The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP013360	Burkholderia thailandensis strain 2003015869 chromosome 1, complete sequence	3762719	410120	463679	3762719	plate,protease,transposase,integrase	Pseudomonas_phage(22.22%)	46	410682:410723	454280:454321
WP_009906344.1|410120_410633_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	52.5	1.1e-21
410682:410723	attL	TGATTTGTAATCATCAGGTGGCGGGTTCGAGTCCTGCAGCCG	NA	NA	NA	NA
WP_045143259.1|410885_411728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009906339.1|411882_412131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009906338.1|412127_413597_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_144410523.1|413647_415000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039337111.1|415497_416172_+	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_144410522.1|416450_417680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144410521.1|417773_418121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172820589.1|418193_419391_+|transposase	IS3 family transposase	transposase	A0A1B0Z042	Pseudomonas_phage	65.9	2.3e-102
WP_144410520.1|419429_420080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009906830.1|420159_422496_-	type I restriction enzyme HsdR N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_069246068.1|423011_424121_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069246059.1|424188_425508_-	hypothetical protein	NA	A0A0A8J8N7	Ralstonia_phage	49.4	1.2e-88
WP_029227459.1|425684_426026_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_009906835.1|426003_426657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029227460.1|426658_426958_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029227461.1|427092_427899_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_029227462.1|427960_428983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009906840.1|428979_429906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009906841.1|429972_430200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045143258.1|430211_431207_-	YqaJ viral recombinase family protein	NA	A6XMH8	Bacillus_virus	37.8	9.4e-49
WP_009906843.1|431279_432248_-	DUF932 domain-containing protein	NA	A0A0H4INH5	Stenotrophomonas_phage	42.0	4.1e-57
WP_080558212.1|432356_432698_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029227464.1|433366_434533_+	DUF4297 domain-containing protein	NA	NA	NA	NA	NA
WP_009906845.1|434529_435009_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009906846.1|435005_436808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144410519.1|437246_438206_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029227466.1|438093_443457_+	DEAD/DEAH box helicase	NA	A0A1B1IUF6	uncultured_Mediterranean_phage	22.1	5.4e-42
WP_009906848.1|443453_444656_+	DUF4338 domain-containing protein	NA	NA	NA	NA	NA
WP_144410518.1|444985_446227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144410517.1|446236_448801_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009906852.1|449129_450344_-	DUF3396 domain-containing protein	NA	E5E3X7	Burkholderia_phage	68.2	5.5e-144
WP_009906853.1|450354_451104_-	VRR-NUC domain-containing protein	NA	A4JWV4	Burkholderia_virus	57.5	1.0e-60
WP_009906854.1|451100_451628_-	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	60.5	7.9e-55
WP_009906855.1|452009_452333_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_009906856.1|452316_452700_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_029227469.1|452730_454095_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	NA	NA	NA	NA
WP_009888580.1|454667_455453_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
454280:454321	attR	TGATTTGTAATCATCAGGTGGCGGGTTCGAGTCCTGCAGCCG	NA	NA	NA	NA
WP_009906858.1|455449_456796_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_025404121.1|456904_457519_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_043036367.1|457892_458582_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_009888592.1|458618_459137_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_009888594.1|459153_460644_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_009906860.1|460716_461220_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_009888597.1|461277_461760_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_009906861.1|461840_463679_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
>prophage 2
NZ_CP013360	Burkholderia thailandensis strain 2003015869 chromosome 1, complete sequence	3762719	766791	777335	3762719	transposase	Hokovirus(14.29%)	8	NA	NA
WP_009904051.1|766791_768744_+	molecular chaperone DnaK	NA	A0A1V0SH73	Hokovirus	50.3	6.6e-147
WP_009889258.1|769007_770138_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	38.0	1.8e-24
WP_039336891.1|770169_772179_+	bifunctional anthranilate synthase component I family protein/class IV aminotransferase	NA	S4VT78	Pandoravirus	34.9	4.8e-52
WP_045143256.1|772245_773466_-|transposase	ISL3 family transposase	transposase	A9YX10	Burkholderia_phage	92.4	1.7e-225
WP_009904054.1|773667_774483_-	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	32.9	3.3e-36
WP_009889263.1|774547_775231_-	deoxynucleoside kinase	NA	A0A249XZR7	Enterococcus_phage	26.0	3.3e-05
WP_009889265.1|775227_775755_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_009904055.1|775790_777335_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	31.2	2.5e-24
>prophage 3
NZ_CP013360	Burkholderia thailandensis strain 2003015869 chromosome 1, complete sequence	3762719	985116	1009338	3762719	protease,transposase,tRNA	Stx2-converting_phage(28.57%)	25	NA	NA
WP_009904256.1|985116_985914_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_144410515.1|986338_987364_+	AAA family ATPase	NA	Q7M293	Enterobacteria_phage	29.7	1.0e-29
WP_009904260.1|987536_987767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099975734.1|987772_988285_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_009904262.1|989021_989420_-	helix-turn-helix transcriptional regulator	NA	R9W020	Paenibacillus_phage	39.4	9.6e-05
WP_029227357.1|989595_990075_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009904264.1|990096_990447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009904265.1|990446_990806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172820589.1|991410_992608_+|transposase	IS3 family transposase	transposase	A0A1B0Z042	Pseudomonas_phage	65.9	2.3e-102
WP_144410513.1|992768_993269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052689349.1|993351_993723_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_144410512.1|993753_994873_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.9	2.8e-49
WP_009906954.1|995269_996832_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	52.1	2.1e-143
WP_029227479.1|996861_997209_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	70.1	4.7e-40
WP_039336681.1|997208_997571_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_039336678.1|997687_998944_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029227358.1|999278_999596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011544796.1|999656_999959_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009904271.1|1000029_1000752_-	DUF5343 domain-containing protein	NA	NA	NA	NA	NA
WP_155772925.1|1001486_1002509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009904277.1|1002652_1004590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009904278.1|1004778_1005753_-	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_009904279.1|1005885_1006770_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_009904281.1|1007006_1007849_+	NAD-dependent protein deacetylase	NA	S5M4R0	Bacillus_phage	24.3	7.5e-07
WP_009904282.1|1008117_1009338_-|protease	serine protease	protease	NA	NA	NA	NA
>prophage 4
NZ_CP013360	Burkholderia thailandensis strain 2003015869 chromosome 1, complete sequence	3762719	1149048	1157730	3762719		Bacillus_phage(16.67%)	8	NA	NA
WP_009904402.1|1149048_1150449_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	38.7	1.4e-79
WP_080511617.1|1150480_1151404_+	D-glycero-beta-D-manno-heptose-7-phosphate kinase	NA	A0A2H4N7X4	Lake_Baikal_phage	27.9	1.3e-15
WP_009904403.1|1151461_1152454_+	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	30.9	9.1e-28
WP_009889858.1|1152525_1152843_+	helix-hairpin-helix domain-containing protein	NA	NA	NA	NA	NA
WP_009904404.1|1153177_1154080_+	cysteine synthase CysM	NA	A0A1X9I5F1	Streptococcus_phage	39.9	4.3e-53
WP_009889862.1|1154174_1155416_-	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_009889864.1|1155594_1156518_+	histone deacetylase family protein	NA	A0A2K9KZC4	Tupanvirus	36.2	3.2e-43
WP_025987375.1|1156887_1157730_-	alpha/beta hydrolase	NA	A7XCB7	Tanapox_virus	26.8	8.5e-19
>prophage 5
NZ_CP013360	Burkholderia thailandensis strain 2003015869 chromosome 1, complete sequence	3762719	2266132	2395182	3762719	transposase,integrase,tRNA,plate,coat	Burkholderia_virus(19.23%)	99	2381658:2381705	2395190:2395237
WP_009905815.1|2266132_2269000_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	39.3	6.7e-148
WP_009891646.1|2269086_2269971_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	48.3	1.1e-69
WP_009905817.1|2270047_2270653_-	DUF4136 domain-containing protein	NA	NA	NA	NA	NA
WP_009891650.1|2270744_2273138_-	CHASE2 domain-containing protein	NA	NA	NA	NA	NA
WP_009891653.1|2273148_2274513_-	FecR domain-containing protein	NA	NA	NA	NA	NA
WP_004193573.1|2274509_2275214_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_009905819.1|2275504_2275891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004193727.1|2276148_2276379_-	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_025405098.1|2276540_2277578_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_009905830.1|2277590_2278610_-	inositol 2-dehydrogenase	NA	NA	NA	NA	NA
WP_009905831.1|2278602_2279484_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_009891666.1|2279733_2280783_+	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_009891668.1|2280883_2282029_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_009891669.1|2282041_2282842_+	sugar ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.4	1.6e-14
WP_025405099.1|2282855_2284856_+	5-dehydro-2-deoxygluconokinase	NA	NA	NA	NA	NA
WP_045143295.1|2284866_2286870_+	3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing)	NA	NA	NA	NA	NA
WP_009905840.1|2286866_2287787_+	myo-inosose-2 dehydratase	NA	NA	NA	NA	NA
WP_009905842.1|2287786_2288590_+	5-deoxy-glucuronate isomerase	NA	NA	NA	NA	NA
WP_009891678.1|2288654_2289359_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.8	8.7e-09
WP_025405101.1|2289355_2291593_-	branched-chain amino acid ABC transporter ATP-binding protein/permease	NA	A0A2R8FFL6	Cedratvirus	27.5	1.2e-08
WP_009905849.1|2291585_2292521_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_019255838.1|2292525_2292975_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_009891683.1|2293234_2294383_-	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_009891685.1|2294572_2294908_+	YbjQ family protein	NA	NA	NA	NA	NA
WP_009905853.1|2295000_2295555_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_025405102.1|2296019_2297558_-	trypsin-like peptidase domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	24.8	5.0e-09
WP_080940522.1|2298109_2299708_-	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_009905862.1|2299792_2300758_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_009905863.1|2301186_2303811_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	39.2	7.1e-80
WP_009905864.1|2304253_2305474_+	CoA transferase	NA	NA	NA	NA	NA
WP_009905865.1|2305567_2306374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009891704.1|2306903_2307146_-	ornithine acetyltransferase	NA	NA	NA	NA	NA
WP_009891706.1|2307393_2309103_+|tRNA	glutamine--tRNA ligase/YqeY domain fusion protein	tRNA	A0A222YZ70	Escherichia_phage	56.9	2.8e-186
WP_009905869.1|2309388_2309865_-	NUDIX hydrolase	NA	A0A2I6PFL2	Proteus_phage	41.3	2.0e-20
WP_009905870.1|2309883_2310270_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009905871.1|2310556_2312656_-	glycoside hydrolase family 3 protein	NA	NA	NA	NA	NA
WP_009905874.1|2312757_2313618_+	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_009905875.1|2313663_2315091_-	cytochrome-c peroxidase	NA	NA	NA	NA	NA
WP_009905877.1|2315324_2316908_+	acid phosphatase	NA	NA	NA	NA	NA
WP_009905879.1|2317132_2318326_+	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_009905880.1|2318343_2319186_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_009891722.1|2319895_2320528_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_025987396.1|2320528_2322601_-	response regulator	NA	Q8QKV7	Ectocarpus_siliculosus_virus	28.0	1.2e-29
WP_009905886.1|2323011_2323977_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_039337972.1|2323992_2326404_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_009905896.1|2326448_2327288_-	molecular chaperone	NA	NA	NA	NA	NA
WP_038708375.1|2327305_2327830_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_009905900.1|2327912_2328473_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_019255106.1|2328525_2329071_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_009891734.1|2329879_2330773_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_038708373.1|2331188_2332478_+	MFS transporter	NA	NA	NA	NA	NA
WP_009905907.1|2332522_2333449_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_009891740.1|2333934_2334216_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_009891742.1|2334415_2334679_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155772930.1|2335665_2336720_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.2	1.5e-44
WP_085952127.1|2336792_2338029_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	95.1	5.8e-157
WP_172820589.1|2338145_2339343_+|transposase	IS3 family transposase	transposase	A0A1B0Z042	Pseudomonas_phage	65.9	2.3e-102
WP_155772931.1|2339409_2340129_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144410544.1|2340435_2341556_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	5.2e-48
WP_050807625.1|2342507_2342954_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019255073.1|2343235_2346259_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009905923.1|2346261_2347278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009905924.1|2347281_2350104_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	24.7	2.5e-30
WP_009905925.1|2350116_2350422_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009905926.1|2350439_2350772_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085955234.1|2351812_2353023_-|transposase	IS3 family transposase	transposase	A0A1B0Z042	Pseudomonas_phage	63.4	9.2e-99
WP_038708366.1|2353137_2353629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009906870.1|2354387_2354882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025405119.1|2354859_2358195_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_039338284.1|2359555_2360134_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_009906969.1|2360240_2362646_-	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_009906968.1|2362642_2363242_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_009906995.1|2363729_2364329_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_025987447.1|2364325_2364883_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_009905935.1|2365019_2365853_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_009905937.1|2365855_2368654_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	24.1	2.0e-27
WP_009891791.1|2369179_2369446_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_025405123.1|2369469_2370897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009905942.1|2370925_2372776_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_009910381.1|2374267_2374486_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009905945.1|2375246_2376725_+	PHB depolymerase family esterase	NA	NA	NA	NA	NA
WP_009905946.1|2377028_2377364_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_009905947.1|2377680_2378967_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	72.0	1.7e-172
WP_025405127.1|2379099_2380005_-	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	75.1	4.9e-129
2381658:2381705	attL	GACTGGCCCGCCCTACACGATTCGAACGTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
WP_009905950.1|2381849_2382494_-	SOS response-associated peptidase family protein	NA	C7BGE4	Burkholderia_phage	89.5	1.6e-113
WP_144410543.1|2382575_2382839_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009905951.1|2382808_2383288_-	DUF2514 family protein	NA	Q6J1Q4	Burkholderia_virus	81.3	2.0e-57
WP_009905952.1|2383284_2383830_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029227429.1|2383826_2384324_-	lysozyme	NA	Q3HQU9	Burkholderia_phage	93.3	1.3e-83
WP_009905959.1|2384316_2384499_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009905961.1|2384677_2384962_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099975745.1|2384964_2385702_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_080940521.1|2385767_2386802_+	acyltransferase	NA	A0A166XZF2	Gordonia_phage	31.2	5.8e-17
WP_144410526.1|2386814_2388051_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	95.1	9.9e-157
WP_144410542.1|2388251_2388452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080558189.1|2389798_2390395_-	DUF2313 domain-containing protein	NA	NA	NA	NA	NA
WP_038711425.1|2391771_2392077_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009905983.1|2393032_2393572_+	Lar family restriction alleviation protein	NA	A0A127KN88	Pseudomonas_phage	66.7	7.1e-11
WP_172820592.1|2394609_2395182_+|integrase	site-specific integrase	integrase	A0A1S5NNJ1	Burkholderia_phage	47.0	3.2e-33
2395190:2395237	attR	GACTGGCCCGCCCTACACGATTCGAACGTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
>prophage 6
NZ_CP013360	Burkholderia thailandensis strain 2003015869 chromosome 1, complete sequence	3762719	2632902	2672588	3762719	capsid,transposase,integrase,portal,tail,head,tRNA,terminase	Pseudomonas_phage(36.36%)	43	2658847:2658873	2677032:2677058
WP_009903844.1|2632902_2633634_-|tRNA	alanyl-tRNA editing protein	tRNA	NA	NA	NA	NA
WP_009892241.1|2633744_2634155_-	group II truncated hemoglobin	NA	NA	NA	NA	NA
WP_009903843.1|2634231_2636841_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_009892245.1|2636837_2637455_-	DUF4126 domain-containing protein	NA	NA	NA	NA	NA
WP_009892247.1|2637635_2637956_-	quaternary ammonium compound efflux SMR transporter SugE	NA	NA	NA	NA	NA
WP_009903842.1|2638202_2638496_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_009903838.1|2638836_2639535_-	two-component system response regulator KdpE	NA	NA	NA	NA	NA
WP_039337861.1|2639527_2642647_-	sensor histidine kinase KdpD	NA	A0A1V0SGX0	Hokovirus	23.6	2.8e-06
WP_009903828.1|2642900_2643482_-	potassium-transporting ATPase subunit KdpC	NA	NA	NA	NA	NA
WP_009903825.1|2643494_2645606_-	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	25.7	4.6e-21
WP_009903823.1|2645673_2647482_-	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_004550719.1|2647478_2647571_-	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
WP_009892266.1|2647997_2648972_-	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_009892268.1|2649230_2649623_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_009903816.1|2649831_2650611_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_009892273.1|2650845_2651496_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_009892278.1|2651790_2652519_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_009892280.1|2652629_2653907_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_009903814.1|2654034_2654958_+	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_009903813.1|2654954_2655707_+	nicotinate-nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_009903812.1|2655711_2656176_+	ribosome silencing factor	NA	NA	NA	NA	NA
WP_009903811.1|2656234_2656705_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_009903809.1|2656756_2657389_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_009903808.1|2657405_2658872_+	ribonuclease G	NA	NA	NA	NA	NA
2658847:2658873	attL	AGCAGTACGACATCGTGCTGATGTAGG	NA	NA	NA	NA
WP_029227343.1|2659045_2660287_+|integrase	site-specific integrase	integrase	Q6J1Q2	Burkholderia_virus	45.1	1.0e-81
WP_144410540.1|2660378_2661137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009903802.1|2661385_2661616_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_009903800.1|2661695_2661983_+	hypothetical protein	NA	A0A1B0VRK7	Pseudomonas_phage	47.9	3.7e-06
WP_080558124.1|2662276_2662462_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009903797.1|2662454_2662649_+	hypothetical protein	NA	A0A1W6JTA7	Pseudomonas_phage	49.0	6.1e-05
WP_009903795.1|2662641_2662893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009903794.1|2662885_2663164_+	hypothetical protein	NA	Q3HQY6	Burkholderia_phage	67.1	6.7e-21
WP_009903792.1|2663156_2663393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009903790.1|2663389_2663617_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009903789.1|2663616_2664165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085955234.1|2664817_2666028_-|transposase	IS3 family transposase	transposase	A0A1B0Z042	Pseudomonas_phage	63.4	9.2e-99
WP_029227453.1|2666555_2666807_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_009906765.1|2666908_2667349_+	hypothetical protein	NA	A0A286S1P9	Klebsiella_phage	60.4	1.2e-40
WP_009906764.1|2667330_2668851_+|terminase	terminase	terminase	B5WZR8	Pseudomonas_phage	79.2	1.1e-229
WP_045143274.1|2668907_2670800_+|capsid	phage major capsid protein	capsid	S4TNE3	Salmonella_phage	44.9	5.2e-133
WP_039337852.1|2670812_2670992_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172820593.1|2671066_2672281_+|portal	phage portal protein	portal	F8TVA0	EBPR_siphovirus	46.1	5.1e-89
WP_009903786.1|2672270_2672588_+|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
2677032:2677058	attR	AGCAGTACGACATCGTGCTGATGTAGG	NA	NA	NA	NA
>prophage 7
NZ_CP013360	Burkholderia thailandensis strain 2003015869 chromosome 1, complete sequence	3762719	2765008	2781265	3762719	capsid,transposase,integrase,portal,tail,head,terminase	Stenotrophomonas_phage(14.29%)	22	2759060:2759077	2771042:2771059
2759060:2759077	attL	CGAGCTCGCCCTCGTCGA	NA	NA	NA	NA
WP_009903624.1|2765008_2766226_+|integrase	tyrosine-type recombinase/integrase	integrase	B7SYF8	Stenotrophomonas_phage	44.8	1.1e-88
WP_038710841.1|2766299_2766956_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144410536.1|2767185_2767791_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157779345.1|2768194_2769010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029227337.1|2769112_2769373_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_009903613.1|2769391_2770144_+	phage antirepressor KilAC domain-containing protein	NA	G3EN85	Psychrobacter_phage	48.6	1.1e-44
WP_080558117.1|2770435_2770621_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009903609.1|2770613_2770826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029227335.1|2770818_2771016_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009903605.1|2771012_2771240_+	hypothetical protein	NA	NA	NA	NA	NA
2771042:2771059	attR	CGAGCTCGCCCTCGTCGA	NA	NA	NA	NA
WP_009903603.1|2771232_2771625_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029227334.1|2771621_2771849_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029227333.1|2771848_2772397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080558116.1|2773187_2773481_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_009903590.1|2773582_2774023_+	hypothetical protein	NA	A0A286S1P9	Klebsiella_phage	61.1	1.0e-39
WP_009903588.1|2774004_2775525_+|terminase	terminase	terminase	B5WZR8	Pseudomonas_phage	79.4	1.6e-228
WP_045143272.1|2775581_2777471_+|capsid	phage major capsid protein	capsid	S4TNE3	Salmonella_phage	43.7	1.9e-130
WP_039337826.1|2777483_2777663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172820594.1|2777737_2778952_+|portal	phage portal protein	portal	F8TVA0	EBPR_siphovirus	46.7	8.6e-89
WP_009906951.1|2778941_2779259_+|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_144410535.1|2779435_2779699_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144410526.1|2780027_2781265_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	95.1	9.9e-157
>prophage 8
NZ_CP013360	Burkholderia thailandensis strain 2003015869 chromosome 1, complete sequence	3762719	2965572	2976453	3762719	protease	Agrobacterium_phage(16.67%)	9	NA	NA
WP_025405293.1|2965572_2967873_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	41.9	3.6e-168
WP_009892611.1|2967869_2968184_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A218MMY6	uncultured_virus	44.6	2.6e-13
WP_004196460.1|2968714_2968918_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	81.8	6.8e-23
WP_039337770.1|2969029_2970625_-	multicopper oxidase family protein	NA	NA	NA	NA	NA
WP_009903329.1|2970789_2972049_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	63.0	6.8e-12
WP_009892615.1|2972313_2972892_+	pseudouridine synthase	NA	NA	NA	NA	NA
WP_080555088.1|2973152_2973368_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019256450.1|2973563_2974073_+	DUF192 domain-containing protein	NA	A0A1B1IUW8	uncultured_Mediterranean_phage	42.2	5.0e-14
WP_009903323.1|2974338_2976453_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.0	2.3e-57
>prophage 9
NZ_CP013360	Burkholderia thailandensis strain 2003015869 chromosome 1, complete sequence	3762719	3702566	3757109	3762719	protease,transposase,integrase,portal,tRNA	Burkholderia_virus(13.33%)	51	3711003:3711019	3758072:3758088
WP_009902119.1|3702566_3703424_-|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
WP_009893639.1|3703532_3704168_-	LysE family translocator	NA	NA	NA	NA	NA
WP_009902117.1|3704288_3705275_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	36.5	3.9e-07
WP_009893641.1|3705306_3705810_-	peptide deformylase	NA	A0A067XQZ3	Caulobacter_phage	31.5	3.2e-13
WP_009902115.1|3706042_3707230_+	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	39.2	2.3e-22
WP_009902114.1|3707290_3707662_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_009902112.1|3707871_3710481_+	DNA topoisomerase III	NA	A0A2P1ELA0	Moumouvirus	25.6	3.8e-17
WP_009893648.1|3710709_3711765_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
3711003:3711019	attL	CGAGCTTGCCGCGCGCG	NA	NA	NA	NA
WP_009902110.1|3712202_3713219_+	D-2-hydroxyacid dehydrogenase family protein	NA	NA	NA	NA	NA
WP_009902108.1|3713338_3714208_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_009893658.1|3714246_3714651_-	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_045143286.1|3715143_3715476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144410512.1|3715778_3716899_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.9	2.8e-49
WP_144410528.1|3718006_3718531_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009902101.1|3718664_3719711_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_009902099.1|3720068_3720569_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009902097.1|3721210_3723244_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019254355.1|3723350_3723833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009902093.1|3724517_3724802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162486552.1|3724874_3725720_-|portal	phage portal protein	portal	A4JWQ2	Burkholderia_virus	85.1	3.0e-133
WP_009902090.1|3725876_3726458_+	Spy/CpxP family protein refolding chaperone	NA	NA	NA	NA	NA
WP_009902086.1|3727251_3727800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009902084.1|3728042_3729491_+	RNA polymerase sigma factor RpoD/SigA	NA	A0A2I7SAT0	Vibrio_phage	34.4	3.4e-31
WP_009902082.1|3729506_3731120_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_019256023.1|3731269_3732211_-	3-methyladenine DNA glycosylase 2	NA	NA	NA	NA	NA
WP_009902073.1|3732207_3733302_-	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	38.1	1.0e-19
WP_009902070.1|3733704_3734121_+	VOC family protein	NA	NA	NA	NA	NA
WP_009902068.1|3734248_3734803_-	YaeQ family protein	NA	NA	NA	NA	NA
WP_009902065.1|3735023_3735371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009902063.1|3735857_3736418_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_004524602.1|3736577_3736748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009902052.1|3737082_3737238_-	lipoprotein	NA	NA	NA	NA	NA
WP_009902051.1|3737302_3738463_-	DUF4382 domain-containing protein	NA	NA	NA	NA	NA
WP_009902049.1|3738875_3739100_-	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_009902046.1|3740598_3741612_+	ParA family protein	NA	Q7M293	Enterobacteria_phage	31.5	1.8e-31
WP_144410527.1|3741604_3742267_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172820589.1|3742378_3743577_-|transposase	IS3 family transposase	transposase	A0A1B0Z042	Pseudomonas_phage	65.9	2.3e-102
WP_009906996.1|3743760_3744336_-	recombinase family protein	NA	A0A219Y9V9	Aeromonas_phage	41.2	1.0e-23
WP_158345901.1|3744811_3744940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025405251.1|3744966_3746067_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025405250.1|3746035_3746977_+	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_009906999.1|3747385_3747898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162840133.1|3748035_3748299_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_009907001.1|3748298_3748778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009907002.1|3749148_3749325_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025405247.1|3749317_3749575_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009907004.1|3749571_3749913_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009907005.1|3750057_3752910_+	DUF927 domain-containing protein	NA	A0A1B0VP75	Pseudomonas_phage	35.2	6.6e-71
WP_144410526.1|3753912_3755149_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	95.1	9.9e-157
WP_038711569.1|3755181_3755781_-	DNA damage-inducible protein D	NA	A0A1W6JPJ7	Morganella_phage	66.0	1.1e-47
WP_009906630.1|3755879_3757109_-|integrase	tyrosine-type recombinase/integrase	integrase	Q858E8	Salmonella_phage	38.7	1.2e-66
3758072:3758088	attR	CGAGCTTGCCGCGCGCG	NA	NA	NA	NA
>prophage 1
NZ_CP013361	Burkholderia thailandensis strain 2003015869 chromosome 2, complete sequence	2966282	54197	78596	2966282	transposase	uncultured_virus(28.57%)	33	NA	NA
WP_080558217.1|54197_55466_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	42.8	2.3e-39
WP_157779363.1|55540_56074_-	DUF2326 domain-containing protein	NA	NA	NA	NA	NA
WP_144410512.1|56145_57266_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.9	2.8e-49
WP_172820589.1|57426_58624_+|transposase	IS3 family transposase	transposase	A0A1B0Z042	Pseudomonas_phage	65.9	2.3e-102
WP_009906959.1|59251_59482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009906958.1|59579_59897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099975758.1|59984_60134_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009906957.1|60468_60753_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009906956.1|61042_61255_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_080558217.1|61344_62613_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	42.8	2.3e-39
WP_034175064.1|63910_64096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009907020.1|64096_64363_+	DUF1488 domain-containing protein	NA	NA	NA	NA	NA
WP_029227483.1|64454_66053_+	SagB/ThcOx family dehydrogenase	NA	NA	NA	NA	NA
WP_006480091.1|66420_67152_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_080001171.1|67388_67592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029227484.1|67787_68210_-	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_009907027.1|68334_69156_+	fatty acid desaturase	NA	NA	NA	NA	NA
WP_029227485.1|69252_69432_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009907030.1|70418_70706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009907031.1|70754_71027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012339007.1|71090_71288_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009907033.1|71824_72142_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009907034.1|72304_72565_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012339006.1|72836_73076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012339005.1|73144_73384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009907039.1|74107_74311_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	70.1	5.9e-19
WP_155772935.1|74539_74695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009907041.1|74852_75098_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_038711778.1|75192_75477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009907043.1|75725_75923_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039336681.1|76294_76657_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_029227479.1|76656_77004_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	70.1	4.7e-40
WP_009906954.1|77033_78596_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	52.1	2.1e-143
>prophage 2
NZ_CP013361	Burkholderia thailandensis strain 2003015869 chromosome 2, complete sequence	2966282	128889	187320	2966282	holin,plate,transposase	Leptospira_phage(25.0%)	44	NA	NA
WP_009898227.1|128889_131085_+|holin	phospholipase C, phosphocholine-specific	holin	NA	NA	NA	NA
WP_144410576.1|131165_132253_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.2	3.4e-44
WP_004523721.1|132572_132992_-	YjbQ family protein	NA	NA	NA	NA	NA
WP_004523720.1|133011_133338_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_004523719.1|133810_134503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080558009.1|135325_135682_-	DUF4148 domain-containing protein	NA	NA	NA	NA	NA
WP_009898259.1|136158_137301_-	porin	NA	NA	NA	NA	NA
WP_009898264.1|137933_138857_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_009898267.1|139474_139777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155275044.1|140423_140657_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019255401.1|140770_141970_-	transcriptional regulator CynR	NA	NA	NA	NA	NA
WP_019255400.1|141969_143394_-	TolC family protein	NA	NA	NA	NA	NA
WP_009898285.1|143387_144287_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_009894707.1|144288_144513_-	DUF1656 domain-containing protein	NA	NA	NA	NA	NA
WP_038708432.1|144509_146576_-	FUSC family protein	NA	NA	NA	NA	NA
WP_009898294.1|147585_149127_-	membrane protein	NA	NA	NA	NA	NA
WP_155275045.1|149474_149831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039339343.1|150675_152571_+	YadA-like family protein	NA	K4F7R4	Cronobacter_phage	46.1	6.9e-08
WP_009898304.1|152646_154098_-	PhoPQ-regulated protein	NA	NA	NA	NA	NA
WP_080558013.1|154169_154376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025987413.1|154348_154942_-	membrane protein	NA	NA	NA	NA	NA
WP_009898306.1|155527_156082_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_038708388.1|156163_156889_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_009898310.1|157048_159745_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_025987411.1|159737_160310_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_025987410.1|160340_161030_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_029227146.1|161032_162709_+	OmpA family protein	NA	NA	NA	NA	NA
WP_009898320.1|163052_163592_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_009898321.1|163625_165125_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_009894730.1|165325_165808_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_019255186.1|165935_166478_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_025405980.1|166483_167833_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_009898325.1|167829_169131_+	type VI secretion system protein TssL	NA	NA	NA	NA	NA
WP_009898327.1|169145_173054_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_009898329.1|173244_173814_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039339348.1|173914_176608_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	26.0	1.9e-35
WP_004523693.1|176682_176952_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_029227147.1|176964_180417_+	RHS repeat protein	NA	NA	NA	NA	NA
WP_038709601.1|180309_181668_-	hypothetical protein	NA	A0A292GJ55	Xanthomonas_phage	49.6	7.6e-110
WP_009894750.1|181700_182729_-	fimbrial protein	NA	NA	NA	NA	NA
WP_009898344.1|182784_183855_-	type VI secretion system ImpA family N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_009898345.1|183873_184923_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_009894755.1|184919_186800_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_009894757.1|186801_187320_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 3
NZ_CP013361	Burkholderia thailandensis strain 2003015869 chromosome 2, complete sequence	2966282	751662	793115	2966282	integrase,tRNA,plate,tail,transposase	Burkholderia_virus(43.24%)	48	763733:763752	797342:797361
WP_009895739.1|751662_752703_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	54.0	1.7e-93
WP_009899222.1|752833_754057_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_009895742.1|754136_754349_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_019254422.1|754515_754962_+	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	48.6	3.3e-22
WP_009899227.1|755058_756936_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	36.2	4.9e-67
WP_009895748.1|756982_757321_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009899229.1|757379_759422_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	32.0	4.2e-35
WP_144410555.1|759761_759977_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009899231.1|760070_760361_-	hypothetical protein	NA	NA	NA	NA	NA
WP_127446954.1|760341_760740_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009899232.1|760831_761332_-	VUT family protein	NA	A0A2H4N7D9	Pectobacterium_phage	54.3	2.0e-31
WP_009899233.1|761665_762022_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	76.8	1.1e-44
WP_009899234.1|762112_762727_-	DUF3164 family protein	NA	A4JWM8	Burkholderia_virus	83.4	2.2e-93
WP_009899237.1|762823_763156_-	hypothetical protein	NA	Q6QIE2	Burkholderia_phage	58.2	2.5e-22
WP_009899239.1|763187_764441_-	AAA family ATPase	NA	Q6QIE1	Burkholderia_phage	69.1	7.2e-155
763733:763752	attL	CGAGCGGCGCGACGGCCGCG	NA	NA	NA	NA
WP_009899242.1|764437_766234_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q6QIE0	Burkholderia_phage	80.2	4.3e-278
WP_009899243.1|766248_767214_-	hypothetical protein	NA	A4JWN3	Burkholderia_virus	70.3	1.4e-102
WP_009899245.1|767227_767539_-	helix-turn-helix domain-containing protein	NA	A4JWN4	Burkholderia_virus	80.0	1.7e-33
WP_155772941.1|767535_767979_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009906820.1|768053_768296_-	DNA-binding protein	NA	Q6QID3	Burkholderia_phage	90.0	7.3e-32
WP_050789956.1|768426_768846_+	helix-turn-helix transcriptional regulator	NA	A4JWR8	Burkholderia_virus	51.4	6.7e-25
WP_052689340.1|768911_769775_+	hypothetical protein	NA	A4JWN9	Burkholderia_virus	29.3	2.4e-24
WP_009906937.1|770277_770625_+	membrane protein	NA	Q6QIC8	Burkholderia_phage	79.1	1.2e-43
WP_025405408.1|770627_771236_+	transglycosylase SLT domain-containing protein	NA	Q6QIC7	Burkholderia_phage	79.8	3.9e-90
WP_009906939.1|771232_771835_+	hypothetical protein	NA	A4JWP5	Burkholderia_virus	61.1	1.8e-50
WP_009906940.1|771831_772170_+	hypothetical protein	NA	A4JWP6	Burkholderia_virus	82.7	4.0e-44
WP_009906941.1|772166_772499_+	hypothetical protein	NA	Q6QIC3	Burkholderia_phage	77.8	1.9e-46
WP_025405411.1|772831_773146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009906942.1|773316_773781_+	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	60.1	3.9e-42
WP_009906943.1|773777_774023_+	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	62.5	1.7e-20
WP_009906944.1|774026_775460_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A4JWK5	Burkholderia_virus	87.2	4.7e-243
WP_009906945.1|775461_775986_+|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	90.2	2.9e-86
WP_009906946.1|776290_776620_+|tail	phage tail assembly protein	tail	Q6QIA8	Burkholderia_phage	65.7	1.8e-25
WP_009906947.1|776591_776750_+	hypothetical protein	NA	Q6QIA7	Burkholderia_phage	80.8	2.5e-17
WP_039339607.1|776900_779459_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	49.8	9.4e-186
WP_009906887.1|779460_780363_+|tail	phage tail protein	tail	Q6QIA4	Burkholderia_phage	72.1	3.5e-71
WP_009906886.1|780362_780569_+|tail	tail protein X	tail	A4JWL2	Burkholderia_virus	78.3	1.5e-25
WP_099975756.1|780565_781762_+	phage protein D	NA	A4JWL3	Burkholderia_virus	70.3	1.2e-135
WP_009906884.1|781758_782361_+|plate	phage baseplate assembly protein V	plate	A4JWL4	Burkholderia_virus	69.0	4.3e-65
WP_135351490.1|782374_782584_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009906962.1|783876_784971_+|transposase	IS5-like element ISButh6 family transposase	transposase	NA	NA	NA	NA
WP_009907016.1|785253_785697_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_009907015.1|785991_786345_+	GPW/gp25 family protein	NA	Q6QIA0	Burkholderia_phage	82.9	4.2e-52
WP_009907014.1|786341_787493_+|plate	baseplate J/gp47 family protein	plate	A4JWL6	Burkholderia_virus	79.9	2.3e-168
WP_009907013.1|787485_788067_+|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	86.5	1.5e-91
WP_009907012.1|788066_790031_+|tail	tail fiber protein	tail	Q45YG3	Burkholderia_virus	58.1	3.9e-131
WP_009907011.1|790046_790748_+|tail	tail assembly chaperone	tail	E5E3Q6	Burkholderia_phage	59.7	1.1e-59
WP_080558217.1|791846_793115_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	42.8	2.3e-39
797342:797361	attR	CGAGCGGCGCGACGGCCGCG	NA	NA	NA	NA
>prophage 4
NZ_CP013361	Burkholderia thailandensis strain 2003015869 chromosome 2, complete sequence	2966282	2247951	2314692	2966282	holin,plate	Aeromonas_phage(25.0%)	47	NA	NA
WP_009900960.1|2247951_2248902_-|holin	choline ABC transporter substrate-binding protein	holin	NA	NA	NA	NA
WP_009900964.1|2249169_2250114_+	GlxA family transcriptional regulator	NA	NA	NA	NA	NA
WP_009900966.1|2250587_2252291_+	peptidase	NA	NA	NA	NA	NA
WP_009900968.1|2252409_2253636_+	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_009907969.1|2253694_2254837_-	porin	NA	NA	NA	NA	NA
WP_019254804.1|2255064_2256102_-|holin	choline ABC transporter substrate-binding protein	holin	NA	NA	NA	NA
WP_009900970.1|2256098_2257652_-|holin	choline-sulfatase	holin	NA	NA	NA	NA
WP_009900971.1|2257814_2258687_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_009900972.1|2258830_2259706_+	formyltetrahydrofolate deformylase	NA	NA	NA	NA	NA
WP_009898039.1|2259792_2261448_-	APC family permease	NA	NA	NA	NA	NA
WP_009900973.1|2261627_2262491_-	glycine betaine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_019254807.1|2262600_2263740_-	hybrid-cluster NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_171462515.1|2263760_2265029_-	Rieske 2Fe-2S domain-containing protein	NA	NA	NA	NA	NA
WP_009900977.1|2265053_2265839_-	drug:proton antiporter	NA	NA	NA	NA	NA
WP_009900978.1|2265835_2267017_-	electron transfer flavoprotein subunit alpha/FixB family protein	NA	NA	NA	NA	NA
WP_009900979.1|2267021_2268947_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_009900980.1|2268949_2271013_-	NADH:flavin oxidoreductase	NA	NA	NA	NA	NA
WP_009898053.1|2271073_2271607_-	4-vinyl reductase	NA	NA	NA	NA	NA
WP_009900981.1|2271754_2272726_-	membrane dipeptidase	NA	NA	NA	NA	NA
WP_009898057.1|2272797_2274072_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	53.4	6.9e-105
WP_009898058.1|2274480_2275506_+	GlxA family transcriptional regulator	NA	NA	NA	NA	NA
WP_009900982.1|2275698_2276898_-	formaldehyde dehydrogenase, glutathione-independent	NA	A0A2K9L7I1	Tupanvirus	26.8	1.4e-11
WP_009900983.1|2277243_2278260_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_025405822.1|2278533_2280018_+	glycoside hydrolase family 68 protein	NA	NA	NA	NA	NA
WP_025987348.1|2280136_2281810_+	glycoside hydrolase family 32 protein	NA	F8WPR5	Bacillus_phage	31.0	1.0e-55
WP_039339746.1|2282261_2283530_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_025405551.1|2283788_2285351_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_009906874.1|2285403_2286369_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_009896564.1|2286501_2288073_-	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_039339117.1|2288069_2289347_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_009896560.1|2289626_2290526_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_019255885.1|2291098_2291374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009900992.1|2291683_2291989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009893756.1|2292144_2292504_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009893757.1|2292562_2296057_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_009893758.1|2296053_2297781_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_009893759.1|2297863_2299225_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_009900994.1|2299221_2299815_-	type VI secretion lipoprotein TssJ	NA	NA	NA	NA	NA
WP_009893761.1|2299820_2300210_-	DUF4150 domain-containing protein	NA	NA	NA	NA	NA
WP_009893763.1|2300249_2300966_-	DUF3540 domain-containing protein	NA	NA	NA	NA	NA
WP_009900995.1|2300968_2302039_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_009900996.1|2302038_2304255_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_039339121.1|2304258_2306547_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_025405827.1|2306715_2309007_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_009901009.1|2308997_2311841_-	type VI secretion system ATPase TssH	NA	A0A2I7REQ1	Vibrio_phage	27.0	1.2e-61
WP_009901010.1|2311843_2312833_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_009901011.1|2312829_2314692_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
>prophage 5
NZ_CP013361	Burkholderia thailandensis strain 2003015869 chromosome 2, complete sequence	2966282	2408700	2520861	2966282	integrase,head,portal,capsid,lysis,protease,holin,tail,terminase,transposase	Burkholderia_virus(79.1%)	101	2459779:2459808	2516232:2516261
WP_009901105.1|2408700_2409084_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_009901107.1|2409556_2410510_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009901108.1|2410801_2411851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011401450.1|2411854_2412901_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_025405852.1|2412913_2413483_-	acetyltransferase	NA	NA	NA	NA	NA
WP_029227266.1|2413475_2414507_-	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_019254319.1|2414436_2415645_-	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_009901115.1|2415866_2416910_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_009901116.1|2416925_2418281_-	membrane protein	NA	NA	NA	NA	NA
WP_009901117.1|2418559_2420320_-	GNAT family N-acetyltransferase	NA	A0A2K9L470	Tupanvirus	37.0	1.5e-36
WP_009901118.1|2420345_2421698_-	lipopolysaccharide biosynthesis protein RfbH	NA	A0A0P0YLZ6	Yellowstone_lake_phycodnavirus	36.1	1.0e-50
WP_009901119.1|2421701_2422787_-	CDP-glucose 4,6-dehydratase	NA	J7Q7J8	Aeropyrum_coil-shaped_virus	29.6	1.1e-13
WP_009901121.1|2422777_2423554_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_009901124.1|2423550_2424768_-	chain-length determining protein	NA	NA	NA	NA	NA
WP_009901125.1|2424772_2427325_-	SLBB domain-containing protein	NA	NA	NA	NA	NA
WP_162096848.1|2428090_2428489_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009901126.1|2428574_2429219_+	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_009901127.1|2429220_2432208_+	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_080558076.1|2432566_2434279_-	thiamine pyrophosphate-binding protein	NA	M4QSI1	Ostreococcus_lucimarinus_virus	31.7	3.2e-65
WP_009893910.1|2434511_2434919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009901130.1|2435621_2436314_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009901131.1|2436446_2440010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009901132.1|2440023_2452392_+	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_009901133.1|2452382_2453117_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144410512.1|2453367_2454488_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.9	2.8e-49
WP_144410526.1|2454763_2456001_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	95.1	9.9e-157
WP_038709965.1|2457180_2457600_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144410567.1|2457657_2457840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009899900.1|2457858_2459715_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
2459779:2459808	attL	TGGCGGAGAGAGGGGGATTCGAACCCCCGA	NA	NA	NA	NA
WP_144410568.1|2460145_2460694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009899898.1|2460690_2460972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009899897.1|2461827_2462514_-	SOS response-associated peptidase family protein	NA	Q8W6R8	Burkholderia_virus	92.2	1.3e-121
WP_029227221.1|2462598_2463240_+	hypothetical protein	NA	Q8W6R9	Burkholderia_virus	90.1	2.0e-108
WP_025990442.1|2463369_2464464_-	DUF3396 domain-containing protein	NA	Q8W6S0	Burkholderia_virus	95.5	5.2e-202
WP_010109969.1|2464491_2465226_-	VRR-NUC domain-containing protein	NA	Q8W6S1	Burkholderia_virus	96.3	7.0e-134
WP_009899893.1|2465222_2465783_-	PAAR domain-containing protein	NA	A4JX23	Burkholderia_virus	94.1	6.1e-98
WP_009899892.1|2465978_2466860_-	hypothetical protein	NA	Q8W6S3	Burkholderia_virus	81.6	2.4e-117
WP_009899891.1|2467023_2467566_-|lysis	lysis protein	lysis	A4JX21	Burkholderia_virus	86.7	1.3e-73
WP_038709960.1|2467565_2468057_-	lysozyme	NA	Q6JIK8	Burkholderia_virus	87.7	4.7e-78
WP_004552929.1|2468049_2468262_-|holin	class II holin gp23	holin	Q8W6S7	Burkholderia_virus	100.0	6.6e-29
WP_009899887.1|2468304_2469048_-	hypothetical protein	NA	Q8W6S8	Burkholderia_virus	72.0	1.4e-102
WP_009899886.1|2469047_2469356_-	hypothetical protein	NA	Q8W6S9	Burkholderia_virus	72.5	1.2e-39
WP_009899885.1|2469352_2472667_-	DUF1983 domain-containing protein	NA	Q8W6T0	Burkholderia_virus	94.6	0.0e+00
WP_029227219.1|2472663_2473248_-|tail	tail assembly protein	tail	Q6JIL3	Burkholderia_virus	93.8	1.5e-94
WP_009899883.1|2473244_2473997_-	C40 family peptidase	NA	Q6JIL4	Burkholderia_virus	89.6	8.4e-135
WP_009899882.1|2474046_2474730_-|tail	phage minor tail protein L	tail	Q6JIL5	Burkholderia_virus	94.7	3.4e-127
WP_029227218.1|2474726_2476115_-|tail	tail fiber domain-containing protein	tail	Q8W6T4	Burkholderia_virus	89.6	3.7e-245
WP_009899880.1|2476123_2476462_-|tail	phage tail protein	tail	Q8W6T5	Burkholderia_virus	96.4	4.4e-59
WP_039339132.1|2476458_2480523_-|tail	phage tail tape measure protein	tail	Q6JIL8	Burkholderia_virus	90.0	0.0e+00
WP_009901135.1|2480536_2480815_-	DUF4035 domain-containing protein	NA	Q8W6T7	Burkholderia_virus	94.7	2.4e-39
WP_029227267.1|2480814_2481279_-|tail	tail assembly protein	tail	A4JX08	Burkholderia_virus	96.1	1.8e-79
WP_009901137.1|2481305_2481761_-	hypothetical protein	NA	Q8W6T9	Burkholderia_virus	95.3	1.1e-73
WP_009901138.1|2481823_2482171_-	DUF3168 domain-containing protein	NA	Q6JIM2	Burkholderia_virus	92.2	6.8e-55
WP_009901139.1|2482167_2482590_-	HK97 gp10 family phage protein	NA	Q6JIM3	Burkholderia_virus	96.4	5.5e-67
WP_038710370.1|2482582_2482912_-|head	phage head closure protein	head	Q6JIM4	Burkholderia_virus	79.8	2.1e-45
WP_029227269.1|2482914_2483277_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q6JIM5	Burkholderia_virus	80.0	1.2e-46
WP_038710381.1|2483280_2483505_-	hypothetical protein	NA	Q6JIM6	Burkholderia_virus	75.3	6.1e-25
WP_029227270.1|2483567_2484824_-|capsid	phage major capsid protein	capsid	Q6JIM7	Burkholderia_virus	94.5	8.1e-215
WP_009901144.1|2484826_2485513_-|head,protease	HK97 family phage prohead protease	head,protease	Q6JIM8	Burkholderia_virus	95.2	3.7e-121
WP_009901146.1|2485493_2486807_-|portal	phage portal protein	portal	Q6JIM9	Burkholderia_virus	81.2	1.0e-204
WP_029227271.1|2486803_2488477_-|terminase	terminase large subunit	terminase	Q3HQS7	Burkholderia_phage	80.8	2.7e-266
WP_029227272.1|2488476_2488956_-|terminase	terminase small subunit	terminase	Q3HQS6	Burkholderia_phage	82.1	9.0e-58
WP_009901149.1|2489075_2489285_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_059601806.1|2489527_2489785_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	Q8W6N1	Burkholderia_virus	98.8	7.0e-41
WP_009901152.1|2489781_2490177_+	helix-turn-helix transcriptional regulator	NA	Q8W6N2	Burkholderia_virus	96.1	5.0e-62
WP_009901154.1|2490210_2490690_-	hypothetical protein	NA	Q3HQX5	Burkholderia_phage	78.6	6.3e-19
WP_144410569.1|2491173_2491509_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144410570.1|2491498_2491909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009901158.1|2492071_2492596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144410571.1|2493307_2495326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_102869147.1|2495722_2496922_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	43.2	5.4e-43
WP_009901163.1|2497066_2497714_-	hypothetical protein	NA	Q8W6N4	Burkholderia_virus	93.0	9.2e-106
WP_009901164.1|2497722_2497983_-	hypothetical protein	NA	Q8W6N5	Burkholderia_virus	95.3	9.9e-43
WP_009901165.1|2497958_2498240_-	hypothetical protein	NA	Q3HR03	Burkholderia_phage	77.9	1.1e-31
WP_038710377.1|2498293_2498716_-	DUF1364 family protein	NA	Q6JIF7	Burkholderia_virus	71.1	2.2e-52
WP_009901169.1|2498712_2499087_-	hypothetical protein	NA	A4JX57	Burkholderia_virus	85.5	1.8e-53
WP_029227276.1|2499083_2499635_-	DUF1064 domain-containing protein	NA	A4JX56	Burkholderia_virus	89.1	1.8e-86
WP_029227277.1|2499631_2500624_-	hypothetical protein	NA	Q6JIG0	Burkholderia_virus	97.6	5.5e-174
WP_009901173.1|2500777_2501038_-	helix-turn-helix domain-containing protein	NA	Q6JIG2	Burkholderia_virus	86.0	3.8e-34
WP_029227278.1|2501034_2501856_-	hypothetical protein	NA	Q8W6P2	Burkholderia_virus	97.8	9.2e-143
WP_009901176.1|2501890_2502865_-	phosphoadenosine phosphosulfate reductase family protein	NA	A4JX51	Burkholderia_virus	77.4	2.0e-149
WP_009901177.1|2503302_2503593_+	DUF4145 domain-containing protein	NA	A4JX50	Burkholderia_virus	97.9	4.3e-47
WP_009901178.1|2503763_2504204_-	phage regulatory CII family protein	NA	Q8W6P5	Burkholderia_virus	97.9	8.8e-76
WP_009901179.1|2504387_2504624_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009901180.1|2504836_2505079_-	helix-turn-helix domain-containing protein	NA	C7BGF8	Burkholderia_phage	71.4	5.4e-27
WP_009901181.1|2505164_2505557_+	hypothetical protein	NA	Q8W6P8	Burkholderia_virus	94.6	6.9e-64
WP_025987318.1|2506453_2506729_+	hypothetical protein	NA	Q8W6Q1	Burkholderia_virus	91.2	2.0e-41
WP_019254603.1|2506739_2506910_+	hypothetical protein	NA	Q8W6Q2	Burkholderia_virus	80.0	1.8e-08
WP_009901185.1|2507321_2507471_+	hypothetical protein	NA	Q8W6Q6	Burkholderia_virus	91.8	2.6e-16
WP_009901186.1|2507467_2508280_+	prohibitin family protein	NA	Q8W6Q7	Burkholderia_virus	97.0	2.0e-142
WP_009901187.1|2508552_2509260_+	hypothetical protein	NA	Q6JII4	Burkholderia_virus	84.7	1.2e-109
WP_009901188.1|2509385_2510060_+	hypothetical protein	NA	Q8W6Q9	Burkholderia_virus	89.5	1.8e-112
WP_009901192.1|2511828_2512779_+	phage Gp37/Gp68 family protein	NA	Q6JIJ3	Burkholderia_virus	67.5	3.2e-123
WP_009901193.1|2512775_2513438_+	hypothetical protein	NA	A0A059VF56	Pseudomonas_phage	42.0	4.3e-34
WP_009901194.1|2513440_2513770_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025987319.1|2513818_2514061_-	hypothetical protein	NA	Q6JIJ4	Burkholderia_virus	84.6	3.1e-30
WP_009901196.1|2514069_2514279_-	hypothetical protein	NA	Q6JIJ5	Burkholderia_virus	91.3	1.8e-31
WP_009901198.1|2514919_2516119_+|integrase	site-specific integrase	integrase	A0A1W6JTA0	Pseudomonas_phage	52.6	1.1e-107
WP_009901199.1|2516391_2518407_-	VC_2705 family sodium/solute symporter	NA	NA	NA	NA	NA
2516232:2516261	attR	TGGCGGAGAGAGGGGGATTCGAACCCCCGA	NA	NA	NA	NA
WP_045143316.1|2518400_2518781_-	DUF4212 domain-containing protein	NA	NA	NA	NA	NA
WP_009901201.1|2518878_2520861_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	44.3	8.9e-83
