The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP013414	Burkholderia ubonensis strain MSMB2035 chromosome 1, complete sequence	3935154	167400	249585	3935154	tail,transposase,holin,plate,integrase	Burkholderia_phage(65.71%)	73	211594:211613	224182:224201
WP_059757018.1|167400_168207_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_059760425.1|168617_169748_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_059759685.1|170598_172107_-	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	30.8	7.1e-32
WP_059759687.1|172147_173800_-	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_059759690.1|173854_174532_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_059759692.1|174757_175912_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_059609443.1|175942_176725_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_059759694.1|176738_178157_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_059759696.1|178197_178764_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_059759699.1|178839_179271_-	Cd(II)/Pb(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_059759702.1|179352_181821_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	45.9	6.4e-131
WP_059759704.1|181852_182176_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_059759706.1|182274_183141_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_059759709.1|183425_184886_+	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_059658326.1|185092_186505_+	ethanolamine permease	NA	NA	NA	NA	NA
WP_059609435.1|186587_187985_+	ethanolamine ammonia-lyase subunit EutB	NA	NA	NA	NA	NA
WP_059759712.1|187981_188773_+	ethanolamine ammonia-lyase subunit EutC	NA	NA	NA	NA	NA
WP_080410208.1|189220_192757_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_155122333.1|192746_194177_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059759720.1|194178_194466_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_059759721.1|194487_195927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059759723.1|195933_196374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059759725.1|196404_197289_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_059759726.1|197437_198973_+	MFS transporter	NA	NA	NA	NA	NA
WP_059759727.1|199202_199670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059759729.1|199880_201407_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_059759733.1|201840_202872_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_059759735.1|202896_203946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059759737.1|203962_205666_-	thiamine pyrophosphate-binding protein	NA	NA	NA	NA	NA
WP_059759739.1|206225_207614_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_059759848.1|207641_208784_-	alginate lyase family protein	NA	NA	NA	NA	NA
WP_059759741.1|208933_211861_-	aminomethyl-transferring glycine dehydrogenase	NA	M4QFZ1	Prochlorococcus_phage	51.3	3.1e-257
211594:211613	attL	CGAGCGCGCGCAGCGCGGCG	NA	NA	NA	NA
WP_059759743.1|211933_212314_-	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_059759745.1|212410_213529_-	glycine cleavage system aminomethyltransferase GcvT	NA	NA	NA	NA	NA
WP_059609549.1|213996_214386_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059759747.1|214534_215587_-	oxidoreductase	NA	NA	NA	NA	NA
WP_059759749.1|216095_218186_+	AAA family ATPase	NA	A7KV33	Bacillus_phage	35.8	9.9e-101
WP_059631748.1|218273_219164_-	cytochrome c5 family protein	NA	NA	NA	NA	NA
WP_059759751.1|219543_220620_-|integrase	site-specific integrase	integrase	A0A1S5NNJ1	Burkholderia_phage	85.2	1.9e-172
WP_080410209.1|220487_220928_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_080410210.1|220937_221321_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059759753.1|221317_224110_-	hypothetical protein	NA	E5E3N5	Burkholderia_phage	92.9	0.0e+00
WP_059759755.1|224113_224377_-	hypothetical protein	NA	E5E3N6	Burkholderia_phage	66.3	1.7e-18
224182:224201	attR	CGAGCGCGCGCAGCGCGGCG	NA	NA	NA	NA
WP_010095912.1|224581_224830_-	ogr/Delta-like zinc finger family protein	NA	K4PAZ0	Burkholderia_phage	91.5	5.9e-37
WP_010095910.1|224954_225170_-	hypothetical protein	NA	E5E3U1	Burkholderia_phage	81.4	2.0e-20
WP_155122334.1|225296_225752_+	transcriptional regulator	NA	E5E3U2	Burkholderia_phage	63.6	1.4e-44
WP_059759757.1|226122_226419_+	hypothetical protein	NA	E5E3U3	Burkholderia_phage	50.5	1.6e-12
WP_059759760.1|226550_227630_-	phage late control D family protein	NA	K4PAY4	Burkholderia_phage	71.8	8.7e-133
WP_059759762.1|227626_228082_-|tail	phage tail protein	tail	K4NXK5	Burkholderia_phage	62.0	6.8e-39
WP_059759764.1|228111_230664_-	hypothetical protein	NA	A4JWS3	Burkholderia_virus	47.2	2.5e-154
WP_076481858.1|230679_230793_-|tail	GpE family phage tail protein	tail	E5E3U7	Burkholderia_phage	75.7	4.0e-09
WP_059759766.1|230801_231185_-|tail	phage tail assembly protein	tail	K4NXA3	Burkholderia_phage	68.0	1.7e-27
WP_010095894.1|231255_231759_-|tail	phage major tail tube protein	tail	E5E3U9	Burkholderia_phage	74.3	4.8e-70
WP_059759768.1|231793_232966_-|tail	phage tail sheath protein	tail	A4JWS7	Burkholderia_virus	83.3	1.2e-188
WP_059759771.1|233048_233885_-|tail	phage tail protein	tail	E5E3Q6	Burkholderia_phage	62.0	8.0e-94
WP_059759773.1|233899_236197_-	hypothetical protein	NA	E5E3V2	Burkholderia_phage	63.9	2.8e-274
WP_059759776.1|236203_236746_-|tail	phage tail protein I	tail	E5FFH2	Burkholderia_phage	72.6	1.2e-71
WP_059759779.1|236738_237653_-|plate	baseplate assembly protein	plate	E5FFH3	Burkholderia_phage	73.9	6.4e-121
WP_059759781.1|237649_238012_-|plate	baseplate assembly protein	plate	K4PAX6	Burkholderia_phage	66.7	7.1e-39
WP_059631727.1|238008_238692_-|plate	phage baseplate assembly protein V	plate	K4NXJ5	Burkholderia_phage	70.0	7.5e-82
WP_059759784.1|239298_239742_-|tail	phage tail protein	tail	A0A291LAV4	Bordetella_phage	45.7	1.8e-23
WP_059759786.1|239752_240817_-	hypothetical protein	NA	A4JWL8	Burkholderia_virus	45.3	5.9e-57
WP_059759788.1|240813_241380_-|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	57.3	1.3e-39
WP_059759791.1|241372_242284_-|plate	baseplate assembly protein	plate	E5FFH3	Burkholderia_phage	50.2	1.5e-74
WP_059759793.1|242280_242736_-|tail	phage tail protein	tail	E5E3V9	Burkholderia_phage	55.0	5.2e-31
WP_080410211.1|242852_243293_-	protein lysB	NA	E5E3W1	Burkholderia_phage	45.2	5.8e-19
WP_059759800.1|243289_244123_-	DUF3380 domain-containing protein	NA	A4JWZ0	Burkholderia_virus	67.4	5.0e-96
WP_045566864.1|244126_244393_-|holin	phage holin family protein	holin	E5E3W3	Burkholderia_phage	66.3	1.6e-24
WP_010095861.1|244394_244739_-	membrane protein	NA	A4JWU2	Burkholderia_virus	79.6	6.7e-39
WP_059759802.1|244754_244961_-|tail	phage tail protein	tail	E5E3W5	Burkholderia_phage	70.6	7.1e-20
WP_059609547.1|245367_245838_-	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_059759852.1|246029_247604_+	TIGR04222 domain-containing membrane protein	NA	NA	NA	NA	NA
WP_059759804.1|247902_249585_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	28.7	5.3e-20
>prophage 2
NZ_CP013414	Burkholderia ubonensis strain MSMB2035 chromosome 1, complete sequence	3935154	334831	396294	3935154	transposase,integrase	Stx2-converting_phage(28.57%)	53	334785:334844	373765:374631
334785:334844	attL	CCTAGAGCGTGTTAGGAACTTTCGTTAAGGAATGCTATCGTGCTGAGATGAAAGCACGGA	NA	NA	NA	NA
WP_059757018.1|334831_335638_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_080409939.1|335694_336156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059750528.1|336145_337348_-	ThiF family adenylyltransferase	NA	NA	NA	NA	NA
WP_059750527.1|337322_337580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080409938.1|337708_338545_+	TIGR04255 family protein	NA	NA	NA	NA	NA
WP_080409937.1|338541_339225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059750526.1|339221_339917_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_059750503.1|340307_341903_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	57.1	6.8e-134
WP_059726816.1|341933_342278_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	73.8	1.1e-41
WP_059751474.1|342774_343593_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059751472.1|343922_344981_-|integrase	integrase	integrase	W6MYA3	Pseudomonas_phage	43.1	1.3e-56
WP_059751471.1|345512_345779_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059751469.1|345763_346150_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059751476.1|346192_347611_-	glucarate dehydratase	NA	NA	NA	NA	NA
WP_059751467.1|347667_349008_-	MFS transporter	NA	NA	NA	NA	NA
WP_059751466.1|349161_350067_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_059751464.1|350173_350896_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_059751462.1|350908_352075_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_059751460.1|352083_353238_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_059751459.1|353259_353970_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.7	4.6e-34
WP_059751457.1|353971_355180_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_059751455.1|355491_355725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059751453.1|355809_356553_-	Mut7-C ubiquitin/RNAse domain-containing protein	NA	NA	NA	NA	NA
WP_059751451.1|356647_357517_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_059614850.1|357596_358238_+	LysE family translocator	NA	NA	NA	NA	NA
WP_059751449.1|358304_359597_-	MFS transporter	NA	NA	NA	NA	NA
WP_059751447.1|359690_360617_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_059751445.1|360776_361613_-	OmpW family protein	NA	NA	NA	NA	NA
WP_059751443.1|361631_362873_-	DUF2957 domain-containing protein	NA	NA	NA	NA	NA
WP_059751441.1|363021_364440_-	DUF2957 domain-containing protein	NA	NA	NA	NA	NA
WP_059751439.1|364870_365821_-	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
WP_059751437.1|365966_366539_-	flavodoxin family protein	NA	NA	NA	NA	NA
WP_059751435.1|366699_367296_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_059751433.1|367520_368207_-	orotate phosphoribosyltransferase	NA	S4W4D9	Pandoravirus	28.2	1.4e-14
WP_059751431.1|368674_370945_+	NADP-dependent malic enzyme	NA	NA	NA	NA	NA
WP_155122338.1|371188_372964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059757018.1|372970_373777_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_059749364.1|373929_377517_-	indolepyruvate ferredoxin oxidoreductase family protein	NA	NA	NA	NA	NA
373765:374631	attR	TCCGTGCTTTCATCTCAGCACGATAGCATTCCTTAACGAAAGTTCCTAACACGCTCTAGGGCGACGCGGACCCGAAGCGTGCCGCGGATCGGCTGCGCGTTCTGATGCGCGCAGCGAGTTCGTGCGGCCGCTCCCGGCCGCACGAACCGCTTCCGCCTTACGCGGCTACGCGACGTGCCGTGTCGTGCCGTCCTGCGGTGCGCGCCAGCGCGCGACGAGGTCGCGCCACTTGATGCGCACGGCCTGCAGGTTGTGCTCCTTCACGTGACCATAGCCGCGAATGCCGTCCGGCAGCGCCGCGAGTTCGAGTGCGAGCGGGCGGTTGGTCGCGGTCAGCTTCGCGAGCACCTCGCCGATCAGCGCTTCGTACTCGCCGATCAGCGCACGCTCGGTGCGACGCTCCTCGGTGCGGCCGAACGGATCGAGGCCGGTGCCGCGCAGGAACTTCAGCTTCGCGAGCATCCGGAACGCCGGCATCATCCACGGGCCGTACGCCTTCTTCAGCAGATGGCCGTGCGCGTCCTTCTTCGCGAACAGCGGCGGCGCGAGGTGGAATTTCAGCTTCCAGTCGCCTTCGAACTGCGCGGACAGGCGCGCGACGAACGCCGGATCGGACTGCAGCCGCGCAACCTCGTATTCGTCCTTGTACGCCATCAGCTTGAACAGGTTGCGCGCGACCGCCTCGGTCAGCGGCTCCTGCGCATCGCCGTCGGCCAGCGCGCGCTCGGCGGCGCGCACGTGCTCGACGAACGCCGCGTAGCGCGCTCCGTAGGCCGCGTTCTGGTATGCGGTGAGGAACTCGACCCGCTTCGCGATCAGCGCGTCCACCGACTTCTTCGTGTGCAGCGCGATCACCGTCGCACCGGC	NA	NA	NA	NA
WP_059658273.1|377835_378030_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045566820.1|378160_379258_-	4-hydroxyphenylpyruvate dioxygenase	NA	NA	NA	NA	NA
WP_059749363.1|379411_379936_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_059749362.1|380002_380650_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_042586829.1|380883_381489_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_059749361.1|381504_382314_-	DUF1835 domain-containing protein	NA	NA	NA	NA	NA
WP_059749360.1|382463_383552_-	phenylacetate-CoA oxygenase/reductase subunit PaaK	NA	NA	NA	NA	NA
WP_059593248.1|383553_384111_-	phenylacetate-CoA oxygenase subunit PaaJ	NA	NA	NA	NA	NA
WP_059749359.1|384136_384940_-	phenylacetate-CoA oxygenase subunit PaaC	NA	NA	NA	NA	NA
WP_010092957.1|384950_385235_-	1,2-phenylacetyl-CoA epoxidase subunit B	NA	NA	NA	NA	NA
WP_059609306.1|385270_386269_-	1,2-phenylacetyl-CoA epoxidase subunit A	NA	NA	NA	NA	NA
WP_059749358.1|386470_387730_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_063801159.1|393894_394371_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_034190888.1|394346_394697_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	39.4	2.5e-17
WP_069240679.1|394728_396294_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	34.4	4.4e-69
>prophage 3
NZ_CP013414	Burkholderia ubonensis strain MSMB2035 chromosome 1, complete sequence	3935154	1115326	1124705	3935154	tRNA	Bacillus_virus(16.67%)	7	NA	NA
WP_059749549.1|1115326_1116637_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.0	1.6e-80
WP_059749550.1|1116659_1116926_-	DUF2164 domain-containing protein	NA	NA	NA	NA	NA
WP_059731386.1|1117098_1118400_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	52.3	4.3e-94
WP_059749551.1|1119033_1121820_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	25.3	4.1e-41
WP_059617943.1|1121827_1123534_+	peptidoglycan DD-metalloendopeptidase family protein	NA	D6QWN8	uncultured_phage	30.9	1.0e-10
WP_080409862.1|1123551_1124355_+	hypothetical protein	NA	A0A2I6UFG0	Klebsiella_phage	32.4	1.3e-05
WP_059749552.1|1124423_1124705_+	PAAR domain-containing protein	NA	A4PE23	Ralstonia_virus	39.8	9.5e-07
>prophage 4
NZ_CP013414	Burkholderia ubonensis strain MSMB2035 chromosome 1, complete sequence	3935154	1806704	1834641	3935154		Burkholderia_phage(27.27%)	49	NA	NA
WP_059757974.1|1806704_1807670_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	37.1	1.0e-28
WP_006400187.1|1807725_1807941_+	transporter	NA	NA	NA	NA	NA
WP_042583946.1|1808081_1808279_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059757977.1|1808318_1808573_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059757979.1|1808848_1809109_-	Pyocin activator protein PrtN	NA	I6NSR8	Burkholderia_phage	73.2	1.6e-29
WP_059757981.1|1809105_1809792_-	hypothetical protein	NA	Q5QF30	Pseudomonas_virus	42.9	3.1e-35
WP_059757984.1|1809788_1810031_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059757987.1|1810027_1810516_-	DUF1643 domain-containing protein	NA	B5WZV8	Pseudomonas_phage	52.5	4.1e-42
WP_155122368.1|1810512_1811301_-	hypothetical protein	NA	A0A291LAU4	Bordetella_phage	55.2	5.3e-71
WP_155122369.1|1811287_1812805_-	hypothetical protein	NA	A1YZU8	Burkholderia_virus	53.9	2.2e-17
WP_059757995.1|1812819_1814496_-	DNA methyltransferase	NA	H9C171	Pectobacterium_phage	43.9	1.8e-140
WP_155122370.1|1814594_1815254_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059758002.1|1815287_1815719_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_059758005.1|1815744_1816155_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059758008.1|1816156_1816351_-	hypothetical protein	NA	A9YX20	Burkholderia_phage	82.1	5.7e-19
WP_059758506.1|1816347_1816821_-	hypothetical protein	NA	A9YX19	Burkholderia_phage	67.4	1.9e-52
WP_059758011.1|1816826_1817279_-	HNH endonuclease	NA	A0A1Z1LW18	Escherichia_phage	43.0	5.8e-22
WP_059758013.1|1817281_1817770_-	DUF1566 domain-containing protein	NA	NA	NA	NA	NA
WP_059758016.1|1817800_1818166_-	DUF1566 domain-containing protein	NA	NA	NA	NA	NA
WP_059758019.1|1818263_1818926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059758022.1|1818952_1820554_-	endonuclease	NA	A0A2H4J6P1	uncultured_Caudovirales_phage	46.6	1.7e-92
WP_059758026.1|1820546_1821452_-	ERF family protein	NA	B5WZW4	Pseudomonas_phage	68.6	1.6e-55
WP_155122371.1|1821466_1821634_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155122372.1|1821630_1822080_-	HNH endonuclease	NA	W6PP19	Citrobacter_phage	38.5	2.7e-19
WP_059758038.1|1822390_1822705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059758042.1|1823120_1823405_-	KTSC domain-containing protein	NA	A9YWW2	Burkholderia_phage	58.3	2.0e-20
WP_080410181.1|1823461_1823698_-	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	40.3	1.9e-08
WP_155122373.1|1823739_1823910_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155122374.1|1824047_1824221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155122375.1|1824238_1824412_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059758049.1|1824795_1825488_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080410162.1|1825509_1826385_-	helix-turn-helix transcriptional regulator	NA	A0A139ZPI7	Marinitoga_camini_virus	24.9	1.5e-05
WP_080410163.1|1826383_1826584_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059758064.1|1826822_1827083_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155122376.1|1827306_1827525_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059758072.1|1827521_1827944_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_080410164.1|1827723_1829007_+	replication protein	NA	I6PDJ3	Cronobacter_phage	47.4	3.7e-13
WP_059758080.1|1829003_1829273_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059758084.1|1829269_1829749_+	adenine methyltransferase	NA	Q3HQW3	Burkholderia_phage	85.4	1.1e-82
WP_059758088.1|1829745_1831140_+	replicative DNA helicase	NA	C7BGG1	Burkholderia_phage	46.5	1.4e-90
WP_088510644.1|1831084_1831648_+	hypothetical protein	NA	S5YLC4	Mycobacterium_phage	32.9	7.0e-17
WP_063801222.1|1831644_1832103_+	hypothetical protein	NA	K4ICN3	Acidithiobacillus_phage	46.3	4.2e-28
WP_155122377.1|1832099_1832714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059758091.1|1832722_1833013_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059758093.1|1833009_1833273_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059758096.1|1833269_1833509_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155122378.1|1833505_1833700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080410165.1|1833752_1834049_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080410166.1|1834041_1834641_+	hypothetical protein	NA	U5PWK7	Bacillus_phage	53.1	3.0e-26
>prophage 5
NZ_CP013414	Burkholderia ubonensis strain MSMB2035 chromosome 1, complete sequence	3935154	1850439	1862343	3935154		Ralstonia_phage(33.33%)	9	NA	NA
WP_059758170.1|1850439_1853487_+	hypothetical protein	NA	L7P7M2	Pseudomonas_phage	22.7	4.0e-10
WP_080410168.1|1853488_1854403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059758177.1|1854399_1855494_+	DUF2163 domain-containing protein	NA	A0A0B5A5B8	Paracoccus_phage	39.1	6.1e-25
WP_059758180.1|1855495_1855900_+	hypothetical protein	NA	A0A1W6DXC5	Sphingobium_phage	41.2	9.1e-19
WP_059758183.1|1855901_1859102_+	hypothetical protein	NA	K4K665	Caulobacter_phage	23.1	7.2e-50
WP_059758187.1|1859104_1860868_+	hypothetical protein	NA	B2ZY69	Ralstonia_phage	43.5	1.3e-05
WP_059758190.1|1860948_1861314_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059758193.1|1861315_1861702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059758196.1|1861692_1862343_+	glycoside hydrolase family 19 protein	NA	A0A0X8WP64	Ralstonia_phage	37.7	1.4e-29
>prophage 6
NZ_CP013414	Burkholderia ubonensis strain MSMB2035 chromosome 1, complete sequence	3935154	2177108	2270240	3935154	protease,tail,transposase,holin,plate,portal,integrase,terminase,capsid,head	uncultured_Caudovirales_phage(21.95%)	93	2166460:2166477	2253260:2253277
2166460:2166477	attL	CGACCGCGCTCGCGGTGC	NA	NA	NA	NA
WP_059627200.1|2177108_2178131_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	31.8	3.4e-38
WP_059761210.1|2179113_2180469_+|transposase	IS110 family transposase	transposase	Q9JMN8	Wolbachia_phage	46.5	2.0e-110
WP_059752403.1|2181946_2183539_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	27.3	6.9e-54
WP_059752398.1|2183705_2185970_-	AsmA family protein	NA	NA	NA	NA	NA
WP_059752393.1|2186132_2186831_+	ATP-binding cassette domain-containing protein	NA	A0A1V0SE00	Indivirus	24.2	9.0e-06
WP_059752389.1|2186827_2187631_+	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_059752384.1|2187648_2188119_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059752380.1|2188349_2188901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059752411.1|2189058_2190075_-	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_059752376.1|2190200_2191166_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_059752373.1|2191393_2192239_+	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_059752369.1|2192309_2193506_-	cystathionine beta-lyase	NA	NA	NA	NA	NA
WP_059752365.1|2193620_2194199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059752362.1|2194218_2195409_-	acetyl-CoA C-acyltransferase family protein	NA	NA	NA	NA	NA
WP_059752358.1|2195474_2196401_-	sugar kinase	NA	NA	NA	NA	NA
WP_059752355.1|2196404_2197778_-	30S ribosomal protein S12 methylthiotransferase RimO	NA	NA	NA	NA	NA
WP_059752407.1|2197793_2199446_+|integrase	integrase	integrase	Q3HQV4	Burkholderia_phage	64.6	7.9e-202
WP_080410015.1|2199385_2200585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080410014.1|2200588_2201317_+	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_080410013.1|2201690_2202104_-	DUF159 family protein	NA	Q8W6R8	Burkholderia_virus	72.8	7.8e-58
WP_038799209.1|2202174_2202717_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_059752349.1|2202692_2203043_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	39.4	9.6e-17
WP_059752344.1|2203074_2204640_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	33.8	9.8e-69
WP_059752337.1|2204976_2205603_+	hypothetical protein	NA	Q8W6R9	Burkholderia_virus	47.8	2.0e-44
WP_059752334.1|2205693_2206104_+	PAAR domain-containing protein	NA	Q8W6S2	Burkholderia_virus	48.8	4.0e-14
WP_059752329.1|2206108_2206612_+	DUF4123 domain-containing protein	NA	A4PE24	Ralstonia_virus	43.9	1.4e-21
WP_059752327.1|2206604_2207078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080410012.1|2206959_2207568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059752324.1|2207580_2208291_+	LysR family transcriptional regulator	NA	A4PE26	Ralstonia_virus	38.1	3.8e-36
WP_059752321.1|2208330_2209119_-	DNA adenine methylase	NA	Q8W6S4	Burkholderia_virus	90.1	4.7e-144
WP_059752318.1|2209289_2209784_-	DUF2514 family protein	NA	C7BGD9	Burkholderia_phage	50.6	5.1e-32
WP_059752316.1|2209780_2210275_-	glycoside hydrolase family 104 protein	NA	Q6J1Q5	Burkholderia_virus	87.0	5.3e-77
WP_059752314.1|2210277_2210562_-|holin	holin	holin	C7BGD7	Burkholderia_phage	92.6	3.8e-40
WP_059752312.1|2210636_2211689_-	late control protein	NA	A0A2H4JBF6	uncultured_Caudovirales_phage	46.8	6.4e-80
WP_059752311.1|2211698_2211905_-|tail	phage tail protein	tail	R9TR63	Vibrio_phage	47.8	1.6e-08
WP_059752309.1|2211879_2212761_-|tail	phage tail protein	tail	A0A2H4J875	uncultured_Caudovirales_phage	38.3	1.3e-33
WP_069240690.1|2212772_2215217_-|tail	phage tail tape measure protein	tail	A0A2H4JG00	uncultured_Caudovirales_phage	33.3	1.4e-53
WP_059774786.1|2215283_2215613_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_069240691.1|2215697_2216201_-|tail	phage major tail tube protein	tail	Q7M2A5	Pseudomonas_phage	49.4	5.1e-43
WP_069240692.1|2216211_2217381_-|tail	phage tail sheath family protein	tail	A0A2H4J869	uncultured_Caudovirales_phage	74.0	1.5e-162
WP_059751527.1|2217461_2217917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059751525.1|2217934_2218996_-	hypothetical protein	NA	A4JWL8	Burkholderia_virus	47.3	1.5e-57
WP_059751523.1|2218992_2219559_-|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	47.6	2.6e-35
WP_059751521.1|2219548_2220442_-|plate	baseplate J protein	plate	D5LGZ3	Escherichia_phage	38.8	1.7e-49
WP_059751519.1|2220438_2220783_-|plate	phage baseplate protein	plate	A0A2H4JA09	uncultured_Caudovirales_phage	51.9	1.9e-25
WP_059751517.1|2220779_2220986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059751515.1|2221049_2221730_-|plate	phage baseplate assembly protein V	plate	NA	NA	NA	NA
WP_059751512.1|2221726_2222254_-	hypothetical protein	NA	Q9JML9	Wolbachia_phage	37.1	6.7e-22
WP_059751510.1|2222246_2222774_-|tail	phage tail protein	tail	K7R9K2	Vibrio_phage	30.2	1.8e-19
WP_059751508.1|2222779_2223070_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045567536.1|2223071_2224067_-|capsid	major capsid protein	capsid	A0A2H4J890	uncultured_Caudovirales_phage	60.3	4.6e-112
WP_059743317.1|2224133_2224478_-|head	head decoration protein	head	NA	NA	NA	NA
WP_059751506.1|2224490_2225588_-|protease	Clp protease ClpP	protease	A0A2H4JDI2	uncultured_Caudovirales_phage	37.2	3.5e-49
WP_059751505.1|2225584_2227075_-|portal	phage portal protein	portal	A0A2H4JFL5	uncultured_Caudovirales_phage	51.5	2.8e-134
WP_059751503.1|2227071_2227278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059751501.1|2227287_2229402_-|terminase	phage terminase large subunit family protein	terminase	A0A2D1GMT1	Marinobacter_phage	52.9	2.7e-178
WP_155122387.1|2229995_2230646_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059751533.1|2230918_2231692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059751497.1|2231908_2234401_-	virulence protein E	NA	A0A2D1GN57	Marinobacter_phage	42.2	3.2e-98
WP_059751531.1|2234559_2234943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059751496.1|2234944_2235502_-	hypothetical protein	NA	C7BGG0	Burkholderia_phage	46.5	2.1e-29
WP_080409988.1|2235513_2235732_-	hypothetical protein	NA	A0A2H4JCB6	uncultured_Caudovirales_phage	56.7	1.2e-09
WP_155122388.1|2235730_2236357_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059751492.1|2236671_2236890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059751490.1|2236941_2237304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059751488.1|2237300_2237900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059751529.1|2237899_2239330_+	hypothetical protein	NA	A0A2I7QW51	Vibrio_phage	30.0	8.5e-11
WP_059751485.1|2239431_2239782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080409987.1|2239795_2240029_+	hypothetical protein	NA	A8YQQ5	Burkholderia_virus	62.3	4.9e-17
WP_155122389.1|2240163_2240895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080409986.1|2240887_2242096_-	RNA-directed DNA polymerase	NA	A0A0F7LDS3	Escherichia_phage	45.7	4.0e-94
WP_059751483.1|2242793_2244494_+	dihydroxyacetone kinase subunit DhaK	NA	NA	NA	NA	NA
WP_059751480.1|2244763_2246128_+	insulinase family protein	NA	NA	NA	NA	NA
WP_059751478.1|2246124_2247471_+	insulinase family protein	NA	NA	NA	NA	NA
WP_155122390.1|2247601_2247919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080400612.1|2248879_2249119_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059611667.1|2249669_2250233_-	polyhydroxyalkanoate synthesis repressor PhaR	NA	NA	NA	NA	NA
WP_010092274.1|2250353_2251094_-	3-ketoacyl-ACP reductase	NA	NA	NA	NA	NA
WP_069240714.1|2251199_2252381_-	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_059750758.1|2252480_2254346_-	class I poly(R)-hydroxyalkanoic acid synthase	NA	NA	NA	NA	NA
2253260:2253277	attR	GCACCGCGAGCGCGGTCG	NA	NA	NA	NA
WP_059750932.1|2254711_2255551_-	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
WP_059750760.1|2255557_2256760_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_059750762.1|2256801_2257626_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_059750765.1|2257695_2259942_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	29.5	2.2e-77
WP_010092269.1|2259997_2260213_-	YdcH family protein	NA	NA	NA	NA	NA
WP_059750767.1|2260291_2261050_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059750770.1|2261216_2263544_+	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_059750772.1|2263635_2265555_-	potassium transporter Kup	NA	A7J6G4	Paramecium_bursaria_Chlorella_virus	32.7	1.3e-78
WP_059750774.1|2265809_2266400_-	phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_059750775.1|2266406_2267753_-	adenylosuccinate synthase	NA	A0A160ER07	Powai_lake_megavirus	36.8	9.0e-71
WP_059618057.1|2267866_2269015_-	ATP phosphoribosyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_010092260.1|2269112_2269304_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_059750776.1|2269340_2270240_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
>prophage 7
NZ_CP013414	Burkholderia ubonensis strain MSMB2035 chromosome 1, complete sequence	3935154	2359295	2432115	3935154	protease,tail,holin,plate,portal,integrase,terminase,capsid,head	uncultured_Caudovirales_phage(25.71%)	76	2353237:2353255	2370740:2370758
2353237:2353255	attL	CGCGCCGATCGCGCGCAGC	NA	NA	NA	NA
WP_059750902.1|2359295_2360498_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	41.8	4.7e-71
WP_155122391.1|2360881_2361661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080409962.1|2361657_2362563_+	DUF3037 domain-containing protein	NA	NA	NA	NA	NA
WP_155122392.1|2362884_2363373_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059750906.1|2363570_2364197_+	hypothetical protein	NA	Q8W6R9	Burkholderia_virus	47.3	7.4e-44
WP_080401268.1|2364221_2364545_-	hypothetical protein	NA	A4PE26	Ralstonia_virus	49.0	4.7e-18
WP_063801163.1|2364950_2365562_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059750909.1|2365449_2365920_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059750911.1|2365909_2366407_-	DUF4123 domain-containing protein	NA	A4PE24	Ralstonia_virus	36.0	4.0e-16
WP_080409963.1|2366413_2367058_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_059750915.1|2367026_2367815_-	DNA adenine methylase	NA	Q8W6S4	Burkholderia_virus	90.8	1.2e-144
WP_080409964.1|2367985_2368480_-	DUF2514 family protein	NA	C7BGD9	Burkholderia_phage	57.6	1.4e-37
WP_059750920.1|2368476_2368968_-	glycoside hydrolase family 104 protein	NA	Q6J1Q5	Burkholderia_virus	90.7	1.6e-78
WP_059529388.1|2368970_2369255_-|holin	holin	holin	C7BGD7	Burkholderia_phage	92.6	6.6e-40
WP_059750922.1|2369328_2370381_-	late control protein	NA	A0A2H4JBF6	uncultured_Caudovirales_phage	47.1	1.1e-79
WP_059750925.1|2370390_2370597_-|tail	phage tail protein	tail	A0A2H4J9Z9	uncultured_Caudovirales_phage	59.7	2.8e-16
WP_059750928.1|2370571_2371453_-|tail	phage tail protein	tail	A0A2H4J875	uncultured_Caudovirales_phage	38.7	1.7e-33
2370740:2370758	attR	CGCGCCGATCGCGCGCAGC	NA	NA	NA	NA
WP_069240693.1|2371465_2373898_-|tail	phage tail tape measure protein	tail	A0A2H4JG00	uncultured_Caudovirales_phage	33.6	2.5e-55
WP_069240694.1|2373964_2374294_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_069240695.1|2374378_2374882_-|tail	phage major tail tube protein	tail	Q7M2A5	Pseudomonas_phage	50.0	6.0e-44
WP_069240696.1|2374892_2376062_-|tail	phage tail sheath family protein	tail	A0A2H4J869	uncultured_Caudovirales_phage	74.2	8.7e-163
WP_059750533.1|2376142_2376598_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_155122393.1|2376616_2377687_-	hypothetical protein	NA	A4JWL8	Burkholderia_virus	43.2	2.2e-56
WP_059750534.1|2377683_2378250_-|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	50.6	8.0e-37
WP_059750535.1|2378239_2379133_-|plate	baseplate J protein	plate	D5LGZ3	Escherichia_phage	38.4	3.8e-49
WP_059643540.1|2379129_2379474_-|plate	phage baseplate protein	plate	A0A2H4JA09	uncultured_Caudovirales_phage	51.9	1.9e-25
WP_059529352.1|2379470_2379677_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059743320.1|2379740_2380421_-|plate	phage baseplate assembly protein V	plate	NA	NA	NA	NA
WP_059750536.1|2380417_2380945_-	hypothetical protein	NA	Q9JML9	Wolbachia_phage	37.9	3.0e-22
WP_059750537.1|2380937_2381465_-|tail	phage tail protein	tail	D4HTU8	Vibrio_phage	29.2	1.2e-18
WP_059750538.1|2381470_2381761_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059750539.1|2381762_2382758_-|capsid	major capsid protein	capsid	A0A2H4J890	uncultured_Caudovirales_phage	60.9	8.3e-114
WP_059750540.1|2382831_2383176_-|head	head decoration protein	head	NA	NA	NA	NA
WP_059750541.1|2383205_2384282_-|protease	Clp protease ClpP	protease	A0A2H4JDI2	uncultured_Caudovirales_phage	37.6	2.7e-49
WP_059750542.1|2384278_2385769_-|portal	phage portal protein	portal	A0A2H4JFL5	uncultured_Caudovirales_phage	51.6	1.7e-134
WP_059750543.1|2385765_2385972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059750544.1|2385981_2388096_-|terminase	phage terminase large subunit family protein	terminase	A0A2D1GMT1	Marinobacter_phage	53.0	2.4e-179
WP_155122394.1|2388777_2389656_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059750545.1|2389724_2390105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059750546.1|2390451_2391225_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059750547.1|2391447_2393955_-	virulence protein E	NA	A0A2D1GN57	Marinobacter_phage	40.4	3.0e-96
WP_155122395.1|2394037_2394610_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059750549.1|2394807_2395191_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155122396.1|2395192_2395540_-	hypothetical protein	NA	C7BGG0	Burkholderia_phage	40.4	2.3e-10
WP_155122397.1|2395559_2395694_-	DUF1922 domain-containing protein	NA	NA	NA	NA	NA
WP_088507965.1|2395805_2395997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080409945.1|2396047_2396656_+	helix-turn-helix transcriptional regulator	NA	G9L6A6	Escherichia_phage	40.2	4.0e-10
WP_155122398.1|2396600_2397065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059750554.1|2397196_2397415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080409941.1|2397466_2397823_+	beta-hexosaminidase	NA	NA	NA	NA	NA
WP_059750555.1|2397870_2398419_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059750603.1|2398418_2399849_+	hypothetical protein	NA	A0A2I7QW51	Vibrio_phage	27.9	2.1e-09
WP_080409943.1|2399845_2400292_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088510561.1|2400357_2400513_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_155122399.1|2400773_2401730_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059750558.1|2402253_2402652_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059750559.1|2402694_2404143_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_059750560.1|2404469_2405648_-	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
WP_059611660.1|2405695_2406328_-	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L2K0	Tupanvirus	36.5	5.2e-21
WP_059750561.1|2406379_2408464_-	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_059750562.1|2408613_2410251_-	fatty-acid--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	23.5	5.9e-24
WP_059750563.1|2410646_2412224_+	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	32.0	8.1e-55
WP_059611584.1|2412262_2412694_+	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_059750564.1|2412808_2413339_+	septation protein A	NA	NA	NA	NA	NA
WP_059611586.1|2413340_2413649_+	BolA family transcriptional regulator	NA	NA	NA	NA	NA
WP_059750565.1|2413670_2414450_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_059750566.1|2414529_2415081_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_059750567.1|2415085_2419150_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	92.4	9.9e-222
WP_059750568.1|2419390_2420695_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_059750569.1|2420739_2422302_+	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
WP_059750570.1|2422415_2424038_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_059527683.1|2424086_2424800_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.4	3.9e-33
WP_059611600.1|2424798_2425479_+	arylesterase	NA	NA	NA	NA	NA
WP_059750571.1|2425567_2427502_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_059618272.1|2428220_2430644_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.9	1.6e-222
WP_010092138.1|2430843_2432115_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	58.5	2.7e-133
>prophage 8
NZ_CP013414	Burkholderia ubonensis strain MSMB2035 chromosome 1, complete sequence	3935154	3815572	3851634	3935154	plate,protease	Erwinia_phage(20.0%)	27	NA	NA
WP_042586564.1|3815572_3816109_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_059611865.1|3816119_3817463_+|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A191ZC11	Erwinia_phage	29.6	3.0e-42
WP_155122424.1|3817682_3818060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059749840.1|3818967_3819408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059611872.1|3819633_3820176_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_059749783.1|3820210_3821584_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_059749782.1|3821672_3821897_-	cysteine-rich CWC family protein	NA	NA	NA	NA	NA
WP_010090348.1|3822215_3823115_+	acetylglutamate kinase	NA	NA	NA	NA	NA
WP_059749781.1|3823111_3823903_+	pyrimidine 5'-nucleotidase	NA	NA	NA	NA	NA
WP_059749780.1|3823869_3824550_+	nucleoid occlusion factor SlmA	NA	NA	NA	NA	NA
WP_059749779.1|3824591_3827264_-	type VI secretion system ATPase TssH	NA	A0A248SJW6	Salicola_phage	30.8	2.5e-72
WP_080409882.1|3827751_3828777_+	TagK domain-containing protein	NA	NA	NA	NA	NA
WP_059749777.1|3828757_3829618_+	ImpE protein superfamily protein	NA	NA	NA	NA	NA
WP_059749776.1|3829601_3830123_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_059749775.1|3830124_3832005_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_059749774.1|3832008_3833070_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_059749773.1|3833066_3834125_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_059749772.1|3834175_3835207_+	fimbrial protein	NA	NA	NA	NA	NA
WP_059749771.1|3835237_3836590_+	hypothetical protein	NA	A0A292GJ55	Xanthomonas_phage	45.5	1.1e-108
WP_059749770.1|3836642_3840095_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	44.3	1.0e-17
WP_076480801.1|3840106_3840373_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080409881.1|3840460_3843619_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	26.8	2.4e-37
WP_059749769.1|3843719_3844283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059749768.1|3844263_3845064_-	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
WP_059749767.1|3845060_3848969_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_059749766.1|3848983_3850288_-	type VI secretion system protein TssL	NA	NA	NA	NA	NA
WP_059611907.1|3850284_3851634_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 1
NZ_CP013416	Burkholderia ubonensis strain MSMB2035 chromosome 2, complete sequence	3000610	797235	846668	3000610	terminase,capsid,head,holin,protease,tRNA,integrase,portal,tail	Burkholderia_phage(57.78%)	60	805162:805189	848518:848545
WP_059759339.1|797235_798276_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	52.6	1.4e-92
WP_155122541.1|798274_799630_+	aminoacetone oxidase family FAD-binding enzyme	NA	NA	NA	NA	NA
WP_004190342.1|799705_799918_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_059759344.1|800081_800528_+	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	47.3	2.2e-21
WP_059759346.1|800601_802479_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	36.7	7.1e-66
WP_080410192.1|802567_804979_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	32.0	4.9e-35
805162:805189	attL	GCGGGTTCGAACCCCGCCGGGCCCACCA	NA	NA	NA	NA
WP_059759351.1|805214_806396_-|integrase	site-specific integrase	integrase	Q774Z5	Bordetella_phage	59.2	1.4e-131
WP_071733003.1|806371_806581_-	excisionase	NA	Q774Z6	Bordetella_phage	76.8	3.7e-24
WP_155122485.1|806621_806768_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059627415.1|807194_807434_-	hypothetical protein	NA	A9YWV3	Burkholderia_phage	67.9	6.8e-22
WP_080410193.1|808576_809608_-	DNA cytosine methyltransferase	NA	A0A2I7QIW2	Vibrio_phage	60.0	8.8e-50
WP_059759359.1|809625_810483_-	hypothetical protein	NA	A0A2H4J418	uncultured_Caudovirales_phage	48.0	1.2e-68
WP_155122486.1|810634_811300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059759481.1|811531_812014_+	hypothetical protein	NA	Q6JII1	Burkholderia_virus	52.7	1.8e-34
WP_059759362.1|812288_812585_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155122487.1|812784_813306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155122488.1|813341_813635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059759372.1|814415_814754_+	hypothetical protein	NA	A4JX41	Burkholderia_virus	83.0	1.6e-45
WP_059759375.1|814801_815002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059759378.1|815375_815843_-	helix-turn-helix transcriptional regulator	NA	Q3HQY7	Burkholderia_phage	84.5	1.3e-69
WP_059759381.1|815901_816108_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_059490741.1|816303_816558_-	hypothetical protein	NA	Q8W6P6	Burkholderia_virus	59.5	5.2e-20
WP_059490742.1|816714_817092_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_059759384.1|817088_817277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155122489.1|817372_817546_+	hypothetical protein	NA	Q3HQZ4	Burkholderia_phage	77.8	8.4e-06
WP_059759387.1|817556_818411_+	hypothetical protein	NA	C7BGF1	Burkholderia_phage	56.2	7.5e-71
WP_080410202.1|819010_819508_+	hypothetical protein	NA	Q8W6P0	Burkholderia_virus	70.6	4.1e-61
WP_088502546.1|819708_820068_+	DUF1064 domain-containing protein	NA	Q8W6N9	Burkholderia_virus	62.2	1.5e-28
WP_060015136.1|820067_820400_+	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_059759394.1|820396_820840_+	DUF1364 family protein	NA	Q3HR02	Burkholderia_phage	86.4	1.9e-73
WP_080410196.1|820836_821175_+	hypothetical protein	NA	Q3HR03	Burkholderia_phage	85.7	8.3e-50
WP_059759398.1|821171_821420_+	hypothetical protein	NA	Q3HR04	Burkholderia_phage	65.9	4.3e-27
WP_059759486.1|821465_821885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155122490.1|821947_822697_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059759405.1|822897_823110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080410197.1|823260_823659_+	HNH endonuclease	NA	Q3HR06	Burkholderia_phage	80.5	4.1e-56
WP_059490752.1|823754_824234_+|terminase	terminase small subunit	terminase	Q3HQS6	Burkholderia_phage	85.5	1.3e-61
WP_059759408.1|824233_825946_+|terminase	terminase large subunit	terminase	Q3HQS7	Burkholderia_phage	94.4	0.0e+00
WP_059759411.1|825953_827249_+|portal	phage portal protein	portal	Q3HQS8	Burkholderia_phage	84.0	2.6e-208
WP_059759413.1|827226_828066_+|protease	Clp protease ClpP	protease	Q3HQS9	Burkholderia_phage	85.7	6.5e-128
WP_059759416.1|828070_829348_+|capsid	phage major capsid protein	capsid	Q3HQT0	Burkholderia_phage	81.1	1.5e-195
WP_059759419.1|829592_829934_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q3HQT2	Burkholderia_phage	80.5	6.4e-42
WP_059490926.1|829936_830266_+|head	phage head closure protein	head	Q8W6U2	Burkholderia_virus	78.7	7.9e-45
WP_059714961.1|830258_830681_+	HK97 gp10 family phage protein	NA	C7BGH3	Burkholderia_phage	85.5	6.1e-58
WP_059714959.1|830677_831022_+	DUF3168 domain-containing protein	NA	Q3HQT5	Burkholderia_phage	77.2	1.1e-41
WP_059759422.1|831077_831533_+	hypothetical protein	NA	Q3HQT6	Burkholderia_phage	87.3	1.1e-68
WP_059759425.1|831560_832028_+|tail	phage tail protein	tail	C7BGC7	Burkholderia_phage	65.5	5.4e-47
WP_059759428.1|832024_832309_+	DUF4035 domain-containing protein	NA	Q3HQT8	Burkholderia_phage	78.7	8.3e-35
WP_059759432.1|832321_836425_+|tail	phage tail tape measure protein	tail	C7BGC8	Burkholderia_phage	71.2	0.0e+00
WP_059759489.1|836424_836763_+|tail	phage tail protein	tail	Q3HQU0	Burkholderia_phage	79.5	4.6e-48
WP_069240742.1|836771_838082_+|tail	tail fiber domain-containing protein	tail	A0A0A1I5W1	Burkholderia_phage	53.9	8.9e-15
WP_059761334.1|838166_838850_+|tail	phage minor tail protein L	tail	Q6JIL5	Burkholderia_virus	82.8	2.6e-114
WP_059761333.1|838898_839651_+	C40 family peptidase	NA	Q3HQU3	Burkholderia_phage	79.4	1.1e-121
WP_059761332.1|839647_840229_+|tail	tail assembly protein	tail	Q8W6T1	Burkholderia_virus	81.3	4.6e-80
WP_080410293.1|843524_843839_+	hypothetical protein	NA	Q3HQU6	Burkholderia_phage	88.2	7.2e-48
WP_059761331.1|843838_844558_+	hypothetical protein	NA	A4JX18	Burkholderia_virus	73.6	1.9e-99
WP_059761330.1|844613_844898_+|holin	holin	holin	C7BGD7	Burkholderia_phage	90.4	1.9e-39
WP_059761329.1|844900_845320_+	glycoside hydrolase family protein	NA	A0A1Q1PW74	Pseudoalteromonas_phage	43.5	1.2e-21
WP_059761328.1|845316_845808_+	DUF2514 family protein	NA	Q6J1Q4	Burkholderia_virus	63.9	1.1e-39
WP_059761327.1|845864_846668_+	hypothetical protein	NA	Q3HQV2	Burkholderia_phage	41.0	5.4e-47
848518:848545	attR	GCGGGTTCGAACCCCGCCGGGCCCACCA	NA	NA	NA	NA
>prophage 2
NZ_CP013416	Burkholderia ubonensis strain MSMB2035 chromosome 2, complete sequence	3000610	2203823	2259754	3000610	terminase,transposase,capsid,head,protease,integrase,tail	Ralstonia_phage(35.48%)	62	2200498:2200512	2212890:2212904
2200498:2200512	attL	GGCAAGCGCGGGCGC	NA	NA	NA	NA
WP_059748968.1|2203823_2205275_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_059748969.1|2205353_2205899_+	lysozyme	NA	A0A0A1I5L5	Burkholderia_phage	45.3	4.1e-30
WP_059749003.1|2206110_2206368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059748971.1|2206613_2206823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080409817.1|2206921_2207611_-	hypothetical protein	NA	Q3HQV2	Burkholderia_phage	55.6	2.6e-66
WP_059748973.1|2207832_2210142_-	DNA-dependent RNA polymerase	NA	A0A2R2ZGE5	Ralstonia_phage	32.4	6.3e-80
WP_059748974.1|2211253_2211445_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069240679.1|2211623_2213189_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	34.4	4.4e-69
2212890:2212904	attR	GCGCCCGCGCTTGCC	NA	NA	NA	NA
WP_034190888.1|2213220_2213571_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	39.4	2.5e-17
WP_063801159.1|2213546_2214023_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_146750691.1|2214376_2214724_-	hypothetical protein	NA	A0A291LAS9	Bordetella_phage	64.6	9.2e-36
WP_059748695.1|2215002_2215227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059748694.1|2215350_2215941_-	DNA polymerase III subunit beta	NA	A0A1L7DQD4	Ralstonia_phage	41.8	1.1e-25
WP_059748693.1|2215950_2216742_-	RNase H superfamily protein	NA	A0A2P0VPF6	Ralstonia_phage	65.8	2.3e-98
WP_088510496.1|2216738_2217113_-	hypothetical protein	NA	A0A1L7DQG2	Ralstonia_phage	58.3	1.9e-23
WP_059748692.1|2217128_2217638_-	HNH endonuclease	NA	A0A1V0DYL4	Citrobacter_phage	48.5	6.7e-35
WP_059748698.1|2217606_2218323_-	hypothetical protein	NA	A0A068Q5R1	Ralstonia_phage	55.7	1.4e-67
WP_059748691.1|2218541_2219372_-	hypothetical protein	NA	A0A068Q6Y4	Ralstonia_phage	54.1	4.4e-68
WP_059748697.1|2219392_2221732_-	DNA polymerase A family protein	NA	A0A068Q7T8	Ralstonia_phage	65.1	4.6e-296
WP_059748690.1|2221778_2222333_-	hypothetical protein	NA	A0A2D1GNL9	Pseudomonas_phage	50.0	1.7e-39
WP_059748689.1|2222329_2223283_-	ATP-dependent DNA ligase	NA	A0A2D2W2E5	Stenotrophomonas_phage	47.3	2.0e-64
WP_059748688.1|2223574_2223871_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155122517.1|2223867_2224008_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059748687.1|2224004_2225300_-	AAA family ATPase	NA	A0A068Q6G7	Ralstonia_phage	60.2	3.4e-152
WP_059748686.1|2225315_2225702_-	hypothetical protein	NA	A0A0X8WNX5	Ralstonia_phage	60.8	2.2e-30
WP_059748685.1|2225698_2226256_-	DNA primase	NA	A0A077KVN4	Ralstonia_phage	55.6	2.9e-47
WP_059748684.1|2226534_2226741_-	transmembrane Fragile-X-F family protein	NA	NA	NA	NA	NA
WP_059748683.1|2226737_2227025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155122518.1|2227034_2227202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059748682.1|2227198_2227585_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059748696.1|2227949_2228204_-	hypothetical protein	NA	B5BTU9	Ralstonia_phage	68.6	8.0e-21
WP_059748679.1|2229752_2229986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080409797.1|2230670_2231840_+	helix-turn-helix transcriptional regulator	NA	L7P7S1	Pseudomonas_phage	32.4	3.9e-22
WP_155122519.1|2232094_2232520_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155122520.1|2233634_2234042_+	TerS protein	NA	A0A0F7L441	uncultured_marine_virus	54.1	8.8e-30
WP_059748676.1|2234038_2235628_+|terminase	terminase large subunit	terminase	F1C585	Cronobacter_phage	64.1	7.9e-183
WP_080409801.1|2235590_2236229_+	peptidase U35	NA	A0A0R6PGI7	Moraxella_phage	48.7	1.5e-31
WP_059748675.1|2236242_2237577_+|capsid	phage major capsid protein	capsid	S4TNE3	Salmonella_phage	41.4	1.4e-79
WP_155122521.1|2237636_2237813_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059748673.1|2239145_2239436_+|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_080409800.1|2239468_2239807_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_059748672.1|2239799_2240156_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_004526590.1|2240155_2240593_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059748671.1|2240741_2241077_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155122522.1|2241097_2241445_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080409750.1|2241407_2241851_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059748670.1|2241834_2244648_+|tail	phage tail protein	tail	C7BGC8	Burkholderia_phage	25.2	2.4e-09
WP_059748669.1|2244644_2244989_+|tail	phage tail protein	tail	Q8W6T5	Burkholderia_virus	42.6	1.2e-16
WP_155122523.1|2244992_2246300_+	hypothetical protein	NA	A0A0A1I5W1	Burkholderia_phage	53.9	8.9e-15
WP_080409840.1|2246290_2246971_+|tail	phage minor tail protein L	tail	A4JX13	Burkholderia_virus	53.1	8.0e-60
WP_080409839.1|2246967_2247699_+	C40 family peptidase	NA	Q8W6T2	Burkholderia_virus	58.0	2.4e-78
WP_155122543.1|2247717_2248278_+|tail	tail assembly protein	tail	Q6JIL3	Burkholderia_virus	54.5	1.5e-48
WP_059749345.1|2248274_2251676_+	host specificity protein J	NA	Q3HQU5	Burkholderia_phage	57.1	0.0e+00
WP_059749344.1|2252715_2252985_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059749343.1|2252984_2253305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059749341.1|2253648_2254563_+	glutaminase	NA	NA	NA	NA	NA
WP_155122524.1|2254699_2255317_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155122525.1|2255624_2256023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155122526.1|2256177_2256330_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059749357.1|2256349_2257801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080409841.1|2258127_2258772_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_059749338.1|2258815_2259754_-|protease	serine protease	protease	NA	NA	NA	NA
>prophage 3
NZ_CP013416	Burkholderia ubonensis strain MSMB2035 chromosome 2, complete sequence	3000610	2303809	2366410	3000610	transposase,holin	Planktothrix_phage(33.33%)	59	NA	NA
WP_059749309.1|2303809_2304829_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_059749308.1|2305114_2305609_+	vanillate O-demethylase oxidoreductase VanB	NA	NA	NA	NA	NA
WP_059749307.1|2305694_2306240_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059749306.1|2306992_2307595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059749350.1|2308703_2309624_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_059749349.1|2309693_2310062_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_059749303.1|2310158_2310632_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_059749302.1|2310687_2311515_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080409835.1|2311527_2311920_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	38.0	2.7e-07
WP_010089867.1|2312002_2312704_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.0	7.3e-16
WP_059609647.1|2312703_2313477_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	29.2	2.9e-13
WP_059665207.1|2313473_2314745_-	high-affinity branched-chain amino acid ABC transporter permease LivM	NA	NA	NA	NA	NA
WP_059609649.1|2314756_2315683_-	high-affinity branched-chain amino acid ABC transporter permease LivH	NA	NA	NA	NA	NA
WP_059749348.1|2315853_2316975_-	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_063801125.1|2317836_2318442_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059749299.1|2318441_2319041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059749298.1|2319057_2319597_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059749297.1|2319895_2320525_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059749295.1|2322324_2322834_-	OmpA family protein	NA	NA	NA	NA	NA
WP_059749294.1|2322921_2324190_-	diguanylate cyclase	NA	NA	NA	NA	NA
WP_059749293.1|2324186_2324888_-	YfiR family protein	NA	NA	NA	NA	NA
WP_059749292.1|2325341_2326517_+	class C beta-lactamase	NA	NA	NA	NA	NA
WP_059749291.1|2326565_2327279_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059749290.1|2327404_2327983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080486051.1|2328487_2329510_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.6	4.5e-46
WP_080486059.1|2329942_2331178_+|transposase	IS3 family transposase	transposase	A0A1B0Z042	Pseudomonas_phage	63.3	5.5e-99
WP_059753563.1|2331469_2332711_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_155122527.1|2332826_2333264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088510600.1|2333257_2333872_-	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_080410051.1|2333872_2334355_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_059753558.1|2334821_2335580_-	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_059753556.1|2335686_2336559_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_042588448.1|2336589_2337531_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_059753659.1|2337571_2338609_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_059753552.1|2338630_2340187_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.3	5.4e-19
WP_059753548.1|2340222_2340999_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_059753544.1|2341038_2342316_-	L-fuconate dehydratase	NA	NA	NA	NA	NA
WP_059718882.1|2342362_2343205_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_059753540.1|2343245_2344010_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_059753536.1|2344603_2344894_+	DUF3331 domain-containing protein	NA	NA	NA	NA	NA
WP_059753656.1|2345032_2346028_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_059753533.1|2346243_2346546_+	DUF4148 domain-containing protein	NA	NA	NA	NA	NA
WP_059753530.1|2346709_2347897_-	DUF971 domain-containing protein	NA	NA	NA	NA	NA
WP_059753527.1|2347919_2348843_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_059753523.1|2348858_2349353_-	4-hydroxybenzoyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_042588458.1|2349355_2350321_-	L-carnitine dehydrogenase	NA	NA	NA	NA	NA
WP_059753520.1|2350400_2351330_-	3-keto-5-aminohexanoate cleavage protein	NA	NA	NA	NA	NA
WP_059753652.1|2351397_2352351_-|holin	choline ABC transporter substrate-binding protein	holin	NA	NA	NA	NA
WP_059753517.1|2353024_2353981_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059753513.1|2354035_2355070_+	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_059753510.1|2355310_2356255_+	GlxA family transcriptional regulator	NA	NA	NA	NA	NA
WP_059753507.1|2356766_2358479_+	peptidase	NA	NA	NA	NA	NA
WP_059753504.1|2358559_2359801_+	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_042588463.1|2359936_2360302_+	YbjQ family protein	NA	NA	NA	NA	NA
WP_059753500.1|2360346_2361219_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_059753649.1|2361350_2361983_+	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_059753496.1|2362476_2363619_-	porin	NA	NA	NA	NA	NA
WP_059753492.1|2363865_2364837_-|holin	choline ABC transporter substrate-binding protein	holin	NA	NA	NA	NA
WP_059753489.1|2364874_2366410_-|holin	choline-sulfatase	holin	NA	NA	NA	NA
>prophage 1
NZ_CP013415	Burkholderia ubonensis strain MSMB2035 plasmid pMSMB2035, complete sequence	299296	0	2188	299296		Rhizobium_phage(50.0%)	3	NA	NA
WP_069240717.1|354_735_+	hypothetical protein	NA	R9TN97	Rhizobium_phage	68.6	7.7e-20
WP_059673161.1|737_1091_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080410100.1|1087_2188_+	phage Gp37/Gp68 family protein	NA	Q6JIJ3	Burkholderia_virus	47.8	3.6e-78
>prophage 2
NZ_CP013415	Burkholderia ubonensis strain MSMB2035 plasmid pMSMB2035, complete sequence	299296	18039	18672	299296		Burkholderia_virus(100.0%)	1	NA	NA
WP_080410102.1|18039_18672_-	DUF159 family protein	NA	Q8W6R8	Burkholderia_virus	71.1	1.7e-80
>prophage 3
NZ_CP013415	Burkholderia ubonensis strain MSMB2035 plasmid pMSMB2035, complete sequence	299296	23850	26591	299296		Escherichia_phage(66.67%)	3	NA	NA
WP_059714374.1|23850_24546_-	ParA family protein	NA	A0A0M3ULE3	Mycobacterium_phage	32.8	3.1e-14
WP_059673144.1|26001_26271_+	type II toxin-antitoxin system ParD family antitoxin	NA	A0A0N7C055	Escherichia_phage	57.1	5.3e-15
WP_059755323.1|26276_26591_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2R2Z2Y1	Escherichia_phage	38.8	8.1e-15
>prophage 4
NZ_CP013415	Burkholderia ubonensis strain MSMB2035 plasmid pMSMB2035, complete sequence	299296	31937	125763	299296	protease,transposase,integrase	Stx2-converting_phage(13.33%)	71	35164:35180	117739:117755
WP_088506841.1|31937_33118_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	42.1	4.8e-60
WP_080410104.1|34427_35645_-	porin	NA	NA	NA	NA	NA
35164:35180	attL	TCGCCGGGATGAGCGGC	NA	NA	NA	NA
WP_059755228.1|35892_36597_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_059755231.1|36602_37877_-	glucarate dehydratase	NA	NA	NA	NA	NA
WP_063801202.1|38323_39616_+	carbohydrate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_059755233.1|39692_40670_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_059755236.1|40669_41722_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_059755238.1|41742_42792_+	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G3M9Y6	Bacillus_virus	31.9	1.4e-23
WP_059755242.1|42788_44915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059755245.1|45024_45882_+	NAD(P)-dependent oxidoreductase	NA	A0A1V0SKV4	Klosneuvirus	28.1	2.9e-06
WP_063801207.1|45907_46870_+	aldose 1-epimerase	NA	NA	NA	NA	NA
WP_059755251.1|49589_50255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080410105.1|50327_50912_-	DUF945 domain-containing protein	NA	A0A2C9CYF8	Yersinia_phage	38.6	6.1e-24
WP_059755254.1|51002_52292_-|integrase	tyrosine-type recombinase/integrase	integrase	G8I6R6	Mycobacterium_virus	26.3	1.1e-06
WP_059755260.1|52402_53440_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_155122428.1|53492_54230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155122429.1|54302_54791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059755266.1|56219_56798_+	DUF4337 domain-containing protein	NA	NA	NA	NA	NA
WP_088510507.1|57295_58416_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.9	2.4e-45
WP_059750474.1|59080_59830_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	60.4	5.9e-80
WP_069240720.1|62650_62920_+	flagellar biosynthetic protein FliQ	NA	NA	NA	NA	NA
WP_063801150.1|62920_63682_+	flagellar biosynthetic protein FliR	NA	NA	NA	NA	NA
WP_080409928.1|63678_64749_+	EscU/YscU/HrcU family type III secretion system export apparatus switch protein	NA	NA	NA	NA	NA
WP_059750477.1|64745_66779_+	FHIPEP family type III secretion protein	NA	NA	NA	NA	NA
WP_080409929.1|66838_67564_+	flagellar hook-basal body complex protein	NA	NA	NA	NA	NA
WP_063801151.1|67560_68346_+	flagellar hook-basal body protein	NA	NA	NA	NA	NA
WP_080409930.1|68354_69071_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080409931.1|69067_69652_+	flagellar basal body L-ring protein FlgH	NA	NA	NA	NA	NA
WP_088510555.1|69633_70755_+	flagellar basal body P-ring protein FlgI	NA	NA	NA	NA	NA
WP_059750480.1|70760_71111_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059750481.1|71111_71540_+	flagellar basal body rod protein FlgC	NA	NA	NA	NA	NA
WP_088510557.1|71548_71839_+	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
WP_059750483.1|71847_73266_+	flagellar M-ring protein FliF	NA	NA	NA	NA	NA
WP_155122430.1|73258_73729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155122431.1|73683_74442_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063801152.1|74438_75743_+	FliI/YscN family ATPase	NA	NA	NA	NA	NA
WP_059750485.1|75757_76204_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155122432.1|76190_76898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059750487.1|76897_77296_+	flagellar hook capping protein	NA	NA	NA	NA	NA
WP_063801153.1|77305_78490_+	flagellar hook-basal body complex protein	NA	NA	NA	NA	NA
WP_155122433.1|78804_79578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155122434.1|79622_79964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080409935.1|80038_80752_+	flagellar type III secretion system pore protein FliP	NA	NA	NA	NA	NA
WP_080409934.1|80726_81491_+	sigma-70 family RNA polymerase sigma factor	NA	A0A0Y0AU18	Bacillus_phage	23.7	2.6e-06
WP_059750492.1|81517_82069_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_155122435.1|82158_82443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059750493.1|82529_83702_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_069240722.1|83894_98588_+	hypothetical protein	NA	A0A248XD62	Klebsiella_phage	29.3	2.7e-99
WP_059750495.1|98584_99175_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059750496.1|99194_99779_-	DUF4291 domain-containing protein	NA	NA	NA	NA	NA
WP_059750503.1|100477_102073_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	57.1	6.8e-134
WP_059726816.1|102103_102448_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	73.8	1.1e-41
WP_155122436.1|103199_103769_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_059749007.1|104035_105985_-	cation-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	28.5	7.2e-53
WP_059749006.1|105981_107025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059749008.1|107021_108059_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_059749005.1|108152_110048_-|protease	protease modulator HflK	protease	NA	NA	NA	NA
WP_059715634.1|111713_112919_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_059750505.1|113866_114730_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069240723.1|114749_115556_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_155122437.1|115646_115922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059756771.1|115918_116494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155122438.1|116726_117080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155122439.1|117092_117902_+	hypothetical protein	NA	NA	NA	NA	NA
117739:117755	attR	TCGCCGGGATGAGCGGC	NA	NA	NA	NA
WP_080410138.1|118485_119754_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	43.3	2.3e-39
WP_080410136.1|119835_120657_+|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	27.5	1.1e-07
WP_059756752.1|121029_122439_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_155122440.1|122502_122670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059756748.1|122673_124161_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_059724236.1|124589_124958_-	glyoxalase	NA	NA	NA	NA	NA
WP_059756745.1|125064_125763_+	YafY family transcriptional regulator	NA	A0A1B0RXM1	Streptococcus_phage	29.2	1.1e-14
>prophage 5
NZ_CP013415	Burkholderia ubonensis strain MSMB2035 plasmid pMSMB2035, complete sequence	299296	133727	136307	299296		Paenibacillus_phage(100.0%)	1	NA	NA
WP_080410134.1|133727_136307_-	hypothetical protein	NA	D0R7J2	Paenibacillus_phage	35.1	6.4e-41
>prophage 6
NZ_CP013415	Burkholderia ubonensis strain MSMB2035 plasmid pMSMB2035, complete sequence	299296	145368	154987	299296		Pandoravirus(25.0%)	5	NA	NA
WP_080410132.1|145368_146478_+	3-deoxy-7-phosphoheptulonate synthase	NA	S4W5F1	Pandoravirus	48.9	2.2e-83
WP_059724219.1|146831_147557_-	hypothetical protein	NA	A0A1I9KF49	Aeromonas_phage	26.1	3.0e-12
WP_069240726.1|149220_149883_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069240727.1|149957_152738_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	33.3	3.0e-84
WP_059760397.1|152758_154987_+	hypothetical protein	NA	A0A077K801	Ralstonia_phage	32.0	4.4e-38
>prophage 7
NZ_CP013415	Burkholderia ubonensis strain MSMB2035 plasmid pMSMB2035, complete sequence	299296	166054	169363	299296		Burkholderia_phage(50.0%)	3	NA	NA
WP_059760409.1|166054_166333_-	HU family DNA-binding protein	NA	Q6QIE5	Burkholderia_phage	58.4	1.8e-18
WP_071750864.1|166696_167614_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059760413.1|168205_169363_+	DUF1016 domain-containing protein	NA	A0A0U2BZN7	Salmonella_phage	65.1	1.9e-53
>prophage 8
NZ_CP013415	Burkholderia ubonensis strain MSMB2035 plasmid pMSMB2035, complete sequence	299296	177488	178274	299296		Planktothrix_phage(100.0%)	1	NA	NA
WP_059755491.1|177488_178274_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	6.1e-19
>prophage 9
NZ_CP013415	Burkholderia ubonensis strain MSMB2035 plasmid pMSMB2035, complete sequence	299296	181935	222087	299296	transposase	Leptospira_phage(50.0%)	30	NA	NA
WP_063801159.1|181935_182412_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_034190888.1|182387_182738_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	39.4	2.5e-17
WP_069240679.1|182769_184335_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	34.4	4.4e-69
WP_059754025.1|184513_184744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059754036.1|184691_185099_+|transposase	transposase	transposase	A0A0P0ZBP6	Stx2-converting_phage	45.6	6.4e-12
WP_034184982.1|185095_185443_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	72.9	1.6e-40
WP_059754028.1|185520_187035_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	55.2	9.0e-152
WP_059754033.1|187031_187397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155122445.1|189267_191574_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_080409794.1|191691_192096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080409785.1|192435_193269_-	molecular chaperone	NA	NA	NA	NA	NA
WP_080409786.1|193268_195890_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_080409787.1|195962_196742_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_155122446.1|196835_197375_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155122447.1|197480_198020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080409788.1|198083_199502_-	fimbrial protein	NA	NA	NA	NA	NA
WP_080409789.1|199775_200108_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_080409790.1|200253_200883_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_155122448.1|202926_203310_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059748663.1|203404_205039_-	GMC family oxidoreductase	NA	NA	NA	NA	NA
WP_155122449.1|205709_208457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059748664.1|208942_209338_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_080409792.1|212766_213756_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_088510507.1|214964_216085_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.9	2.4e-45
WP_088510619.1|216186_217306_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.5	1.6e-49
WP_080410106.1|217376_218234_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_059755015.1|218479_218851_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	30.7	1.3e-06
WP_155122450.1|218847_219012_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059755018.1|219298_220318_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_059755021.1|220596_222087_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
>prophage 10
NZ_CP013415	Burkholderia ubonensis strain MSMB2035 plasmid pMSMB2035, complete sequence	299296	241450	251356	299296		Pseudomonas_virus(20.0%)	10	NA	NA
WP_059755054.1|241450_243412_+	DNA cytosine methyltransferase	NA	Q9ZXI4	Pseudomonas_virus	63.9	1.3e-190
WP_059755056.1|243471_243792_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059755059.1|244392_245220_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.4	7.3e-47
WP_059755062.1|245288_245954_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059755291.1|246012_246486_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059755064.1|246901_247543_+	DNA methylase	NA	A0A2K9VH43	Faecalibacterium_phage	41.8	1.0e-32
WP_042585090.1|247576_248086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143135103.1|248143_248314_+	PQQ-dependent sugar dehydrogenase	NA	NA	NA	NA	NA
WP_059755068.1|248310_248505_+	hypothetical protein	NA	A0A1B0RXC3	Streptococcus_phage	58.3	1.2e-08
WP_059755071.1|249268_251356_+	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	29.1	4.6e-21
>prophage 11
NZ_CP013415	Burkholderia ubonensis strain MSMB2035 plasmid pMSMB2035, complete sequence	299296	259657	266059	299296		Klebsiella_phage(50.0%)	4	NA	NA
WP_059755088.1|259657_262480_+	relaxase domain-containing protein	NA	A0A159B7W8	Klebsiella_phage	27.6	3.5e-08
WP_059755091.1|262598_263606_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_059755094.1|263608_264037_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_059755096.1|264163_266059_+	ABC transporter permease subunit	NA	Q6GZ02	Mycoplasma_phage	23.2	9.9e-07
>prophage 12
NZ_CP013415	Burkholderia ubonensis strain MSMB2035 plasmid pMSMB2035, complete sequence	299296	288020	293299	299296		Burkholderia_virus(40.0%)	7	NA	NA
WP_059755134.1|288020_289073_+	site-specific DNA-methyltransferase	NA	Q8W6P4	Burkholderia_virus	61.9	2.0e-121
WP_059755136.1|290056_290557_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088510618.1|290657_290969_+	hypothetical protein	NA	A0A1V0E8G7	Vibrio_phage	61.1	2.2e-28
WP_059755144.1|290965_291391_+	HNH endonuclease	NA	Q3HQV7	Burkholderia_phage	72.1	2.8e-55
WP_059755149.1|291387_291846_+	hypothetical protein	NA	R9TN97	Rhizobium_phage	68.6	9.3e-20
WP_059673161.1|291848_292202_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080410100.1|292198_293299_+	phage Gp37/Gp68 family protein	NA	Q6JIJ3	Burkholderia_virus	47.8	3.6e-78
