The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP013430	Burkholderia multivorans strain AU1185 isolate AU1185 chromosome 1, complete sequence	3525707	162258	215666	3525707	integrase,transposase	Escherichia_phage(23.08%)	43	149344:149360	169337:169353
149344:149360	attL	GGATGATGCCGGCCGCG	NA	NA	NA	NA
WP_069219851.1|162258_163287_+|integrase	site-specific integrase	integrase	A0A1S6L1B6	Ralstonia_phage	36.3	1.2e-46
WP_069219852.1|165153_166686_+	site-specific DNA-methyltransferase	NA	A0A220NUF4	Escherichia_phage	37.1	3.8e-57
WP_069219853.1|166694_169391_+	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
169337:169353	attR	GGATGATGCCGGCCGCG	NA	NA	NA	NA
WP_081336697.1|169609_170404_-	replication initiation protein	NA	NA	NA	NA	NA
WP_006405053.1|170472_171483_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	50.0	6.3e-85
WP_006402507.1|171482_172289_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	57.5	4.6e-78
WP_172820289.1|172408_172519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155770725.1|172907_173363_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069219854.1|173359_174574_-	ThiF family adenylyltransferase	NA	NA	NA	NA	NA
WP_034192959.1|174548_174824_-	multiubiquitin domain-containing protein	NA	NA	NA	NA	NA
WP_034192958.1|174997_175336_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_069219855.1|175322_176123_+	ImmA/IrrE family metallo-endopeptidase	NA	Q854W5	Mycobacterium_virus	33.1	6.7e-05
WP_105762551.1|176732_177852_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.9	1.6e-49
WP_069219858.1|178273_179374_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_069219859.1|179420_180314_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_069219860.1|180306_181194_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_069219861.1|181190_181982_+	ABC transporter ATP-binding protein	NA	A0A2H4UU96	Bodo_saltans_virus	24.1	1.9e-07
WP_069219862.1|181978_182698_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	25.5	1.6e-10
WP_069219863.1|182753_183704_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_006397350.1|184068_184818_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	60.7	4.8e-82
WP_011875599.1|184834_186391_-|transposase	IS21-like element IS408 family transposase	transposase	K4I413	Acidithiobacillus_phage	55.1	1.4e-160
WP_069219864.1|186626_187922_+	MFS transporter	NA	NA	NA	NA	NA
WP_069219865.1|187966_189319_+	MFS transporter	NA	NA	NA	NA	NA
WP_081336700.1|189483_190404_+	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_081336701.1|190393_191434_+	phosphotransferase family protein	NA	NA	NA	NA	NA
WP_069219866.1|191433_191790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081336702.1|191792_193022_+	acyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_069219867.1|193024_196498_+	indolepyruvate ferredoxin oxidoreductase family protein	NA	NA	NA	NA	NA
WP_069219868.1|196520_197288_+	SDR family oxidoreductase	NA	A0A0M4JSW6	Mollivirus	25.7	1.8e-07
WP_069219869.1|197333_198515_+	beta-ketothiolase BktB	NA	NA	NA	NA	NA
WP_069219870.1|198607_199363_+	glucose 1-dehydrogenase	NA	NA	NA	NA	NA
WP_081336703.1|199552_200275_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_069219871.1|200739_201981_-	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_069219872.1|202230_202578_+	RidA family protein	NA	NA	NA	NA	NA
WP_069219873.1|202657_203443_+	aspartate/glutamate racemase family protein	NA	NA	NA	NA	NA
WP_105762551.1|203564_204684_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.9	1.6e-49
WP_034192955.1|204793_205147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165927445.1|206580_207261_+	hypothetical protein	NA	NA	NA	NA	NA
WP_131929085.1|207413_208145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072465429.1|208433_209651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072465427.1|209939_210227_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_069219876.1|210569_211955_-	TniQ family protein	NA	NA	NA	NA	NA
WP_105762551.1|214546_215666_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.9	1.6e-49
>prophage 2
NZ_CP013430	Burkholderia multivorans strain AU1185 isolate AU1185 chromosome 1, complete sequence	3525707	443912	483146	3525707	integrase,protease,transposase	Escherichia_phage(28.57%)	35	451530:451547	470283:470300
WP_006406974.1|443912_444434_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	53.0	7.4e-21
WP_069219923.1|444726_445647_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059937846.1|445654_446704_+|integrase	site-specific integrase	integrase	A0A1L7DQ84	Ralstonia_phage	38.2	8.1e-51
WP_081068816.1|446986_447223_+	plasmid-related protein	NA	NA	NA	NA	NA
WP_069219924.1|447219_447846_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_172820292.1|448044_448323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069219925.1|448345_449299_+	type IV secretion system protein	NA	NA	NA	NA	NA
WP_069219926.1|449332_449614_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172820293.1|450197_450665_+	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
WP_155770726.1|450651_450807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069219928.1|450875_451202_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_069219929.1|451350_452346_+	ATP-binding protein	NA	A0A2H4UTU5	Bodo_saltans_virus	28.1	8.6e-10
451530:451547	attL	CGTGCCGGAAGCCGACCG	NA	NA	NA	NA
WP_069219930.1|452357_455045_+	S8 family peptidase	NA	NA	NA	NA	NA
WP_146125202.1|455111_455627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069219932.1|456238_457456_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	43.3	2.3e-89
WP_069219933.1|458071_460933_-	DUF927 domain-containing protein	NA	A0A1B0VP75	Pseudomonas_phage	35.6	8.6e-71
WP_069219934.1|461060_461387_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069219935.1|461397_461742_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146125166.1|461738_461984_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172820294.1|462262_462439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069219936.1|462766_463291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081056539.1|463287_463479_-	AlpA family phage regulatory protein	NA	A0A2L0V109	Agrobacterium_phage	47.2	1.1e-06
WP_124637671.1|464136_464895_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105810582.1|464953_465697_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081336708.1|466109_466694_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069220683.1|467118_468549_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069219939.1|468964_469540_+	recombinase family protein	NA	A0A219Y912	Aeromonas_phage	43.2	8.4e-26
WP_011875632.1|470510_471533_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	48.4	2.7e-83
470283:470300	attR	CGGTCGGCTTCCGGCACG	NA	NA	NA	NA
WP_006397377.1|471529_472315_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	58.8	3.1e-79
WP_069219941.1|474470_476804_+	SEC-C domain-containing protein	NA	NA	NA	NA	NA
WP_069219942.1|476884_478003_-	DUF3396 domain-containing protein	NA	E5E3X7	Burkholderia_phage	84.2	2.3e-181
WP_006405053.1|478350_479361_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	50.0	6.3e-85
WP_006402507.1|479360_480167_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	57.5	4.6e-78
WP_069219943.1|480843_481371_-	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	59.2	3.9e-54
WP_163013128.1|481948_483146_+|transposase	IS3 family transposase	transposase	A0A1B0Z042	Pseudomonas_phage	65.5	1.0e-102
>prophage 3
NZ_CP013430	Burkholderia multivorans strain AU1185 isolate AU1185 chromosome 1, complete sequence	3525707	494889	552075	3525707	plate,tail,tRNA,transposase	Acidithiobacillus_phage(28.57%)	45	NA	NA
WP_011875599.1|494889_496446_+|transposase	IS21-like element IS408 family transposase	transposase	K4I413	Acidithiobacillus_phage	55.1	1.4e-160
WP_006397350.1|496462_497212_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	60.7	4.8e-82
WP_146125203.1|497606_497984_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069219947.1|498025_499060_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_065494298.1|499459_499777_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006406963.1|499862_500645_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_006409507.1|500641_501988_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_006400550.1|502090_502690_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_006406961.1|503078_503711_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006406960.1|503746_504262_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_006400547.1|504277_505768_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_006400546.1|505839_506343_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_006406959.1|506405_506891_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_035946276.1|506969_508805_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_069219948.1|508768_509869_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_006409508.1|509913_512583_+	type VI secretion system ATPase TssH	NA	A0A223W0B1	Agrobacterium_phage	31.7	2.2e-89
WP_006409504.1|512621_513743_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_069219949.1|513811_516373_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	26.6	1.3e-57
WP_069219950.1|516372_517413_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_006406952.1|517771_518395_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_053297736.1|520179_521016_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_069219951.1|521008_523291_+	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_069219953.1|524292_525252_-	OmpA family protein	NA	NA	NA	NA	NA
WP_006400525.1|525256_526246_-	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
WP_069219954.1|526242_530172_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_006406946.1|530470_531316_-	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_069219955.1|531437_532424_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_069219956.1|532635_533664_+	transporter	NA	NA	NA	NA	NA
WP_006411754.1|533790_535962_-	peptidase M1	NA	A0A0P0IY26	Acinetobacter_phage	26.4	1.1e-49
WP_069219957.1|536605_537103_+	LEA type 2 family protein	NA	NA	NA	NA	NA
WP_069219958.1|537212_538346_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_069219959.1|538435_539326_+	methyltransferase	NA	NA	NA	NA	NA
WP_059937052.1|539376_539949_-	DUF1415 domain-containing protein	NA	NA	NA	NA	NA
WP_006400513.1|540004_540625_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_006406936.1|540837_542121_+	MFS transporter	NA	NA	NA	NA	NA
WP_006406934.1|542266_542872_+	nitroreductase family protein	NA	NA	NA	NA	NA
WP_035948474.1|543028_544279_+	Hsp70 family protein	NA	NA	NA	NA	NA
WP_006400508.1|544390_544594_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	71.6	1.4e-20
WP_006400506.1|545016_546615_+	APC family permease	NA	NA	NA	NA	NA
WP_006406932.1|546759_547551_-	dioxygenase	NA	NA	NA	NA	NA
WP_006400504.1|547769_548366_-	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
WP_006400503.1|548379_548691_-	Grx4 family monothiol glutaredoxin	NA	NA	NA	NA	NA
WP_012214221.1|548758_549601_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_006400499.1|549611_550694_-	peptide chain release factor 1	NA	A0A0S4KWG0	Pseudomonas_phage	44.8	8.7e-08
WP_006406930.1|550776_552075_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
>prophage 4
NZ_CP013430	Burkholderia multivorans strain AU1185 isolate AU1185 chromosome 1, complete sequence	3525707	813365	822335	3525707		Hokovirus(16.67%)	7	NA	NA
WP_006401601.1|813365_815312_+	molecular chaperone DnaK	NA	A0A1V0SH73	Hokovirus	51.2	2.7e-148
WP_053297605.1|815576_816707_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	39.0	2.8e-25
WP_069220001.1|816710_818573_+	aminodeoxychorismate synthase component I	NA	S4VT78	Pandoravirus	38.3	2.6e-60
WP_069220002.1|818676_819492_-	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	32.9	7.4e-36
WP_006401597.1|819538_820225_-	deoxynucleoside kinase	NA	S5MMC6	Bacillus_phage	28.9	3.3e-13
WP_006401596.1|820221_820761_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_006406404.1|820796_822335_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	30.7	6.1e-23
>prophage 5
NZ_CP013430	Burkholderia multivorans strain AU1185 isolate AU1185 chromosome 1, complete sequence	3525707	964926	1005198	3525707	plate,tRNA,transposase	Escherichia_phage(33.33%)	38	NA	NA
WP_006406296.1|964926_965691_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_069220050.1|966075_967125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155770730.1|967639_968209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163013128.1|968211_969410_-|transposase	IS3 family transposase	transposase	A0A1B0Z042	Pseudomonas_phage	65.5	1.0e-102
WP_172820296.1|969457_970141_-	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_048996627.1|970262_970493_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048996625.1|970496_970895_-	helix-turn-helix transcriptional regulator	NA	R9W020	Paenibacillus_phage	38.3	4.3e-05
WP_006411716.1|971068_971548_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_006400871.1|971630_971876_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_105774423.1|972055_972700_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105800266.1|973979_975103_-|transposase	IS3-like element ISBvi7 family transposase	transposase	S5WIU1	Leptospira_phage	40.7	5.4e-45
WP_006402507.1|975373_976180_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	57.5	4.6e-78
WP_006405053.1|976179_977190_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	50.0	6.3e-85
WP_027350538.1|979176_979545_+	DUF3817 domain-containing protein	NA	NA	NA	NA	NA
WP_077181385.1|979547_979970_+	CopD family protein	NA	NA	NA	NA	NA
WP_006397377.1|980130_980916_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	58.8	3.1e-79
WP_011875632.1|980912_981935_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	48.4	2.7e-83
WP_012492785.1|982034_982937_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012492784.1|983504_984296_-	DsbA family protein	NA	NA	NA	NA	NA
WP_102896113.1|986581_988531_-	hypothetical protein	NA	A0A1L7N0M1	Ralstonia_phage	37.2	2.5e-66
WP_069220051.1|988527_990537_-	acyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	40.9	9.0e-83
WP_012492782.1|990737_991067_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012492781.1|991378_991930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_127837584.1|992132_992402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006486517.1|992601_993240_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012492779.1|993241_993541_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006486559.1|993643_994450_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_006486492.1|994515_995643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006486561.1|995639_996554_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006486507.1|996605_996821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006486515.1|996832_997828_-	YqaJ viral recombinase family protein	NA	A6XMH8	Bacillus_virus	40.8	2.5e-57
WP_041494520.1|997898_998099_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006486525.1|998095_999064_-	DUF932 domain-containing protein	NA	A0A0H4INH5	Stenotrophomonas_phage	43.6	2.0e-59
WP_077181108.1|999181_999439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006401211.1|1000619_1001879_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.0	3.9e-44
WP_053299177.1|1002696_1003077_+	DUF3592 domain-containing protein	NA	NA	NA	NA	NA
WP_012492775.1|1003098_1003671_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081336764.1|1003677_1005198_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
>prophage 6
NZ_CP013430	Burkholderia multivorans strain AU1185 isolate AU1185 chromosome 1, complete sequence	3525707	2020782	2063494	3525707	integrase,protease,capsid	Burkholderia_phage(58.7%)	61	2012642:2012660	2068425:2068443
2012642:2012660	attL	CGACTTCCTGCGCGACGAA	NA	NA	NA	NA
WP_069220285.1|2020782_2021814_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B1P9F9	Acinetobacter_phage	38.8	4.8e-56
WP_069220286.1|2021774_2022287_-	DUF2514 family protein	NA	Q3HQV1	Burkholderia_phage	67.7	1.3e-41
WP_069220287.1|2022283_2022832_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069220288.1|2022828_2023326_-	lysozyme	NA	Q3HQU9	Burkholderia_phage	92.7	4.5e-84
WP_069220289.1|2023318_2023501_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069220290.1|2023629_2024214_+	acyltransferase	NA	NA	NA	NA	NA
WP_069220291.1|2024407_2025415_-	hypothetical protein	NA	A9YX14	Burkholderia_phage	38.9	4.1e-60
WP_069220292.1|2025481_2026144_-	DUF2612 domain-containing protein	NA	A9YX13	Burkholderia_phage	88.2	1.3e-110
WP_069220293.1|2026143_2027325_-	hypothetical protein	NA	A9YX12	Burkholderia_phage	93.6	3.4e-199
WP_069220294.1|2027321_2027675_-	hypothetical protein	NA	A9YX11	Burkholderia_phage	94.9	1.1e-55
WP_069220295.1|2027713_2028226_-	Rha family transcriptional regulator	NA	A0A192Y918	Salmonella_phage	49.5	5.9e-15
WP_069220296.1|2028365_2029115_-	hypothetical protein	NA	A9YX06	Burkholderia_phage	86.3	1.2e-117
WP_155770731.1|2029136_2029913_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069220297.1|2029909_2030899_-	hypothetical protein	NA	A9YX04	Burkholderia_phage	66.3	1.7e-106
WP_069220298.1|2030895_2031213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069220299.1|2031212_2031788_-	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	37.4	3.1e-20
WP_069220300.1|2031784_2033848_-	mannosyl-glycoprotein endo-beta-N-acetylglucosamidase	NA	A0A0M4REK7	Salmonella_phage	35.8	1.0e-36
WP_069220301.1|2034031_2034505_-	hypothetical protein	NA	A0A0N7IRF3	Acinetobacter_phage	40.9	8.7e-21
WP_069220302.1|2034507_2034948_-	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	58.9	6.8e-44
WP_069220303.1|2034962_2036438_-	DUF3383 domain-containing protein	NA	A0A0P0I492	Acinetobacter_phage	47.5	4.4e-111
WP_069220304.1|2036447_2037038_-	hypothetical protein	NA	A9YX29	Burkholderia_phage	92.3	6.2e-101
WP_069220305.1|2037042_2037414_-	hypothetical protein	NA	A9YX28	Burkholderia_phage	93.5	4.2e-63
WP_069220306.1|2037417_2037900_-	hypothetical protein	NA	A9YX26	Burkholderia_phage	88.1	5.0e-72
WP_069220307.1|2037928_2038312_-	DUF4054 domain-containing protein	NA	A9YX25	Burkholderia_phage	91.3	4.1e-61
WP_069220308.1|2038320_2038584_-	hypothetical protein	NA	A9YX24	Burkholderia_phage	74.0	5.2e-15
WP_069220309.1|2038585_2039623_-	DUF2184 domain-containing protein	NA	A0A0N7IRF2	Acinetobacter_phage	64.2	2.4e-116
WP_059594712.1|2039633_2040122_-	hypothetical protein	NA	A0A0P0I8F3	Acinetobacter_phage	56.8	1.9e-39
WP_069220310.1|2040134_2041436_-	DUF2213 domain-containing protein	NA	A9YX03	Burkholderia_phage	39.3	2.7e-48
WP_081336739.1|2041494_2042169_-	HNH endonuclease	NA	B4UTX2	Rhizobium_phage	32.2	4.0e-19
WP_081336740.1|2042275_2042953_-|capsid	minor capsid protein	capsid	A9YWZ8	Burkholderia_phage	68.1	1.2e-79
WP_081336741.1|2042846_2044433_-	DUF1073 domain-containing protein	NA	A0A0P0I486	Acinetobacter_phage	61.7	5.0e-153
WP_069220312.1|2044429_2046025_-	TerL protein	NA	A9YWZ6	Burkholderia_phage	90.2	1.9e-293
WP_069220313.1|2046026_2046506_-	DUF2280 domain-containing protein	NA	A9YWZ5	Burkholderia_phage	86.2	3.5e-70
WP_069220314.1|2046523_2047177_-	hypothetical protein	NA	A9YWZ4	Burkholderia_phage	85.9	7.9e-105
WP_043292150.1|2047247_2047427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069220315.1|2047551_2047983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069220316.1|2047979_2048309_-	hypothetical protein	NA	A9YWZ0	Burkholderia_phage	61.2	7.2e-22
WP_069220317.1|2048319_2048790_-	RusA family crossover junction endodeoxyribonuclease	NA	A9YWY9	Burkholderia_phage	80.1	1.2e-62
WP_069220318.1|2048786_2049047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069220319.1|2049043_2049790_-	hypothetical protein	NA	A0A2K8HNW6	Pseudomonas_phage	42.0	7.8e-24
WP_069220320.1|2049792_2050809_-	DUF1376 domain-containing protein	NA	H2BD69	Pseudomonas_phage	42.9	3.9e-34
WP_069220321.1|2050805_2051012_-	hypothetical protein	NA	A9YWY0	Burkholderia_phage	80.3	1.5e-25
WP_069220322.1|2051008_2051380_-	hypothetical protein	NA	A9YWX9	Burkholderia_phage	86.1	3.8e-56
WP_011881815.1|2051555_2051837_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069220323.1|2051847_2052102_-|protease	Clp protease	protease	NA	NA	NA	NA
WP_048995173.1|2052098_2052344_-	helix-turn-helix domain-containing protein	NA	A0A0M3LQ90	Mannheimia_phage	45.9	4.5e-13
WP_011881812.1|2052430_2052817_+	GP52 family protein	NA	A9YWX7	Burkholderia_phage	69.0	3.7e-09
WP_165487634.1|2053189_2053366_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006488862.1|2053366_2053750_+	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A222YZ88	Escherichia_phage	44.8	3.3e-18
WP_069220324.1|2054915_2055626_+	hypothetical protein	NA	Q3HQX1	Burkholderia_phage	90.3	1.1e-54
WP_069220325.1|2055668_2055962_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048996087.1|2055988_2056399_+	hypothetical protein	NA	A0A0X8WNX5	Ralstonia_phage	52.7	4.4e-29
WP_006403326.1|2057148_2057310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069220326.1|2057309_2058122_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	G8CLD3	Synechococcus_phage	40.8	2.1e-46
WP_069220327.1|2058127_2059180_+	recombinase RecT	NA	Q858E1	Salmonella_phage	48.3	1.8e-58
WP_069220328.1|2059240_2059987_+	site-specific DNA-methyltransferase	NA	O03956	Myxococcus_phage	49.3	1.8e-52
WP_069220330.1|2060765_2061179_+	hypothetical protein	NA	Q3HQW1	Burkholderia_phage	52.1	6.9e-06
WP_069220331.1|2061175_2061469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155770732.1|2061458_2061890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012467583.1|2061886_2062117_+	hypothetical protein	NA	A9YWU6	Burkholderia_phage	52.8	1.1e-13
WP_081336742.1|2063023_2063494_+	hypothetical protein	NA	Q3HQV8	Burkholderia_phage	60.9	8.9e-34
2068425:2068443	attR	TTCGTCGCGCAGGAAGTCG	NA	NA	NA	NA
>prophage 7
NZ_CP013430	Burkholderia multivorans strain AU1185 isolate AU1185 chromosome 1, complete sequence	3525707	2288161	2335184	3525707	plate,integrase,capsid,transposase	Burkholderia_phage(53.19%)	68	2306032:2306050	2337827:2337845
WP_069220402.1|2288161_2288641_-	DUF2514 family protein	NA	Q3HQV1	Burkholderia_phage	81.2	1.8e-53
WP_069220403.1|2288637_2289186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069220404.1|2289182_2289680_-	lysozyme	NA	Q3HQU9	Burkholderia_phage	90.9	7.9e-81
WP_069220405.1|2289672_2289855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069220290.1|2289983_2290568_+	acyltransferase	NA	NA	NA	NA	NA
WP_069220406.1|2290761_2291769_-	hypothetical protein	NA	A9YX14	Burkholderia_phage	38.9	5.4e-60
WP_069220407.1|2291835_2292498_-	DUF2612 domain-containing protein	NA	A9YX13	Burkholderia_phage	89.1	8.0e-113
WP_069220408.1|2292497_2293679_-|plate	baseplate J/gp47 family protein	plate	A9YX12	Burkholderia_phage	94.4	1.8e-200
WP_069220409.1|2293675_2294029_-	hypothetical protein	NA	A9YX11	Burkholderia_phage	95.7	1.6e-56
WP_069220410.1|2294067_2294562_-	Rha family transcriptional regulator	NA	A0A1D8EX53	Mycobacterium_phage	37.4	1.2e-12
WP_069220296.1|2294701_2295451_-	hypothetical protein	NA	A9YX06	Burkholderia_phage	86.3	1.2e-117
WP_155770731.1|2295472_2296249_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069220297.1|2296245_2297235_-	hypothetical protein	NA	A9YX04	Burkholderia_phage	66.3	1.7e-106
WP_069220298.1|2297231_2297549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069220299.1|2297548_2298124_-	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	37.4	3.1e-20
WP_069220411.1|2298120_2300184_-	mannosyl-glycoprotein endo-beta-N-acetylglucosamidase	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	30.3	3.7e-39
WP_069220412.1|2300367_2300925_-	hypothetical protein	NA	A0A0N7IRF3	Acinetobacter_phage	33.1	1.4e-17
WP_069220302.1|2300927_2301368_-	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	58.9	6.8e-44
WP_069220413.1|2301382_2302858_-	DUF3383 domain-containing protein	NA	A0A0P0I492	Acinetobacter_phage	47.0	6.3e-110
WP_069220414.1|2302867_2303461_-	hypothetical protein	NA	A9YX29	Burkholderia_phage	93.8	9.7e-102
WP_155770736.1|2303453_2303657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069220415.1|2303661_2304033_-	hypothetical protein	NA	A9YX28	Burkholderia_phage	97.6	1.6e-65
WP_069220416.1|2304094_2304574_-	hypothetical protein	NA	A9YX26	Burkholderia_phage	88.7	4.9e-72
WP_069220417.1|2304602_2304986_-	DUF4054 domain-containing protein	NA	A9YX25	Burkholderia_phage	92.1	5.3e-61
WP_069220418.1|2304994_2305267_-	hypothetical protein	NA	A9YX24	Burkholderia_phage	72.0	1.2e-14
WP_069220309.1|2305268_2306306_-	DUF2184 domain-containing protein	NA	A0A0N7IRF2	Acinetobacter_phage	64.2	2.4e-116
2306032:2306050	attL	GCGAACATCGAGTTCGTGA	NA	NA	NA	NA
WP_059594712.1|2306316_2306805_-	hypothetical protein	NA	A0A0P0I8F3	Acinetobacter_phage	56.8	1.9e-39
WP_069220310.1|2306817_2308119_-	DUF2213 domain-containing protein	NA	A9YX03	Burkholderia_phage	39.3	2.7e-48
WP_081336739.1|2308177_2308852_-	HNH endonuclease	NA	B4UTX2	Rhizobium_phage	32.2	4.0e-19
WP_081336740.1|2308958_2309636_-|capsid	minor capsid protein	capsid	A9YWZ8	Burkholderia_phage	68.1	1.2e-79
WP_081336741.1|2309529_2311116_-	DUF1073 domain-containing protein	NA	A0A0P0I486	Acinetobacter_phage	61.7	5.0e-153
WP_069220312.1|2311112_2312708_-	TerL protein	NA	A9YWZ6	Burkholderia_phage	90.2	1.9e-293
WP_069220313.1|2312709_2313189_-	DUF2280 domain-containing protein	NA	A9YWZ5	Burkholderia_phage	86.2	3.5e-70
WP_069220314.1|2313206_2313860_-	hypothetical protein	NA	A9YWZ4	Burkholderia_phage	85.9	7.9e-105
WP_043292150.1|2313930_2314110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069220315.1|2314234_2314666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069220316.1|2314662_2314992_-	hypothetical protein	NA	A9YWZ0	Burkholderia_phage	61.2	7.2e-22
WP_069220317.1|2315002_2315473_-	RusA family crossover junction endodeoxyribonuclease	NA	A9YWY9	Burkholderia_phage	80.1	1.2e-62
WP_069220318.1|2315469_2315730_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069220319.1|2315726_2316473_-	hypothetical protein	NA	A0A2K8HNW6	Pseudomonas_phage	42.0	7.8e-24
WP_069220320.1|2316475_2317492_-	DUF1376 domain-containing protein	NA	H2BD69	Pseudomonas_phage	42.9	3.9e-34
WP_069220321.1|2317488_2317695_-	hypothetical protein	NA	A9YWY0	Burkholderia_phage	80.3	1.5e-25
WP_069220322.1|2317691_2318063_-	hypothetical protein	NA	A9YWX9	Burkholderia_phage	86.1	3.8e-56
WP_069220419.1|2318229_2318466_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163013128.1|2318721_2319920_-|transposase	IS3 family transposase	transposase	A0A1B0Z042	Pseudomonas_phage	65.5	1.0e-102
WP_155770738.1|2320060_2320228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069220420.1|2320326_2320809_+	hypothetical protein	NA	A0A127KNL4	Pseudomonas_phage	40.0	5.9e-25
WP_069220421.1|2320977_2321214_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_069220422.1|2321286_2321685_+	helix-turn-helix transcriptional regulator	NA	A0A125RNS6	Pseudomonas_phage	53.0	4.9e-09
WP_006488905.1|2322042_2322219_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006488862.1|2322219_2322603_+	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A222YZ88	Escherichia_phage	44.8	3.3e-18
WP_155770739.1|2323398_2323581_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069220324.1|2324681_2325392_+	hypothetical protein	NA	Q3HQX1	Burkholderia_phage	90.3	1.1e-54
WP_069220325.1|2325434_2325728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048996087.1|2325754_2326165_+	hypothetical protein	NA	A0A0X8WNX5	Ralstonia_phage	52.7	4.4e-29
WP_006403326.1|2326914_2327076_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069220326.1|2327075_2327888_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	G8CLD3	Synechococcus_phage	40.8	2.1e-46
WP_069220327.1|2327893_2328946_+	recombinase RecT	NA	Q858E1	Salmonella_phage	48.3	1.8e-58
WP_069220328.1|2329006_2329753_+	site-specific DNA-methyltransferase	NA	O03956	Myxococcus_phage	49.3	1.8e-52
WP_069220330.1|2330531_2330945_+	hypothetical protein	NA	Q3HQW1	Burkholderia_phage	52.1	6.9e-06
WP_069220331.1|2330941_2331235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155770732.1|2331224_2331656_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012467583.1|2331652_2331883_+	hypothetical protein	NA	A9YWU6	Burkholderia_phage	52.8	1.1e-13
WP_069220425.1|2332619_2333351_+	metallophosphoesterase	NA	A0A2H4J0P0	uncultured_Caudovirales_phage	53.9	3.0e-68
WP_155770740.1|2333354_2333687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069220427.1|2333731_2333917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006401152.1|2333913_2334162_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069220428.1|2334146_2335184_-|integrase	tyrosine-type recombinase/integrase	integrase	Q19US1	Mannheimia_phage	44.2	4.2e-68
2337827:2337845	attR	GCGAACATCGAGTTCGTGA	NA	NA	NA	NA
>prophage 8
NZ_CP013430	Burkholderia multivorans strain AU1185 isolate AU1185 chromosome 1, complete sequence	3525707	2521993	2530252	3525707		Yaba_monkey_tumor_virus(16.67%)	8	NA	NA
WP_006406236.1|2521993_2522902_+	alpha/beta hydrolase	NA	Q6TUZ7	Yaba_monkey_tumor_virus	26.8	6.2e-15
WP_006400715.1|2522917_2523841_-	histone deacetylase family protein	NA	A0A2K9KZC4	Tupanvirus	34.0	2.3e-41
WP_006400716.1|2523884_2525228_+	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_006400717.1|2525309_2526212_-	cysteine synthase CysM	NA	A0A1X9I5F1	Streptococcus_phage	39.2	1.8e-51
WP_006400718.1|2526420_2526777_-	helix-hairpin-helix domain-containing protein	NA	NA	NA	NA	NA
WP_006400719.1|2526852_2527845_-	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	30.9	6.9e-28
WP_006400720.1|2527893_2528844_-	D-glycero-beta-D-manno-heptose-7-phosphate kinase	NA	A0A2H4N7X4	Lake_Baikal_phage	27.5	9.0e-17
WP_069220463.1|2528851_2530252_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	37.7	1.8e-77
>prophage 9
NZ_CP013430	Burkholderia multivorans strain AU1185 isolate AU1185 chromosome 1, complete sequence	3525707	2606220	2670063	3525707	tRNA,transposase	Staphylococcus_phage(15.0%)	55	NA	NA
WP_006400804.1|2606220_2607522_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	45.4	6.0e-96
WP_006400805.1|2607769_2608036_+	DUF2164 domain-containing protein	NA	NA	NA	NA	NA
WP_006406276.1|2608048_2609359_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.2	6.5e-82
WP_006406277.1|2609509_2610199_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_012467517.1|2610246_2612556_-	DNA translocase FtsK	NA	G1FGP1	Mycobacterium_phage	50.0	1.1e-84
WP_006400809.1|2612877_2613840_+	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	42.6	1.3e-60
WP_035489261.1|2613972_2614749_+	Smr/MutS family protein	NA	NA	NA	NA	NA
WP_006400811.1|2614735_2615359_+	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_006400812.1|2615478_2616597_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	34.8	5.3e-24
WP_006406281.1|2616748_2617606_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_006400814.1|2617595_2618534_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_069220479.1|2618676_2619924_-	carbohydrate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_006400816.1|2620352_2621822_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	35.0	3.9e-75
WP_012213937.1|2621908_2622589_+	6-phosphogluconolactonase	NA	NA	NA	NA	NA
WP_006400818.1|2622566_2624495_+	bifunctional transcriptional regulator/glucokinase	NA	NA	NA	NA	NA
WP_006400819.1|2624587_2625805_-	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	27.1	1.3e-28
WP_035489288.1|2626036_2626492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006406286.1|2626665_2627949_+	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_006400822.1|2627961_2629083_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2I2L4R9	Orpheovirus	34.5	2.2e-46
WP_006400823.1|2629097_2629727_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	40.3	2.3e-29
WP_006400824.1|2630042_2630558_+	DUF1993 domain-containing protein	NA	NA	NA	NA	NA
WP_048994405.1|2630670_2631813_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	36.2	1.4e-48
WP_006400826.1|2631864_2632383_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	38.7	1.4e-19
WP_006400827.1|2632379_2632817_+	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_006406288.1|2632917_2634114_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_069220480.1|2634211_2635336_-	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_069220481.1|2635934_2637491_+	UbiD family decarboxylase	NA	NA	NA	NA	NA
WP_006409618.1|2637516_2638182_+	LysE family transporter	NA	NA	NA	NA	NA
WP_006400832.1|2638357_2638642_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069220482.1|2639176_2640106_+	DUF2520 domain-containing protein	NA	NA	NA	NA	NA
WP_006400835.1|2640182_2640746_+	YggT family protein	NA	NA	NA	NA	NA
WP_006400836.1|2640755_2641106_-	DUF190 domain-containing protein	NA	NA	NA	NA	NA
WP_048994396.1|2641129_2641516_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	53.5	1.3e-22
WP_006406291.1|2641661_2642531_-	NAD-dependent protein deacetylase	NA	S5M4R0	Bacillus_phage	23.4	1.6e-07
WP_048994409.1|2643306_2643846_+	chromate transporter	NA	NA	NA	NA	NA
WP_080560172.1|2644568_2644910_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006400842.1|2644906_2645113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048994394.1|2645168_2647055_-	acyltransferase	NA	C6ZR20	Salmonella_phage	37.9	1.9e-103
WP_006400845.1|2647221_2648481_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.5	3.0e-44
WP_048995560.1|2648560_2649883_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_006400848.1|2650017_2650332_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045594016.1|2651375_2651735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006409623.1|2651867_2654138_+	bifunctional DNA primase/polymerase	NA	D6R422	Bacillus_phage	33.4	1.4e-71
WP_105800266.1|2654526_2655649_+|transposase	IS3-like element ISBvi7 family transposase	transposase	S5WIU1	Leptospira_phage	40.7	5.4e-45
WP_069220483.1|2656022_2656814_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_012492804.1|2657557_2658607_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_006489036.1|2658658_2659612_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_012492805.1|2659840_2660716_+	transporter	NA	NA	NA	NA	NA
WP_006489043.1|2660873_2662256_+|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
WP_006489006.1|2662300_2662549_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	53.3	9.2e-14
WP_034178584.1|2663196_2664342_-	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_006482148.1|2665838_2667308_-	DUF3987 domain-containing protein	NA	A0A0K0N7B1	Gordonia_phage	23.2	3.4e-07
WP_006482143.1|2667531_2667879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006482147.1|2667942_2668155_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006401211.1|2668803_2670063_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.0	3.9e-44
>prophage 10
NZ_CP013430	Burkholderia multivorans strain AU1185 isolate AU1185 chromosome 1, complete sequence	3525707	3420776	3491119	3525707	head,tRNA,holin,protease,terminase,plate,integrase,tail,portal,capsid,transposase	Burkholderia_phage(76.47%)	80	3452483:3452530	3491238:3491285
WP_006407211.1|3420776_3422249_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_006407212.1|3422253_3423744_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_006407213.1|3423814_3424114_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_004189550.1|3424478_3425522_+	rod shape-determining protein	NA	NA	NA	NA	NA
WP_069220658.1|3425647_3426730_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_006401859.1|3426726_3427239_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_053297817.1|3427341_3429669_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_006401857.1|3429680_3430829_+	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_006407216.1|3430871_3431645_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_006401855.1|3431641_3432427_-	2-dehydro-3-deoxyglucarate aldolase	NA	NA	NA	NA	NA
WP_006401854.1|3432652_3433105_-	6-carboxytetrahydropterin synthase QueD	NA	A0A088FAL2	Vibrio_phage	31.4	2.0e-14
WP_006407217.1|3433124_3433757_-	7-carboxy-7-deazaguanine synthase	NA	R4TAH8	Halovirus	33.6	1.9e-07
WP_006401852.1|3433831_3434566_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A1B0Z0B4	Vibrio_phage	43.5	2.1e-50
WP_006401851.1|3435029_3435731_-	response regulator	NA	NA	NA	NA	NA
WP_012214364.1|3435731_3438185_-	PAS domain-containing sensor histidine kinase	NA	NA	NA	NA	NA
WP_006401849.1|3438174_3438765_-	DUF4390 domain-containing protein	NA	NA	NA	NA	NA
WP_045593715.1|3438761_3440165_-	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_006407220.1|3440348_3441206_-|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
WP_006407221.1|3441303_3441945_-	LysE family translocator	NA	NA	NA	NA	NA
WP_069220659.1|3442066_3443050_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	38.3	3.2e-09
WP_006410713.1|3443084_3443588_-	peptide deformylase	NA	A0A067XQZ3	Caulobacter_phage	32.1	1.1e-13
WP_172488701.1|3443774_3445112_+	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	35.6	5.9e-22
WP_006407224.1|3445149_3445530_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_006401840.1|3445734_3448332_+	DNA topoisomerase III	NA	A0A2P1ELA0	Moumouvirus	24.7	3.4e-18
WP_006401839.1|3448478_3449528_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_006401838.1|3449951_3450965_+	D-2-hydroxyacid dehydrogenase family protein	NA	M1HBE3	Paramecium_bursaria_Chlorella_virus	23.2	1.1e-09
WP_069220660.1|3450984_3451851_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_012467421.1|3451859_3452264_-	PaaI family thioesterase	NA	NA	NA	NA	NA
3452483:3452530	attL	GGACTCTTAATCCGTAGGTCGAGTGTTCGAGTCACTCACGCCCCACCA	NA	NA	NA	NA
WP_035947409.1|3452713_3453238_+	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	64.2	3.4e-58
WP_170935258.1|3453245_3453953_+	VRR-NUC domain-containing protein	NA	Q8W6S1	Burkholderia_virus	47.3	8.1e-47
WP_088928005.1|3453962_3454780_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	36.4	3.9e-08
WP_035947412.1|3454885_3455989_+	DUF3396 domain-containing protein	NA	A9YX32	Burkholderia_phage	60.1	4.0e-93
WP_140401745.1|3456004_3456754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043279815.1|3456869_3457511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006410815.1|3458005_3458749_+	DUF1275 domain-containing protein	NA	NA	NA	NA	NA
WP_106918417.1|3459219_3459444_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035947247.1|3459687_3459933_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006401829.1|3460125_3461175_-|portal	phage portal protein	portal	E5E3S7	Burkholderia_phage	93.1	1.2e-190
WP_006401828.1|3461174_3462926_-|terminase	terminase ATPase subunit family protein	terminase	E5E3S6	Burkholderia_phage	92.3	0.0e+00
WP_006401827.1|3463075_3463897_+|capsid	GPO family capsid scaffolding protein	capsid	E5E3S5	Burkholderia_phage	95.6	1.5e-140
WP_006401826.1|3463934_3464954_+|capsid	phage major capsid protein, P2 family	capsid	A0A1S5NPT2	Burkholderia_phage	86.4	8.4e-170
WP_006401825.1|3464950_3465637_+|terminase	terminase endonuclease subunit	terminase	E5E3S3	Burkholderia_phage	93.4	1.6e-116
WP_006401824.1|3465741_3466218_+|head	head completion/stabilization protein	head	E5E3S2	Burkholderia_phage	91.8	1.5e-76
WP_006401823.1|3466217_3466460_+	hypothetical protein	NA	E5E3S1	Burkholderia_phage	72.5	1.1e-24
WP_006401822.1|3466459_3466672_+|tail	tail protein X	tail	E5E3S0	Burkholderia_phage	94.3	3.7e-32
WP_006401821.1|3466674_3467049_+|holin	phage holin family protein	holin	E5E3R9	Burkholderia_phage	96.8	5.0e-56
WP_006401820.1|3467048_3467369_+|holin	phage holin family protein	holin	A0A1S5NTF8	Burkholderia_phage	92.5	3.7e-47
WP_006401819.1|3467361_3468162_+	DUF3380 domain-containing protein	NA	E5E3R7	Burkholderia_phage	90.6	6.4e-133
WP_006401818.1|3468158_3468650_+	hypothetical protein	NA	A0A1S5NQ26	Burkholderia_phage	70.6	2.6e-52
WP_006401817.1|3468646_3469057_+|tail	phage tail protein	tail	E5E3R4	Burkholderia_phage	96.3	2.1e-71
WP_006401816.1|3469056_3469506_+	phage virion morphogenesis protein	NA	E5E3R3	Burkholderia_phage	89.3	3.5e-64
WP_006401814.1|3469922_3470627_+|plate	phage baseplate assembly protein V	plate	A0A1S5NNH1	Burkholderia_phage	81.9	1.1e-96
WP_006401813.1|3470623_3471001_+	GPW/gp25 family protein	NA	E5E3R0	Burkholderia_phage	89.6	3.5e-57
WP_006401812.1|3470997_3471903_+|plate	baseplate J/gp47 family protein	plate	E5E3Q9	Burkholderia_phage	94.7	4.2e-157
WP_006401811.1|3471895_3472450_+|tail	phage tail protein I	tail	E5E3Q8	Burkholderia_phage	92.9	1.2e-93
WP_006401810.1|3472452_3474063_+|tail	phage tail protein	tail	E5E3Q7	Burkholderia_phage	99.3	7.8e-263
WP_006401809.1|3474073_3474910_+|tail	tail fiber assembly protein	tail	E5E3Q6	Burkholderia_phage	89.3	7.6e-145
WP_006410531.1|3474953_3475139_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106918433.1|3475568_3475661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006401806.1|3476133_3477306_+|tail	phage tail sheath protein	tail	A0A1S5NNH8	Burkholderia_phage	92.3	2.2e-214
WP_006401805.1|3477335_3477845_+|tail	phage major tail tube protein	tail	E5E3Q2	Burkholderia_phage	94.1	3.6e-89
WP_006401804.1|3477878_3478190_+|tail	phage tail assembly protein	tail	E5E3Q1	Burkholderia_phage	97.1	5.7e-45
WP_035947244.1|3478189_3478309_+|tail	GpE family phage tail protein	tail	E5E3Q0	Burkholderia_phage	92.3	9.7e-14
WP_006401802.1|3478305_3481068_+	hypothetical protein	NA	E5E3P9	Burkholderia_phage	79.5	0.0e+00
WP_006401801.1|3481080_3481509_+|tail	phage tail protein	tail	E5E3P8	Burkholderia_phage	95.8	2.2e-71
WP_006401800.1|3481505_3482654_+	phage late control D family protein	NA	E5E3P7	Burkholderia_phage	96.6	1.6e-193
WP_035947236.1|3483120_3483501_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_006401797.1|3483506_3483998_-	helix-turn-helix transcriptional regulator	NA	E5E3U2	Burkholderia_phage	42.0	6.7e-24
WP_006401796.1|3484115_3484301_+	hypothetical protein	NA	K4NZX7	Burkholderia_phage	49.2	6.9e-06
WP_006401795.1|3484316_3484511_+	hypothetical protein	NA	E5E3U0	Burkholderia_phage	58.7	2.7e-13
WP_006401794.1|3484536_3484728_+	hypothetical protein	NA	E5E3T9	Burkholderia_phage	57.8	1.2e-10
WP_006401793.1|3484755_3485004_+	ogr/Delta-like zinc finger family protein	NA	E5E3P1	Burkholderia_phage	89.0	1.0e-36
WP_006401792.1|3485092_3485287_+	hypothetical protein	NA	E5E3P0	Burkholderia_phage	98.4	1.0e-28
WP_006401791.1|3485290_3485494_+	hypothetical protein	NA	E5E3N9	Burkholderia_phage	92.5	2.5e-25
WP_006401790.1|3485537_3485732_+	hypothetical protein	NA	E5E3N8	Burkholderia_phage	95.3	1.8e-25
WP_006401789.1|3485736_3486096_+	hypothetical protein	NA	E5E3N7	Burkholderia_phage	97.5	1.3e-56
WP_006401788.1|3486092_3486353_+	hypothetical protein	NA	E5E3N6	Burkholderia_phage	91.9	1.7e-34
WP_006401787.1|3486355_3489151_+	toprim domain-containing protein	NA	E5E3N5	Burkholderia_phage	96.6	0.0e+00
WP_080560198.1|3489769_3490039_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_006401785.1|3490039_3491119_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4J8E5	uncultured_Caudovirales_phage	31.5	3.6e-30
3491238:3491285	attR	GGACTCTTAATCCGTAGGTCGAGTGTTCGAGTCACTCACGCCCCACCA	NA	NA	NA	NA
>prophage 1
NZ_CP013431	Burkholderia multivorans strain AU1185 isolate AU1185 chromosome 2, complete sequence	2533520	252008	298826	2533520	transposase	Pseudomonas_phage(22.22%)	40	NA	NA
WP_163013128.1|252008_253207_-|transposase	IS3 family transposase	transposase	A0A1B0Z042	Pseudomonas_phage	65.5	1.0e-102
WP_069220788.1|253417_254209_-	HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_065060494.1|254512_255610_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_065060495.1|255629_256745_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_069220789.1|256789_257494_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_069220790.1|257490_258579_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_069220791.1|258575_259646_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_069220792.1|259642_261016_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_172820312.1|261028_263146_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_172820313.1|263165_263666_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069220793.1|263814_265083_+	SfnB family sulfur acquisition oxidoreductase	NA	NA	NA	NA	NA
WP_105771389.1|266290_267458_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.1	1.3e-38
WP_155770745.1|267571_268093_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088928048.1|268043_269224_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	41.4	8.2e-60
WP_155770746.1|269216_271178_+	peptidase M23	NA	Q2NPA7	Xanthomonas_phage	34.4	6.9e-11
WP_155770747.1|271179_271743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155770748.1|272442_272727_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012217389.1|273540_274800_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.0	3.9e-44
WP_069220798.1|274876_275356_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_069220799.1|275448_275895_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_069220800.1|275891_276569_-	peroxiredoxin	NA	NA	NA	NA	NA
WP_069220801.1|276741_277650_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_069220802.1|277652_278087_+	heme-binding protein	NA	NA	NA	NA	NA
WP_069220803.1|278133_279312_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_069220804.1|279330_280620_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_069220805.1|280628_281330_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_069220806.1|281391_282588_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_069220807.1|282596_283472_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_069220808.1|283474_284491_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_069220809.1|284487_285246_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	32.5	3.7e-05
WP_069220810.1|285229_286030_+	ATP-binding cassette domain-containing protein	NA	A0A2R8FG22	Brazilian_cedratvirus	27.8	1.1e-07
WP_069220811.1|286143_287226_+	porin	NA	NA	NA	NA	NA
WP_069220812.1|287277_287925_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_069220813.1|288309_289734_+	putative sulfate exporter family transporter	NA	NA	NA	NA	NA
WP_163013128.1|290539_291738_-|transposase	IS3 family transposase	transposase	A0A1B0Z042	Pseudomonas_phage	65.5	1.0e-102
WP_155770749.1|292087_293731_+	SAVED domain-containing protein	NA	NA	NA	NA	NA
WP_069220816.1|293750_294965_+	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_081336783.1|294961_296686_+	ThiF family adenylyltransferase	NA	NA	NA	NA	NA
WP_081336784.1|296685_297171_+	Mov34/MPN/PAD-1 family protein	NA	NA	NA	NA	NA
WP_111442900.1|297706_298826_+|transposase	IS3-like element IS407 family transposase	transposase	S5WIU1	Leptospira_phage	39.9	1.2e-49
>prophage 2
NZ_CP013431	Burkholderia multivorans strain AU1185 isolate AU1185 chromosome 2, complete sequence	2533520	928980	994327	2533520	transposase,plate	Ralstonia_phage(20.0%)	51	NA	NA
WP_069220611.1|928980_930240_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.5	3.0e-44
WP_069220970.1|931025_931637_-	LysE family translocator	NA	NA	NA	NA	NA
WP_069220971.1|932149_932683_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_006396690.1|932701_933763_-	alkene reductase	NA	NA	NA	NA	NA
WP_006396691.1|933843_934152_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_065496288.1|934315_935560_-	MFS transporter	NA	NA	NA	NA	NA
WP_006411590.1|935707_936586_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_006411582.1|936602_937742_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_053298380.1|937860_938202_-	cupredoxin family copper-binding protein	NA	NA	NA	NA	NA
WP_059939011.1|938219_939158_-	metallophosphoesterase	NA	NA	NA	NA	NA
WP_069220972.1|939443_941195_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_006396699.1|941206_942559_+	nitrate/sulfonate/bicarbonate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.5	2.4e-31
WP_069220973.1|942609_943719_-	type VI secretion system ImpA family N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_069220974.1|943715_944789_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_069220975.1|944788_946678_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_006410793.1|946713_947280_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_035947393.1|947389_948034_-	TagK domain-containing protein	NA	NA	NA	NA	NA
WP_069220976.1|948575_951257_+	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	31.8	5.2e-86
WP_006410787.1|951293_951833_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_069220977.1|951860_953354_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_069220978.1|953444_953930_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_006403139.1|954008_954512_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_069220979.1|954543_955890_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_146123991.1|955958_956285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069220980.1|956359_958882_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	29.4	5.8e-71
WP_081336802.1|959013_959610_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_081336803.1|959759_960350_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_088928122.1|960478_961084_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_081336805.1|961228_961822_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_069220981.1|961818_964044_+	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_081068852.1|964036_964996_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_081336849.1|965007_965289_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_069220982.1|966363_968901_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	33.1	1.1e-80
WP_069221471.1|968909_969752_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_069220983.1|969748_972307_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069220984.1|972308_973250_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069221472.1|973897_974245_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105810600.1|974313_974592_+	PAAR domain-containing protein	NA	A4PE23	Ralstonia_virus	38.3	3.8e-08
WP_172820322.1|974588_975887_+	type VI secretion system protein TssL	NA	NA	NA	NA	NA
WP_069220986.1|975912_980010_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_069220987.1|980025_981291_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_040132099.1|981332_981584_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_069220988.1|981600_984336_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_069220989.1|984383_989006_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	51.4	2.3e-57
WP_081068824.1|989002_989332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081068826.1|989726_989969_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146123492.1|990250_990751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146123491.1|991554_991860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069220991.1|991986_992391_+	RHS domain-containing protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	38.0	1.4e-14
WP_006402507.1|992510_993317_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	57.5	4.6e-78
WP_006405053.1|993316_994327_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	50.0	6.3e-85
