1399869_+	GPW/gp25 family protein	NA	V9IQW0	Stenotrophomonas_phage	50.0	4.5e-25
WP_069204201.1|1399879_1401076_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	Q9ZXK4	Pseudomonas_virus	56.2	2.5e-96
WP_069204202.1|1401100_1401613_+|tail	phage major tail tube protein	tail	V9IQX1	Stenotrophomonas_phage	61.3	5.0e-54
WP_069207090.1|1401697_1401991_+|tail	phage tail assembly protein	tail	R4JJY8	Burkholderia_phage	43.2	3.9e-11
WP_069204203.1|1401999_1402116_+|tail	GpE family phage tail protein	tail	A0A1S5NR79	Burkholderia_phage	61.8	3.6e-05
WP_069204204.1|1402122_1404615_+|tail	phage tail tape measure protein	tail	Q9ZXK0	Pseudomonas_virus	28.5	1.4e-69
WP_069204205.1|1404611_1405049_+|tail	phage tail protein	tail	Q9ZXJ9	Pseudomonas_virus	54.4	1.8e-33
WP_069204206.1|1405048_1406047_+	late control protein	NA	A4JWX2	Burkholderia_virus	49.1	9.6e-78
WP_150126841.1|1406047_1406746_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083224531.1|1406925_1407429_-	helix-turn-helix domain-containing protein	NA	A0A059VK24	Pseudomonas_phage	39.5	5.8e-07
WP_069204209.1|1407510_1407831_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_083224532.1|1407823_1408060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083224533.1|1408056_1408557_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150127064.1|1408571_1408889_+	ogr/Delta-like zinc finger family protein	NA	A0A077K829	Ralstonia_phage	43.8	1.7e-12
WP_069204210.1|1408999_1409374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069204211.1|1409384_1412108_+	toprim domain-containing protein	NA	A0A077K8T2	Ralstonia_phage	46.4	3.7e-233
WP_069204212.1|1412107_1412545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083224912.1|1412556_1412913_+	DUF2312 domain-containing protein	NA	B0VK10	Azospirillum_phage	55.3	1.2e-14
WP_069204213.1|1413234_1413447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069204215.1|1413676_1414018_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069204216.1|1414010_1414583_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069204217.1|1414579_1415080_+	ASCH domain-containing protein	NA	A0A068CCC0	Rhizobium_phage	53.3	5.7e-39
WP_069204218.1|1415234_1416353_+	phosphoadenosine phosphosulfate reductase family protein	NA	NA	NA	NA	NA
WP_069204219.1|1416349_1417042_+	DNA methylase	NA	A0A0K0MD78	Pseudoalteromonas_phage	32.7	2.6e-21
WP_069204220.1|1417038_1417227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069204221.1|1417223_1418357_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A291AUF0	Sinorhizobium_phage	33.8	8.2e-41
WP_069204222.1|1418474_1418966_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_083224913.1|1418991_1419711_+	uracil-DNA glycosylase	NA	NA	NA	NA	NA
WP_069204223.1|1420079_1420943_-	N-carbamoylputrescine amidase	NA	M1H5W0	Paramecium_bursaria_Chlorella_virus	43.3	2.3e-64
WP_069204224.1|1421504_1422566_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.3	4.5e-33
WP_069207095.1|1422562_1423345_-	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_069204225.1|1423674_1424283_-	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
WP_069204226.1|1424396_1426709_-	DNA translocase FtsK 4TM domain-containing protein	NA	S5VNE3	Mycobacterium_phage	46.5	3.2e-84
WP_069204227.1|1426998_1428426_+	D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase	NA	NA	NA	NA	NA
WP_069207096.1|1428656_1428914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069204228.1|1429475_1430309_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_069207097.1|1430374_1431532_+	pyridoxal phosphate-dependent aminotransferase	NA	A0A0H3TLT9	Faustovirus	26.2	2.8e-12
1430923:1430943	attR	CCCCAACAACCCGACCGGCAC	NA	NA	NA	NA
WP_069204229.1|1431638_1433219_+|tRNA	lysine--tRNA ligase	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP014168	Sphingomonas panacis strain DCY99 chromosome, complete genome	5003808	2249824	2300339	5003808	transposase,integrase	Acinetobacter_phage(42.86%)	41	2262799:2262814	2299648:2299663
WP_069207206.1|2249824_2250760_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_150126884.1|2250893_2251942_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_150126885.1|2252120_2252396_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083224610.1|2252464_2253928_-	O-antigen polysaccharide polymerase Wzy	NA	NA	NA	NA	NA
WP_169833121.1|2254048_2254222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169833122.1|2254212_2254674_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_083224611.1|2255031_2255280_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_069204837.1|2256846_2257077_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_069204838.1|2257192_2257723_+	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_069204839.1|2257736_2258702_+	FecR domain-containing protein	NA	NA	NA	NA	NA
WP_069204840.1|2258775_2259318_-	MucR family transcriptional regulator	NA	A0A1P8VVG0	Erythrobacter_phage	45.4	5.9e-21
WP_150126887.1|2259466_2259847_-	conjugal transfer protein TraD	NA	NA	NA	NA	NA
WP_083224935.1|2259785_2259977_-	conjugal transfer protein TraD	NA	NA	NA	NA	NA
WP_083224614.1|2260327_2260540_-	AlpA family phage regulatory protein	NA	A0A1V0E8E5	Vibrio_phage	46.0	1.9e-07
WP_069204845.1|2262212_2263769_-	glycoside hydrolase family 28 protein	NA	NA	NA	NA	NA
2262799:2262814	attL	TCGAGCGCGATGCCGC	NA	NA	NA	NA
WP_083224936.1|2263831_2266912_-	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	32.8	8.5e-16
WP_083224937.1|2267156_2268758_+	glycosyl hydrolase 43 family protein	NA	NA	NA	NA	NA
WP_069204847.1|2268754_2270326_+	alpha-L-rhamnosidase	NA	NA	NA	NA	NA
WP_069204848.1|2270316_2271354_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	31.9	4.7e-27
WP_069204849.1|2271607_2271832_-	DUF2274 domain-containing protein	NA	NA	NA	NA	NA
WP_069204850.1|2272129_2272369_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069204851.1|2272487_2273669_-	TrbI/VirB10 family protein	NA	NA	NA	NA	NA
WP_069204852.1|2273665_2274598_-	P-type conjugative transfer protein TrbG	NA	NA	NA	NA	NA
WP_069204853.1|2274594_2275407_-	conjugal transfer protein TrbF	NA	NA	NA	NA	NA
WP_069204854.1|2275410_2276709_-	P-type conjugative transfer protein TrbL	NA	NA	NA	NA	NA
WP_083224938.1|2276799_2277477_-	P-type conjugative transfer protein TrbJ	NA	NA	NA	NA	NA
WP_069204855.1|2278158_2279229_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_083224939.1|2279762_2280356_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_169833123.1|2280279_2281254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083224616.1|2281387_2284183_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	24.3	4.2e-22
WP_069204858.1|2284199_2287346_+	PD40 domain-containing protein	NA	NA	NA	NA	NA
WP_169833124.1|2288521_2289556_-	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_069204861.1|2289646_2290417_-	cyclase family protein	NA	NA	NA	NA	NA
WP_069204862.1|2290416_2291403_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_169833125.1|2291444_2292854_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_083224618.1|2293009_2293672_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_083224619.1|2293770_2294142_-	GFA family protein	NA	NA	NA	NA	NA
WP_169833126.1|2294212_2294698_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_150126889.1|2294785_2295914_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	28.5	1.1e-21
WP_069204866.1|2298235_2299141_+|integrase	site-specific integrase	integrase	S5W9T9	Leptospira_phage	29.8	3.0e-22
WP_069204867.1|2299145_2300339_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
2299648:2299663	attR	GCGGCATCGCGCTCGA	NA	NA	NA	NA
>prophage 4
NZ_CP014168	Sphingomonas panacis strain DCY99 chromosome, complete genome	5003808	3525677	3584376	5003808	transposase	Stx2-converting_phage(40.0%)	52	NA	NA
WP_169833225.1|3525677_3526741_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_069205752.1|3526837_3527623_-	class II aldolase/adducin family protein	NA	NA	NA	NA	NA
WP_083224718.1|3527642_3528725_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_069205753.1|3528726_3529815_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_069205754.1|3529838_3531074_-	thiosulfate sulfurtransferase	NA	NA	NA	NA	NA
WP_069205755.1|3531070_3531682_-	cysteine dioxygenase	NA	NA	NA	NA	NA
WP_069205756.1|3531678_3532461_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.2	3.4e-22
WP_069205757.1|3532460_3533276_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_069205758.1|3533533_3534373_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_069205759.1|3534591_3535254_+	AhpC/TSA family protein	NA	NA	NA	NA	NA
WP_069205760.1|3535286_3536240_-	dehydrogenase	NA	NA	NA	NA	NA
WP_069205761.1|3536236_3537406_-	acyl-CoA/acyl-ACP dehydrogenase	NA	NA	NA	NA	NA
WP_083224719.1|3537407_3538232_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_150126940.1|3538295_3539467_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	28.2	4.4e-13
WP_069205763.1|3539480_3539849_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_083224720.1|3539845_3540247_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_069203773.1|3540491_3540857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069203774.1|3540955_3542518_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	46.9	5.8e-122
WP_069203775.1|3542570_3542918_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	60.9	4.3e-33
WP_169833225.1|3542981_3544045_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_169833226.1|3545120_3546662_-	sulfatase	NA	A0A2P0VMN7	Tetraselmis_virus	24.5	2.0e-10
WP_069205766.1|3546731_3547370_-	maleylacetoacetate isomerase	NA	NA	NA	NA	NA
WP_069205767.1|3547362_3548061_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_069205768.1|3548057_3549107_-	gentisate 1,2-dioxygenase	NA	NA	NA	NA	NA
WP_069207408.1|3549100_3550783_-	glycoside hydrolase family 3 protein	NA	NA	NA	NA	NA
WP_069205769.1|3550903_3553327_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_083224721.1|3553516_3554872_+	MFS transporter	NA	NA	NA	NA	NA
WP_069205770.1|3554911_3555964_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_069205771.1|3556125_3558021_+	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_069205772.1|3558037_3559759_+	sulfatase	NA	NA	NA	NA	NA
WP_069205773.1|3559792_3560725_+	formylglycine-generating enzyme family protein	NA	NA	NA	NA	NA
WP_069205774.1|3560694_3561225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069205775.1|3561278_3562769_+	sulfatase	NA	NA	NA	NA	NA
WP_069205776.1|3563330_3564350_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_069207410.1|3564518_3565274_-	class II aldolase/adducin family protein	NA	NA	NA	NA	NA
WP_069207411.1|3565381_3565753_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_069205777.1|3567300_3569238_+	thiamine pyrophosphate-binding protein	NA	NA	NA	NA	NA
WP_083224724.1|3569241_3569895_+	cytochrome c	NA	NA	NA	NA	NA
WP_083224725.1|3570007_3572140_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_069205780.1|3572306_3573638_+	Rieske 2Fe-2S domain-containing protein	NA	NA	NA	NA	NA
WP_069205781.1|3573634_3573982_+	non-heme iron oxygenase ferredoxin subunit	NA	NA	NA	NA	NA
WP_150126943.1|3574100_3574610_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_069207412.1|3574617_3575343_-	class II aldolase/adducin family protein	NA	NA	NA	NA	NA
WP_069205783.1|3575408_3576020_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_069205784.1|3576058_3577048_-	amidohydrolase	NA	NA	NA	NA	NA
WP_069205785.1|3577079_3577778_-	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_069205786.1|3578083_3579028_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_069205787.1|3579220_3579718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069205788.1|3579816_3581424_+	MFS transporter	NA	NA	NA	NA	NA
WP_069205789.1|3581420_3581744_+	NIPSNAP family protein	NA	NA	NA	NA	NA
WP_069205790.1|3581752_3583012_+	oxidoreductase	NA	NA	NA	NA	NA
WP_069207206.1|3583440_3584376_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP014168	Sphingomonas panacis strain DCY99 chromosome, complete genome	5003808	4174816	4248535	5003808	transposase,head,tail,capsid,integrase,terminase,portal	Rhodobacter_phage(19.05%)	87	4185664:4185680	4192486:4192502
WP_150126979.1|4174816_4175574_-|transposase	IS5 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	40.2	1.5e-14
WP_069206230.1|4175658_4176768_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_083224790.1|4176822_4177272_+	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	50.0	4.5e-27
WP_083224791.1|4177295_4177673_+	excalibur calcium-binding domain-containing protein	NA	NA	NA	NA	NA
WP_150126980.1|4177826_4178615_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150126981.1|4178830_4179229_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150126982.1|4179297_4179672_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069206233.1|4179715_4180009_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_083224792.1|4179996_4180275_-	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_069207493.1|4180538_4181555_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069207494.1|4181916_4182303_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_083224985.1|4182417_4182843_-	GFA family protein	NA	NA	NA	NA	NA
WP_069206235.1|4182982_4183378_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_069206236.1|4183882_4184251_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069206237.1|4184238_4184424_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169833170.1|4184523_4184694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069206238.1|4184969_4186253_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q8W6M6	Sinorhizobium_phage	41.6	1.5e-83
4185664:4185680	attL	CGCGCCTGCTGGCGCTG	NA	NA	NA	NA
WP_083224794.1|4186266_4187010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069206239.1|4187210_4188416_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q8W6M6	Sinorhizobium_phage	41.2	2.4e-75
WP_069206241.1|4188748_4189816_+	RelA/SpoT domain-containing protein	NA	A0A1B0VBT5	Salmonella_phage	31.0	6.1e-30
WP_150126793.1|4189980_4190927_-|transposase	IS630 family transposase	transposase	A0A2P0VP61	Tetraselmis_virus	24.4	5.5e-14
WP_069206242.1|4191015_4191801_-	DNA adenine methylase	NA	A0A291AUP9	Sinorhizobium_phage	55.9	9.2e-76
WP_069206243.1|4192164_4192431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150126983.1|4192387_4192843_-	hypothetical protein	NA	NA	NA	NA	NA
4192486:4192502	attR	CAGCGCCAGCAGGCGCG	NA	NA	NA	NA
WP_150126984.1|4192839_4193100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069207496.1|4193111_4193624_-	glycoside hydrolase family protein	NA	A0A291LB53	Caulobacter_phage	42.0	8.0e-20
WP_069206246.1|4193635_4193917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150126985.1|4193997_4194819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150126986.1|4194824_4195745_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150126987.1|4195757_4197743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069206249.1|4197753_4197960_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169833171.1|4197970_4198144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069206250.1|4198140_4201374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069206251.1|4201377_4201800_-	hypothetical protein	NA	A0A2L0V149	Salmonella_phage	41.6	4.3e-19
WP_069206252.1|4201809_4202397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150126988.1|4202397_4202988_-	hypothetical protein	NA	A0A2P1CKS5	Pantoea_phage	30.8	3.0e-18
WP_169833172.1|4202987_4206365_-	tape measure protein	NA	A0A2H4GY14	Pseudomonas_phage	43.6	9.6e-37
WP_150127115.1|4206758_4206935_-|tail	phage tail assembly chaperone	tail	NA	NA	NA	NA
WP_069206256.1|4207318_4207750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069206257.1|4207817_4208207_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_069206258.1|4208199_4208658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169833173.1|4208654_4208981_-|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
WP_069206260.1|4209007_4209307_-|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_169833174.1|4209329_4209476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069206261.1|4209569_4210883_-|capsid	phage major capsid protein	capsid	I3ULZ9	Rhodobacter_phage	39.4	8.8e-71
WP_069206262.1|4210906_4211836_-	S49 family peptidase	NA	I3ULZ8	Rhodobacter_phage	44.7	1.9e-59
WP_169833175.1|4211832_4213122_-|portal	phage portal protein	portal	I3ULZ7	Rhodobacter_phage	44.2	5.4e-89
WP_069207497.1|4213130_4214828_-|terminase	terminase large subunit	terminase	A0A0R6PKH7	Moraxella_phage	46.9	2.2e-138
WP_069206264.1|4214939_4215431_-|terminase	P27 family phage terminase small subunit	terminase	NA	NA	NA	NA
WP_069206265.1|4215593_4215917_-	HNH endonuclease	NA	A0A0U2C119	Paracoccus_phage	54.4	4.4e-08
WP_069206266.1|4215917_4216556_-	DUF3164 family protein	NA	M4STB6	Rhodobacter_phage	57.4	1.4e-58
WP_169833176.1|4216552_4216714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069206267.1|4216713_4217007_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150126989.1|4217155_4217761_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069206269.1|4217732_4218044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069206270.1|4218585_4218942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069206271.1|4219155_4220487_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069206272.1|4221057_4222095_-	serine/threonine protein kinase	NA	G9L673	Escherichia_phage	39.0	5.9e-62
WP_069206273.1|4222095_4222542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150126990.1|4222734_4223163_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069206275.1|4223305_4223752_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150126991.1|4223788_4224100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169833177.1|4224142_4224505_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_069206277.1|4224552_4224834_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_069206278.1|4224830_4225073_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069206280.1|4225434_4226103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069206281.1|4226191_4226398_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150126992.1|4226394_4226793_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_069206283.1|4226789_4226987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069206284.1|4226983_4227199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069206285.1|4227195_4227438_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069206286.1|4227434_4227674_+	DUF2312 domain-containing protein	NA	B0VK10	Azospirillum_phage	61.2	1.2e-18
WP_069206287.1|4228052_4228268_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_083224798.1|4228367_4229936_-	recombinase family protein	NA	A0A097BYD1	Leuconostoc_phage	28.5	1.0e-17
WP_069206288.1|4230393_4230927_-	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_069206289.1|4230904_4233889_-	relaxase domain-containing protein	NA	NA	NA	NA	NA
WP_069206290.1|4233885_4235934_-	type IV secretion system DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_069206291.1|4235930_4236233_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069206292.1|4236700_4237027_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069206293.1|4237176_4238190_-	DUF2493 domain-containing protein	NA	NA	NA	NA	NA
WP_069206294.1|4238268_4238760_-	DUF736 domain-containing protein	NA	NA	NA	NA	NA
WP_069206295.1|4239654_4240650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069206296.1|4240960_4244932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069206297.1|4245117_4245393_+	HU family DNA-binding protein	NA	A0A2P1JU83	Erwinia_phage	45.6	6.2e-11
WP_069206298.1|4245469_4246138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069206299.1|4246236_4246890_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169833178.1|4247056_4248535_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP014168	Sphingomonas panacis strain DCY99 chromosome, complete genome	5003808	4401215	4430479	5003808	transposase	Stx2-converting_phage(50.0%)	29	NA	NA
WP_169833192.1|4401215_4401710_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_169833228.1|4402574_4402856_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069206424.1|4402942_4403407_+	SRPBCC family protein	NA	NA	NA	NA	NA
WP_069207206.1|4403663_4404599_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_150127005.1|4405314_4405659_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069206425.1|4405825_4407490_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	44.0	1.3e-111
WP_069206426.1|4407548_4407890_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	53.4	1.1e-28
WP_069206427.1|4407886_4408255_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_069206428.1|4408621_4409113_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150127006.1|4409396_4409972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069206431.1|4410000_4410603_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_083224822.1|4410972_4411356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069206432.1|4411490_4412147_+	maleylacetoacetate isomerase	NA	NA	NA	NA	NA
WP_069206433.1|4412468_4413170_+	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_069206434.1|4413263_4413935_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_083224993.1|4414016_4415189_+	FAD-dependent monooxygenase	NA	NA	NA	NA	NA
WP_069206436.1|4415185_4416712_+	FAD-dependent monooxygenase	NA	NA	NA	NA	NA
WP_069206437.1|4416824_4417235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069206438.1|4417655_4418558_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_083224994.1|4418924_4420457_+|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.7	2.2e-126
WP_069206440.1|4420468_4421209_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	46.7	2.5e-59
WP_069207519.1|4421444_4422650_+	MFS transporter	NA	NA	NA	NA	NA
WP_069206441.1|4422845_4423175_+	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_083224823.1|4423188_4424205_+	pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha	NA	NA	NA	NA	NA
WP_069206443.1|4424262_4424988_+	TSUP family transporter	NA	NA	NA	NA	NA
WP_069206444.1|4425086_4425992_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_069206445.1|4426095_4427133_+	NAD(P)-dependent alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_069206447.1|4427849_4428530_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_069206448.1|4429048_4430479_+|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP014168	Sphingomonas panacis strain DCY99 chromosome, complete genome	5003808	4587431	4595676	5003808	protease	Caulobacter_phage(42.86%)	9	NA	NA
WP_069206576.1|4587431_4588538_-|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.7	9.1e-37
WP_083224845.1|4588527_4589277_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069206577.1|4589273_4590377_-	phosphoribosyltransferase domain-containing protein	NA	A0A172Q0Y1	Acinetobacter_phage	28.4	1.7e-27
WP_069206578.1|4590370_4591519_-	trypsin-like peptidase domain-containing protein	NA	A0A1B1IRH0	uncultured_Mediterranean_phage	37.0	1.0e-14
WP_069206579.1|4591540_4592116_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	43.3	7.8e-32
WP_069206580.1|4592142_4592721_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	39.1	7.9e-32
WP_069206581.1|4592736_4593837_-	DUF475 domain-containing protein	NA	K4JUR1	Caulobacter_phage	45.7	1.3e-67
WP_069206582.1|4593866_4595051_-	TerD family protein	NA	NA	NA	NA	NA
WP_069206583.1|4595094_4595676_-	TerD family protein	NA	A0A2L1IWC0	Streptomyces_phage	35.1	6.3e-13
>prophage 8
NZ_CP014168	Sphingomonas panacis strain DCY99 chromosome, complete genome	5003808	4897355	4952832	5003808	tRNA,transposase,integrase	Acidithiobacillus_phage(41.67%)	39	4920018:4920038	4961379:4961399
WP_069206817.1|4897355_4898891_-|tRNA	proline--tRNA ligase	tRNA	A0A2K9L0T2	Tupanvirus	38.7	9.9e-74
WP_150127032.1|4899112_4900180_+	catalase	NA	NA	NA	NA	NA
WP_083225010.1|4900179_4900830_+	cytochrome b	NA	NA	NA	NA	NA
WP_069206820.1|4900897_4902403_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_069206821.1|4902522_4904055_+	glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_083224871.1|4904051_4904840_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	33.6	7.5e-25
WP_069206822.1|4904913_4906170_+	MFS transporter	NA	NA	NA	NA	NA
WP_069206823.1|4906166_4908581_+	alpha-glucosidase	NA	NA	NA	NA	NA
WP_069206824.1|4908653_4910939_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_069206825.1|4910950_4912258_+	dienelactone hydrolase	NA	NA	NA	NA	NA
WP_150127123.1|4912293_4914141_+	beta galactosidase jelly roll domain-containing protein	NA	L0N6M2	Herpes_simplex_virus	26.4	4.2e-18
WP_069207596.1|4914177_4915950_-	diguanylate cyclase	NA	NA	NA	NA	NA
WP_150127033.1|4916805_4917129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069206828.1|4917169_4917946_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_150127034.1|4918403_4918739_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150127035.1|4918717_4919548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083225012.1|4919613_4920369_-	competence/damage-inducible protein A	NA	NA	NA	NA	NA
4920018:4920038	attL	GCGCCTCGGTCAGCCCGCCGC	NA	NA	NA	NA
WP_069207597.1|4920434_4921259_+	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_069206832.1|4921580_4921919_+	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_069206833.1|4922028_4923441_+	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_069206834.1|4923805_4928422_-	NAD-glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_069206835.1|4928607_4929669_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069206836.1|4930085_4931303_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	43.4	8.1e-87
WP_150127036.1|4931481_4931946_+|transposase	transposase	transposase	K4I413	Acidithiobacillus_phage	45.0	7.5e-33
WP_069206838.1|4931956_4932163_+	IstB-like ATP-binding domain-containing protein	NA	NA	NA	NA	NA
WP_083224994.1|4932325_4933858_+|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.7	2.2e-126
WP_069206440.1|4933869_4934610_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	46.7	2.5e-59
WP_083224872.1|4934606_4935233_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	45.3	2.3e-37
WP_165388486.1|4935511_4935682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069207225.1|4935656_4937750_+	recombinase family protein	NA	NA	NA	NA	NA
WP_069206839.1|4938127_4939090_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083225013.1|4939549_4941016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069206841.1|4941735_4942929_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_069206842.1|4942933_4943839_-|integrase	site-specific integrase	integrase	S5W9T9	Leptospira_phage	28.6	2.0e-21
WP_169833211.1|4944414_4946220_+	recombinase family protein	NA	K4ICM1	Acidithiobacillus_phage	44.9	4.1e-79
WP_069206844.1|4946394_4947882_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	27.3	2.4e-08
WP_069206845.1|4948386_4948812_+	MucR family transcriptional regulator	NA	A0A1P8VVG0	Erythrobacter_phage	47.7	3.4e-16
WP_069206846.1|4949365_4950160_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_069204867.1|4951638_4952832_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
4961379:4961399	attR	GCGGCGGGCTGACCGAGGCGC	NA	NA	NA	NA
