The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP013433	Burkholderia vietnamiensis strain AU1233 chromosome 1, complete sequence	5577538	351408	403013	5577538	integrase,protease,transposase	uncultured_Mediterranean_phage(22.22%)	54	369396:369412	411958:411974
WP_034194003.1|351408_352122_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_011883035.1|352413_357117_+	glutamate synthase subunit alpha	NA	NA	NA	NA	NA
WP_014722301.1|357202_358669_+	glutamate synthase subunit beta	NA	NA	NA	NA	NA
WP_014722302.1|358944_359187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014722303.1|359183_359738_+	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_069263220.1|359850_361617_-	ABC transporter ATP-binding protein/permease	NA	NA	NA	NA	NA
WP_045578585.1|362243_363395_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011883040.1|363427_363625_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_011883041.1|363663_364479_+	thiazole synthase	NA	NA	NA	NA	NA
WP_069263222.1|364475_365600_+	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_011883043.1|365684_366506_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.9	6.8e-21
WP_011883044.1|366502_367270_+	lipid asymmetry maintenance ABC transporter permease subunit MlaE	NA	NA	NA	NA	NA
WP_059463947.1|367294_367855_+	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_011883046.1|367887_368835_+	VacJ family lipoprotein	NA	NA	NA	NA	NA
WP_011883047.1|368959_369589_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
369396:369412	attL	TGCAGATCGACTACCGC	NA	NA	NA	NA
WP_034193997.1|369585_369861_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_069263224.1|370052_370979_+	ABC transporter ATP-binding protein	NA	A0A1M7XV31	Cedratvirus	32.4	2.6e-21
WP_011883050.1|370975_371731_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_059460389.1|371782_372022_+	BolA family transcriptional regulator	NA	NA	NA	NA	NA
WP_059560217.1|372035_373385_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_011883052.1|373381_374035_+	ATP phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_011883053.1|374059_375376_+	histidinol dehydrogenase	NA	NA	NA	NA	NA
WP_011883054.1|375495_376569_+	histidinol-phosphate transaminase	NA	NA	NA	NA	NA
WP_006765368.1|376631_377219_+	imidazoleglycerol-phosphate dehydratase HisB	NA	NA	NA	NA	NA
WP_011883055.1|377281_377902_+	YchE family NAAT transporter	NA	NA	NA	NA	NA
WP_011883056.1|377898_378540_+	imidazole glycerol phosphate synthase subunit HisH	NA	NA	NA	NA	NA
WP_011883057.1|378703_379459_+	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino]imidazole-4- carboxamide isomerase	NA	NA	NA	NA	NA
WP_011883058.1|379565_380339_+	imidazole glycerol phosphate synthase subunit HisF	NA	NA	NA	NA	NA
WP_011883059.1|380338_380755_+	phosphoribosyl-AMP cyclohydrolase	NA	NA	NA	NA	NA
WP_011883060.1|380751_381117_+	phosphoribosyl-ATP diphosphatase	NA	NA	NA	NA	NA
WP_011883061.1|381198_381591_+	membrane protein	NA	NA	NA	NA	NA
WP_011546602.1|381619_381985_+	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
WP_006751795.1|382079_382310_+	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_014722313.1|382336_382870_+	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_011883064.1|382911_383694_+	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	29.9	6.1e-27
WP_011883065.1|383839_385048_-	Do family serine endopeptidase	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	33.6	1.2e-10
WP_011883066.1|385069_385816_+	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_011883067.1|386035_386656_+	ubiquinol-cytochrome c reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_059475053.1|386655_388038_+	cytochrome bc complex cytochrome b subunit	NA	NA	NA	NA	NA
WP_011883069.1|388059_388818_+	cytochrome c1	NA	NA	NA	NA	NA
WP_006400565.1|388912_389524_+	glutathione S-transferase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_014722317.1|389595_390102_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	52.0	7.1e-21
WP_069263226.1|390393_391596_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	49.9	1.6e-106
WP_155772554.1|391612_392458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172820409.1|392393_393674_-	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_172820410.1|393900_395439_-	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_069263233.1|395545_395836_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081333169.1|395883_396156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085954470.1|396316_397134_-|transposase	IS5-like element ISBcen20 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	35.0	1.1e-07
WP_069263237.1|397517_397913_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_172820411.1|397888_398245_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_106919311.1|399354_400591_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	98.2	1.1e-160
WP_069263239.1|401196_401448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155121928.1|401926_403013_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	35.2	3.2e-42
411958:411974	attR	GCGGTAGTCGATCTGCA	NA	NA	NA	NA
>prophage 2
NZ_CP013433	Burkholderia vietnamiensis strain AU1233 chromosome 1, complete sequence	5577538	417132	455665	5577538	capsid,plate,transposase	uncultured_Caudovirales_phage(25.0%)	34	NA	NA
WP_069263258.1|417132_418050_-|capsid	phage capsid protein	capsid	NA	NA	NA	NA
WP_069263259.1|418100_419096_-	YqaJ viral recombinase family protein	NA	A6XMH8	Bacillus_virus	40.8	1.6e-53
WP_069264797.1|419169_420135_-	DUF932 domain-containing protein	NA	A0A0H4INH5	Stenotrophomonas_phage	42.5	1.3e-58
WP_172820451.1|420229_420562_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081333171.1|421084_421540_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_172820413.1|421860_422484_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_155772557.1|422483_423194_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081333254.1|423874_424027_+	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_081333173.1|424036_424450_+	DNA mismatch endonuclease Vsr	NA	I6NSG0	Burkholderia_phage	53.2	2.9e-36
WP_069263264.1|424436_425630_+	DNA cytosine methyltransferase	NA	A7XXH6	Thermus_virus	27.8	1.4e-27
WP_069263265.1|425806_428125_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_069263266.1|428126_429800_+	DEAD/DEAH box helicase family protein	NA	A0A1B0YC45	Lactobacillus_phage	26.1	1.2e-27
WP_069263268.1|429796_430324_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069263270.1|430345_431470_+	DUF4935 domain-containing protein	NA	NA	NA	NA	NA
WP_069264798.1|431698_432466_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_155772558.1|432818_433187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148278539.1|433238_433520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011883093.1|433841_434642_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_131753411.1|434667_434964_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069263271.1|434956_438136_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	26.9	4.9e-59
WP_069263272.1|438186_442839_+	RHS domain-containing protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	48.4	1.6e-45
WP_011883097.1|442838_443168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081333174.1|443422_444691_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	43.9	3.5e-40
WP_059622951.1|445230_445548_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011883100.1|445640_446423_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_011883101.1|446419_447766_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_172820452.1|447868_448468_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_011883103.1|448854_449490_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_011883104.1|449544_450060_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_011883105.1|450075_451566_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_011883106.1|451636_452140_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_011883107.1|452202_452688_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_014722341.1|452765_454601_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_059560417.1|454564_455665_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
>prophage 3
NZ_CP013433	Burkholderia vietnamiensis strain AU1233 chromosome 1, complete sequence	5577538	744675	753820	5577538		Hokovirus(16.67%)	7	NA	NA
WP_011883357.1|744675_746628_+	molecular chaperone DnaK	NA	A0A1V0SH73	Hokovirus	50.1	7.0e-149
WP_011883359.1|746884_748021_+	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	27.2	2.2e-22
WP_069263323.1|748025_750053_+	bifunctional anthranilate synthase component I family protein/class IV aminotransferase	NA	S4VT78	Pandoravirus	35.1	2.6e-53
WP_014722488.1|750144_750960_-	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	32.5	3.7e-35
WP_014722489.1|751007_751694_-	deoxynucleoside kinase	NA	A0A0M3UL55	Enterococcus_phage	29.5	3.6e-07
WP_069263325.1|751690_752233_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_011883369.1|752266_753820_-	polynucleotide adenylyltransferase PcnB	NA	A0A1B0V011	Roseobacter_phage	27.6	1.7e-17
>prophage 4
NZ_CP013433	Burkholderia vietnamiensis strain AU1233 chromosome 1, complete sequence	5577538	953660	979329	5577538	transposase	Paenibacillus_phage(50.0%)	20	NA	NA
WP_106919311.1|953660_954898_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	98.2	1.1e-160
WP_069263383.1|954910_956242_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069264809.1|956238_959055_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	27.1	1.4e-62
WP_155772561.1|959722_960539_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	35.0	1.1e-07
WP_051392257.1|960737_961199_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_081333181.1|961195_961744_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155772562.1|961772_962978_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069263386.1|962961_963444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069263388.1|963445_964750_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085954470.1|964688_965506_-|transposase	IS5-like element ISBcen20 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	35.0	1.1e-07
WP_172820418.1|965700_966375_+	DUF3732 domain-containing protein	NA	NA	NA	NA	NA
WP_069264812.1|966549_968295_+	RNA-directed DNA polymerase	NA	NA	NA	NA	NA
WP_081333184.1|968790_969093_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_069263391.1|970176_971376_+	nucleoside 2-deoxyribosyltransferase	NA	NA	NA	NA	NA
WP_060040214.1|971372_971969_+	7-cyano-7-deazaguanine synthase	NA	NA	NA	NA	NA
WP_155772563.1|971955_972618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155772564.1|973740_973884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085954470.1|974429_975246_+|transposase	IS5-like element ISBcen20 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	35.0	1.1e-07
WP_081333185.1|975735_977988_+	type I restriction enzyme HsdR N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_155772565.1|978095_979329_+|transposase	IS3 family transposase	transposase	A0A1B0Z042	Pseudomonas_phage	64.2	1.7e-103
>prophage 5
NZ_CP013433	Burkholderia vietnamiensis strain AU1233 chromosome 1, complete sequence	5577538	2619715	2676569	5577538	integrase,holin,transposase	Bacillus_virus(16.67%)	37	2657834:2657850	2685830:2685846
WP_069263861.1|2619715_2620663_-|holin	choline ABC transporter substrate-binding protein	holin	NA	NA	NA	NA
WP_011880823.1|2620783_2621779_-	GlxA family transcriptional regulator	NA	NA	NA	NA	NA
WP_011880824.1|2621892_2622789_-|holin	choline ABC transporter permease subunit	holin	NA	NA	NA	NA
WP_072465484.1|2622781_2623879_-	glycine betaine/L-proline ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.8	3.8e-27
WP_060042474.1|2624549_2627963_+	DUF2339 domain-containing protein	NA	NA	NA	NA	NA
WP_069263863.1|2627959_2629318_+	DUF3999 domain-containing protein	NA	NA	NA	NA	NA
WP_011880828.1|2629433_2629739_+	NIPSNAP family protein	NA	NA	NA	NA	NA
WP_014724011.1|2630027_2630678_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_006749916.1|2630888_2631107_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014724012.1|2631199_2632102_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155772653.1|2633231_2642021_+	YadA-like family protein	NA	NA	NA	NA	NA
WP_069263867.1|2642115_2642796_+	OmpA family protein	NA	NA	NA	NA	NA
WP_059561449.1|2643106_2644252_+	DUF2827 domain-containing protein	NA	NA	NA	NA	NA
WP_034195520.1|2644266_2645421_+	DUF2827 domain-containing protein	NA	NA	NA	NA	NA
WP_059462763.1|2645446_2645914_+	DUF4019 domain-containing protein	NA	NA	NA	NA	NA
WP_011880838.1|2645935_2647072_+	DUF2827 domain-containing protein	NA	NA	NA	NA	NA
WP_046427460.1|2647106_2649071_+	FkbM family methyltransferase	NA	A0A291AUV0	Sinorhizobium_phage	28.2	2.4e-08
WP_011880840.1|2649117_2649549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011880841.1|2649610_2650414_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_011880842.1|2651155_2652298_-	DUF2827 domain-containing protein	NA	NA	NA	NA	NA
WP_059462761.1|2652567_2654568_-	acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha	NA	NA	NA	NA	NA
WP_046427440.1|2654604_2655390_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_034195527.1|2655409_2657017_-	methylcrotonoyl-CoA carboxylase	NA	A0A1B2ITV7	Pike_perch_iridovirus	56.3	2.7e-21
WP_011880846.1|2657048_2658230_-	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
2657834:2657850	attL	CGCTCATCGCGAGCGCG	NA	NA	NA	NA
WP_080938586.1|2658400_2659147_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011880848.1|2659217_2659706_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_041494232.1|2659902_2660982_+	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_011880850.1|2660978_2661944_+	oxidoreductase	NA	NA	NA	NA	NA
WP_069263869.1|2662171_2664367_+	TonB-dependent siderophore receptor	NA	A0A0P0I887	Acinetobacter_phage	30.8	6.7e-07
WP_060092691.1|2664395_2666318_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_034195533.1|2666838_2667573_+	metallophosphoesterase family protein	NA	NA	NA	NA	NA
WP_059669192.1|2667626_2668238_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_106919311.1|2668714_2669951_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	98.2	1.1e-160
WP_081333200.1|2669948_2671304_-	kelch repeat-containing protein	NA	NA	NA	NA	NA
WP_011880242.1|2672481_2673987_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_069263164.1|2674563_2675595_-|integrase	site-specific integrase	integrase	A0A2R2ZGC4	Ralstonia_phage	22.1	9.2e-07
WP_069263160.1|2675591_2676569_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
2685830:2685846	attR	CGCTCATCGCGAGCGCG	NA	NA	NA	NA
>prophage 6
NZ_CP013433	Burkholderia vietnamiensis strain AU1233 chromosome 1, complete sequence	5577538	3056754	3063317	5577538		Enterobacteria_phage(66.67%)	7	NA	NA
WP_059606890.1|3056754_3057816_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	47.3	7.1e-87
WP_059606888.1|3057827_3058721_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	57.7	1.6e-95
WP_059606886.1|3058705_3059257_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	54.7	1.5e-51
WP_059739335.1|3059249_3060149_+	dTDP-4-dehydrorhamnose reductase	NA	I7HXC9	Enterobacteria_phage	33.5	4.2e-24
WP_059606882.1|3060281_3061697_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	30.8	1.2e-57
WP_059606880.1|3061698_3062517_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_059606904.1|3062522_3063317_+	ABC transporter ATP-binding protein	NA	Q66093	Chlorella_virus	26.3	4.6e-06
>prophage 7
NZ_CP013433	Burkholderia vietnamiensis strain AU1233 chromosome 1, complete sequence	5577538	3256944	3265401	5577538		Bacillus_phage(16.67%)	8	NA	NA
WP_011883830.1|3256944_3258345_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	37.9	2.5e-76
WP_011883831.1|3258352_3259303_+	D-glycero-beta-D-manno-heptose-7-phosphate kinase	NA	A0A2H4N7X4	Lake_Baikal_phage	28.5	2.6e-16
WP_059668160.1|3259366_3260359_+	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	30.9	5.9e-27
WP_059462873.1|3260432_3260780_+	helix-hairpin-helix domain-containing protein	NA	NA	NA	NA	NA
WP_046425224.1|3260985_3261888_+	cysteine synthase CysM	NA	A0A1X9I5F1	Streptococcus_phage	39.5	6.3e-52
WP_059462874.1|3261987_3263211_-	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_011883840.1|3263381_3264305_+	histone deacetylase family protein	NA	A0A2K9KZC4	Tupanvirus	35.2	1.3e-41
WP_155624667.1|3264429_3265401_-	alpha/beta fold hydrolase	NA	A7XCB7	Tanapox_virus	28.1	1.1e-22
>prophage 8
NZ_CP013433	Burkholderia vietnamiensis strain AU1233 chromosome 1, complete sequence	5577538	3528826	3536538	5577538	integrase	Burkholderia_virus(42.86%)	13	3528205:3528221	3535495:3535511
3528205:3528221	attL	CGATCGGCGTGCCGGTG	NA	NA	NA	NA
WP_069264084.1|3528826_3529912_-|integrase	tyrosine-type recombinase/integrase	integrase	Q8W6R7	Burkholderia_virus	84.7	3.7e-184
WP_069264086.1|3529911_3530142_-	DUF4224 domain-containing protein	NA	Q6JIJ7	Burkholderia_virus	51.3	3.5e-15
WP_069264088.1|3530138_3530828_-	hypothetical protein	NA	Q5QF30	Pseudomonas_virus	44.1	4.8e-36
WP_069264090.1|3530824_3531196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069264092.1|3531192_3531543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069264094.1|3531539_3532154_-	hypothetical protein	NA	A0A0U1UNM2	Pseudomonas_phage	56.0	4.6e-22
WP_081333264.1|3532164_3533226_-	RNA-directed DNA polymerase	NA	H7BVN7	unidentified_phage	34.9	7.4e-44
WP_069264096.1|3533485_3533863_-	four helix bundle protein	NA	NA	NA	NA	NA
WP_069264098.1|3533877_3534342_-	DUF1566 domain-containing protein	NA	NA	NA	NA	NA
WP_069264100.1|3534372_3534726_-	DUF1566 domain-containing protein	NA	NA	NA	NA	NA
WP_069264102.1|3534752_3535115_-	DUF1566 domain-containing protein	NA	NA	NA	NA	NA
WP_069264104.1|3535302_3536160_-	DUF2303 family protein	NA	R9TSA8	Rhizobium_phage	31.3	2.9e-22
3535495:3535511	attR	CACCGGCACGCCGATCG	NA	NA	NA	NA
WP_059568110.1|3536193_3536538_-	hypothetical protein	NA	C5IHK2	Burkholderia_virus	38.4	1.1e-09
>prophage 9
NZ_CP013433	Burkholderia vietnamiensis strain AU1233 chromosome 1, complete sequence	5577538	3547038	3555283	5577538	terminase	Vibrio_phage(33.33%)	8	NA	NA
WP_069264144.1|3547038_3548274_+|terminase	PBSX family phage terminase large subunit	terminase	L7TKU1	Rhizobium_phage	49.8	2.3e-121
WP_069264146.1|3548282_3550391_+	hypothetical protein	NA	F8TUN9	EBPR_podovirus	34.6	3.8e-92
WP_069264149.1|3550392_3550698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069264150.1|3550805_3551537_+	hypothetical protein	NA	A8HNY6	Thalassomonas_phage	36.0	5.5e-06
WP_069264153.1|3551545_3552754_+	hypothetical protein	NA	A0A2I7RHI0	Vibrio_phage	35.4	3.0e-49
WP_069264155.1|3552816_3553146_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069264158.1|3553142_3553859_+	hypothetical protein	NA	I3PUX2	Vibrio_phage	30.6	1.8e-17
WP_081333220.1|3553858_3555283_+	hypothetical protein	NA	A0A0E3JSB2	Rhodoferax_phage	41.6	2.2e-99
>prophage 10
NZ_CP013433	Burkholderia vietnamiensis strain AU1233 chromosome 1, complete sequence	5577538	3821306	3874407	5577538	tail,capsid,terminase,plate	Burkholderia_phage(62.26%)	76	NA	NA
WP_069264234.1|3821306_3821948_-	hypothetical protein	NA	O03965	Myxococcus_phage	37.7	4.1e-29
WP_069264236.1|3821944_3822142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069264238.1|3822138_3823188_-	phage Gp37/Gp68 family protein	NA	Q8W6R4	Burkholderia_virus	56.9	1.0e-101
WP_081333224.1|3823186_3823846_+	HNH endonuclease	NA	A0A218KCC2	Bacillus_phage	46.4	1.3e-14
WP_155772607.1|3823923_3824508_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069264246.1|3824898_3825135_-	hypothetical protein	NA	A9YWV8	Burkholderia_phage	87.2	2.9e-33
WP_069264248.1|3825131_3825689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155772608.1|3825828_3826029_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069264250.1|3826022_3826268_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155772609.1|3826264_3827437_-	hypothetical protein	NA	A6N3G8	Burkholderia_virus	72.2	1.0e-06
WP_069264254.1|3827597_3829586_-	DNA cytosine methyltransferase	NA	Q9ZXI4	Pseudomonas_virus	57.2	1.9e-165
WP_059701376.1|3829752_3830088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069264256.1|3830257_3830878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069264257.1|3830991_3831615_-	1-pyrroline-5-carboxylate dehydrogenase	NA	A9YX18	Burkholderia_phage	94.4	1.1e-20
WP_069264259.1|3831611_3833378_-	AAA family ATPase	NA	J7HXJ7	Pseudomonas_phage	37.2	3.4e-78
WP_069264261.1|3833374_3834259_-	cell division protein FtsK	NA	J7I0T4	Pseudomonas_phage	33.5	1.2e-34
WP_069264894.1|3834289_3835492_-	hypothetical protein	NA	A0A2I7RZ22	Vibrio_phage	33.7	6.5e-20
WP_069264263.1|3835580_3836390_-	PD-(D/E)XK nuclease family protein	NA	J7HXJ4	Pseudomonas_phage	60.2	8.0e-91
WP_069264265.1|3836386_3836686_-	KTSC domain-containing protein	NA	A9YWW2	Burkholderia_phage	81.8	1.4e-40
WP_172820432.1|3836781_3836925_-	hypothetical protein	NA	A9YWW4	Burkholderia_phage	67.4	3.0e-09
WP_172820433.1|3836921_3837071_-	hypothetical protein	NA	A9YWW5	Burkholderia_phage	63.8	1.5e-08
WP_172820434.1|3837067_3837244_-	hypothetical protein	NA	A9YWW6	Burkholderia_phage	72.4	2.4e-16
WP_069264267.1|3837243_3837489_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069264269.1|3837485_3837836_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069264271.1|3837832_3838060_-	hypothetical protein	NA	I6NVM7	Burkholderia_virus	45.0	1.4e-05
WP_069264273.1|3838108_3838525_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069264275.1|3839117_3839948_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172820435.1|3840619_3840967_-	helix-turn-helix domain-containing protein	NA	A9YWX7	Burkholderia_phage	97.4	7.2e-57
WP_081333229.1|3841051_3841363_+	helix-turn-helix domain-containing protein	NA	A9YWX8	Burkholderia_phage	80.4	1.4e-43
WP_069264278.1|3841479_3841854_+	hypothetical protein	NA	A9YWX9	Burkholderia_phage	80.6	5.8e-52
WP_081333230.1|3841850_3842072_+	hypothetical protein	NA	A9YWY0	Burkholderia_phage	83.8	2.1e-30
WP_155772610.1|3842113_3842905_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155772611.1|3842958_3843117_+	hypothetical protein	NA	A9YWY3	Burkholderia_phage	81.2	2.1e-08
WP_069264280.1|3843113_3844352_+	phosphoadenosine phosphosulfate reductase family protein	NA	R9TRT5	Rhizobium_phage	69.8	9.2e-171
WP_059898338.1|3844514_3844733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069264282.1|3844770_3845760_+	YdaU family protein	NA	NA	NA	NA	NA
WP_155772612.1|3845756_3845930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069264284.1|3845926_3846397_+	RusA family crossover junction endodeoxyribonuclease	NA	A9YWY9	Burkholderia_phage	89.7	2.0e-73
WP_069264286.1|3846408_3846735_+	hypothetical protein	NA	A9YWZ0	Burkholderia_phage	89.7	2.1e-42
WP_069264288.1|3846731_3847325_+	DNA-binding protein	NA	A9YWZ1	Burkholderia_phage	93.2	4.8e-101
WP_069224162.1|3847432_3847876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069264290.1|3847981_3848647_+	hypothetical protein	NA	A9YWZ4	Burkholderia_phage	89.8	2.4e-109
WP_069224164.1|3848665_3849145_+	DUF2280 domain-containing protein	NA	A9YWZ5	Burkholderia_phage	75.7	4.2e-55
WP_069264293.1|3849095_3850649_+|terminase	phage terminase large subunit	terminase	H9C0C7	Vibrio_phage	45.2	1.3e-110
WP_069264297.1|3850669_3852136_+	DUF1073 domain-containing protein	NA	A9YWZ7	Burkholderia_phage	94.8	2.2e-264
WP_069264299.1|3852132_3852888_+|capsid	minor capsid protein	capsid	A9YWZ8	Burkholderia_phage	97.2	5.5e-134
WP_155754269.1|3853046_3853208_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069264301.1|3853209_3854670_+	DUF2213 domain-containing protein	NA	A9YX03	Burkholderia_phage	88.3	1.2e-206
WP_069264303.1|3854679_3855186_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069264305.1|3855255_3856347_+	DUF2184 domain-containing protein	NA	A9YX23	Burkholderia_phage	96.3	1.1e-162
WP_011881830.1|3856348_3856816_+	hypothetical protein	NA	A9YX24	Burkholderia_phage	85.9	2.6e-25
WP_069264307.1|3856878_3857262_+	DUF4054 domain-containing protein	NA	A9YX25	Burkholderia_phage	94.5	5.3e-61
WP_069264309.1|3857290_3857773_+	hypothetical protein	NA	A9YX26	Burkholderia_phage	88.1	2.5e-71
WP_069264311.1|3857776_3858148_+	hypothetical protein	NA	A9YX28	Burkholderia_phage	94.3	3.2e-63
WP_069264312.1|3858152_3858743_+	hypothetical protein	NA	A9YX29	Burkholderia_phage	93.4	7.4e-102
WP_069264313.1|3858752_3860228_+	DUF3383 domain-containing protein	NA	A0A0P0I492	Acinetobacter_phage	47.9	1.0e-112
WP_059602255.1|3860243_3860684_+	DUF3277 family protein	NA	A0A0P0IKY2	Acinetobacter_phage	59.6	6.4e-42
WP_069264315.1|3860686_3861268_+	hypothetical protein	NA	A0A0N7IRF3	Acinetobacter_phage	32.6	7.2e-17
WP_069264318.1|3861451_3863431_+	mannosyl-glycoprotein endo-beta-N-acetylglucosamidase	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	31.5	1.4e-40
WP_081333231.1|3863427_3864003_+	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	35.1	3.8e-18
WP_069264320.1|3864002_3864320_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069264321.1|3864316_3865285_+	hypothetical protein	NA	A9YX04	Burkholderia_phage	88.6	4.0e-145
WP_069264322.1|3865281_3865659_-	hypothetical protein	NA	A9YX05	Burkholderia_phage	90.4	5.8e-60
WP_069264323.1|3865662_3866403_+	hypothetical protein	NA	A9YX06	Burkholderia_phage	87.8	1.5e-120
WP_069264324.1|3866410_3866764_+	hypothetical protein	NA	A9YX11	Burkholderia_phage	95.7	7.3e-57
WP_069264326.1|3866760_3867942_+|plate	baseplate J/gp47 family protein	plate	A9YX12	Burkholderia_phage	93.9	1.1e-200
WP_069264328.1|3867941_3868604_+	DUF2612 domain-containing protein	NA	A9YX13	Burkholderia_phage	85.5	3.8e-107
WP_069264330.1|3868667_3870080_+	hypothetical protein	NA	A9YX14	Burkholderia_phage	28.2	2.4e-13
WP_172820436.1|3870128_3871133_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_069264334.1|3871206_3871605_+|tail	phage tail assembly chaperone	tail	A0A291LAV4	Bordetella_phage	37.8	5.4e-08
WP_059475787.1|3871664_3871847_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069264335.1|3871839_3872337_+	lysozyme	NA	Q3HQU9	Burkholderia_phage	90.9	3.2e-82
WP_069264336.1|3872333_3872882_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069264339.1|3872878_3873358_+	DUF2514 family protein	NA	Q6J1Q4	Burkholderia_virus	47.1	8.2e-27
WP_069224189.1|3873327_3873654_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069264899.1|3873735_3874407_+	SOS response-associated peptidase family protein	NA	Q8W6R8	Burkholderia_virus	72.5	2.1e-97
>prophage 11
NZ_CP013433	Burkholderia vietnamiensis strain AU1233 chromosome 1, complete sequence	5577538	4016470	4104786	5577538	head,holin,protease,portal,capsid,tail,terminase	Burkholderia_phage(35.56%)	97	NA	NA
WP_069264399.1|4016470_4017277_-|protease	YhfC family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_046427002.1|4017330_4018374_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	29.1	5.1e-13
WP_069264915.1|4018666_4019632_-	bifunctional glyoxylate/hydroxypyruvate reductase B	NA	M1I539	Acanthocystis_turfacea_Chlorella_virus	27.7	4.4e-19
WP_011884906.1|4019637_4020918_-	MFS transporter	NA	NA	NA	NA	NA
WP_069264401.1|4021081_4022083_-	sugar kinase	NA	NA	NA	NA	NA
WP_059568172.1|4022111_4022876_-	xylose isomerase	NA	NA	NA	NA	NA
WP_011884909.1|4023142_4024036_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011884910.1|4024146_4025220_+	YeiH family putative sulfate export transporter	NA	NA	NA	NA	NA
WP_014723072.1|4025287_4027069_+	ClcB-like voltage-gated chloride channel protein	NA	NA	NA	NA	NA
WP_011884912.1|4027238_4027859_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014723073.1|4028049_4029159_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_011884914.1|4029155_4032305_+	efflux RND transporter permease subunit	NA	S5VL66	Leptospira_phage	18.4	4.2e-10
WP_069264402.1|4032307_4033891_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_011884917.1|4034869_4036255_-	sigma 54-interacting transcriptional regulator	NA	NA	NA	NA	NA
WP_034193156.1|4036504_4037389_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_069264404.1|4037431_4039099_+	TIGR01244 family phosphatase	NA	NA	NA	NA	NA
WP_011884920.1|4039117_4039924_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_011884921.1|4040064_4040886_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_041493835.1|4040882_4041812_-	ABC transporter permease subunit	NA	Q6GZ02	Mycoplasma_phage	22.0	1.1e-06
WP_011884923.1|4041808_4042969_-	polyamine ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	34.3	1.6e-23
WP_011884924.1|4043055_4044150_-	polyamine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_011884925.1|4044658_4044862_+	DUF1289 domain-containing protein	NA	NA	NA	NA	NA
WP_069264406.1|4045081_4045723_-	OmpW family protein	NA	NA	NA	NA	NA
WP_011884927.1|4045788_4046979_-	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_045579084.1|4047102_4048539_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_011884929.1|4048798_4049164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011884930.1|4049195_4049660_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_069264408.1|4049793_4050840_+	zinc-dependent alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_069264410.1|4051013_4052606_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	26.5	1.2e-53
WP_069224220.1|4052734_4054996_-	AsmA family protein	NA	NA	NA	NA	NA
WP_011884934.1|4055148_4055850_+	ATP-binding cassette domain-containing protein	NA	A0A1V0SE00	Indivirus	25.0	7.6e-05
WP_011884935.1|4055846_4056650_+	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_014723082.1|4056833_4057385_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069264916.1|4057552_4058569_-	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_014723084.1|4058692_4059634_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014723085.1|4059770_4060616_+	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_034193170.1|4060700_4061885_-	cystathionine beta-lyase	NA	NA	NA	NA	NA
WP_059462604.1|4061994_4062537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011884942.1|4062598_4063525_-	sugar kinase	NA	NA	NA	NA	NA
WP_069264411.1|4063528_4064914_-	30S ribosomal protein S12 methylthiotransferase RimO	NA	NA	NA	NA	NA
WP_069264918.1|4064928_4066557_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	66.1	7.0e-203
WP_155772614.1|4066582_4067356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069264415.1|4067407_4068079_-	SOS response-associated peptidase family protein	NA	Q8W6R8	Burkholderia_virus	72.2	1.6e-97
WP_172820438.1|4068244_4068412_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059495943.1|4068455_4069292_-	hypothetical protein	NA	Q3HQV2	Burkholderia_phage	44.1	1.2e-49
WP_069264919.1|4069453_4070092_-	hypothetical protein	NA	Q775E2	Bordetella_phage	41.4	6.2e-22
WP_069264416.1|4070091_4070574_-	hypothetical protein	NA	Q775E1	Bordetella_phage	57.0	2.7e-46
WP_069264417.1|4070575_4070860_-|holin	phage holin family protein	holin	C7BGD7	Burkholderia_phage	78.3	8.6e-32
WP_069264418.1|4070923_4071238_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069264420.1|4071278_4071992_-	hypothetical protein	NA	A4JX18	Burkholderia_virus	47.1	1.0e-49
WP_172820439.1|4071991_4072300_-	hypothetical protein	NA	Q3HQU6	Burkholderia_phage	51.0	1.1e-21
WP_069264424.1|4072299_4075692_-|tail	phage tail protein	tail	A4JX16	Burkholderia_virus	64.0	0.0e+00
WP_069264426.1|4075693_4076269_-|tail	tail assembly protein	tail	Q6JIL3	Burkholderia_virus	69.2	3.6e-69
WP_069264428.1|4076272_4077016_-	C40 family peptidase	NA	A4JX14	Burkholderia_virus	72.1	1.5e-107
WP_069264430.1|4077063_4077750_-|tail	phage minor tail protein L	tail	Q6JIL5	Burkholderia_virus	73.8	1.7e-94
WP_155772615.1|4077755_4078847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034193082.1|4078843_4079185_-|tail	phage tail protein	tail	C7BGC9	Burkholderia_phage	58.2	5.1e-31
WP_069264434.1|4079185_4082029_-|tail	phage tail tape measure protein	tail	Q6JIL8	Burkholderia_virus	34.6	1.3e-55
WP_081333235.1|4082021_4082462_-	HK97 gp10 family phage protein	NA	A0A1W6JP15	Morganella_phage	34.0	1.9e-09
WP_155770210.1|4082454_4082688_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034193080.1|4082747_4083170_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069264436.1|4083209_4083848_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_060043783.1|4083893_4084295_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_059895682.1|4084287_4084617_-|head	phage head closure protein	head	NA	NA	NA	NA
WP_069264438.1|4084616_4085291_-|head,tail	phage head-tail connector protein	head,tail	NA	NA	NA	NA
WP_069264439.1|4085294_4085573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069264441.1|4085636_4086893_-|capsid	phage major capsid protein	capsid	C7BGH0	Burkholderia_phage	51.8	8.3e-103
WP_172820440.1|4086987_4087719_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	C7BGG9	Burkholderia_phage	55.3	1.2e-48
WP_059461708.1|4087727_4089086_-|portal	phage portal protein	portal	C7BGG8	Burkholderia_phage	36.4	2.5e-68
WP_059723478.1|4089082_4090738_-|terminase	terminase large subunit	terminase	A0A0P0ZEI4	Stx2-converting_phage	71.6	1.5e-232
WP_059495983.1|4090741_4091224_-|terminase	terminase small subunit	terminase	Q3HQS6	Burkholderia_phage	60.3	7.5e-36
WP_051974407.1|4091337_4091598_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_069264447.1|4091679_4092027_-	hypothetical protein	NA	A2I2Y8	Vibrio_virus	63.2	1.3e-29
WP_059461704.1|4092133_4092712_-	hypothetical protein	NA	Q3HR05	Burkholderia_phage	35.4	3.1e-20
WP_059461703.1|4092766_4093012_-	hypothetical protein	NA	Q3HR04	Burkholderia_phage	46.9	1.1e-11
WP_155632423.1|4093008_4093323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155772659.1|4093307_4093745_-	DUF1364 family protein	NA	Q6JIF7	Burkholderia_virus	80.9	3.2e-62
WP_059461701.1|4093777_4094032_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069264451.1|4094028_4094385_-	DUF4406 domain-containing protein	NA	H2BD42	Pseudomonas_phage	53.8	6.1e-27
WP_034193065.1|4094381_4094729_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_069264453.1|4094728_4095292_-	DUF1064 domain-containing protein	NA	A4JX56	Burkholderia_virus	55.3	9.7e-43
WP_069264924.1|4095288_4096281_-	helix-turn-helix domain-containing protein	NA	Q8W6P0	Burkholderia_virus	66.2	8.3e-106
WP_034193063.1|4096292_4097114_-	ParB N-terminal domain-containing protein	NA	Q6JIG3	Burkholderia_virus	56.6	9.4e-71
WP_155772616.1|4097124_4097301_-	hypothetical protein	NA	Q3HQZ4	Burkholderia_phage	39.7	7.2e-05
WP_069264455.1|4097297_4097987_-	phage antirepressor KilAC domain-containing protein	NA	A0A1V1FD44	Vibrio_phage	44.0	2.0e-42
WP_034193061.1|4097987_4098434_-	phage regulatory CII family protein	NA	Q3HQZ3	Burkholderia_phage	77.7	5.1e-63
WP_155623504.1|4098565_4098733_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069264459.1|4098734_4098965_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155772617.1|4099191_4099461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081333236.1|4099462_4099759_-	helix-turn-helix domain-containing protein	NA	C7BGF8	Burkholderia_phage	86.5	3.4e-31
WP_081333267.1|4099844_4100246_+	hypothetical protein	NA	C7BGF7	Burkholderia_phage	70.7	1.1e-45
WP_155772618.1|4100652_4101534_-	hypothetical protein	NA	A0A0R6PIN1	Moraxella_phage	28.4	6.4e-25
WP_155745021.1|4101496_4101691_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059895642.1|4102024_4102291_+	acyl carrier protein	NA	A0A1P8VVJ5	Erythrobacter_phage	39.4	7.6e-06
WP_069264464.1|4103087_4103768_-	hypothetical protein	NA	A4JX33	Burkholderia_virus	62.1	1.1e-11
WP_069264466.1|4103800_4104514_+	hypothetical protein	NA	O03965	Myxococcus_phage	45.2	5.5e-51
WP_069264468.1|4104510_4104786_+	hypothetical protein	NA	Q3HQV5	Burkholderia_phage	64.7	9.2e-23
>prophage 1
NZ_CP013434	Burkholderia vietnamiensis strain AU1233 chromosome 2, complete sequence	1257529	183292	273280	1257529	transposase,integrase,plate	uncultured_Caudovirales_phage(15.0%)	74	212716:212742	250248:250274
WP_043291147.1|183292_184498_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_034193888.1|184814_186695_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_069264971.1|186823_189823_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_045579752.1|189822_190692_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_034193885.1|190735_191179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006482386.1|191244_191703_+	DUF1795 domain-containing protein	NA	NA	NA	NA	NA
WP_045579751.1|191724_195972_+	RHS domain-containing protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	52.2	1.2e-28
WP_081333279.1|195981_196506_+	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_081333280.1|196575_197001_+	RhsIA family immunity protein	NA	NA	NA	NA	NA
WP_081333281.1|197194_197797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059475982.1|199293_199758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069264974.1|199949_201488_+|transposase	IS3-like element ISBmu11 family transposase	transposase	A0A1B1P773	Bacillus_phage	35.2	2.8e-44
WP_045579749.1|203947_204769_+	type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein	NA	NA	NA	NA	NA
WP_045579748.1|204752_205709_+	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_106919311.1|207317_208555_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	98.2	1.1e-160
WP_081333162.1|208553_209342_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_069263160.1|209338_210316_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_069263164.1|210312_211344_+|integrase	site-specific integrase	integrase	A0A076YL28	Mesorhizobium_phage	27.9	4.3e-12
212716:212742	attL	TGCGTATTTCGGACGAACGTGACCGGC	NA	NA	NA	NA
WP_069224829.1|212883_214407_+|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	52.8	2.9e-150
WP_059476177.1|214419_215187_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	53.3	2.5e-70
WP_155625324.1|215613_215778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069224830.1|216539_217583_+	DUF1016 family protein	NA	Q9JMP5	Wolbachia_phage	52.5	2.3e-106
WP_172820468.1|218018_218333_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_126221127.1|218610_219072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_126221126.1|219119_219566_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155625382.1|219579_219831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069264976.1|219864_220089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081333285.1|220130_220406_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_069264977.1|220417_220738_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_069264979.1|220731_220980_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_069264981.1|221106_221778_-|integrase	site-specific integrase	integrase	A0A1W6DWU1	Sphingobium_phage	29.0	3.1e-11
WP_045579170.1|221941_222268_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_069264983.1|222398_223310_+	SOS response-associated peptidase family protein	NA	NA	NA	NA	NA
WP_155772662.1|223871_224213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059896631.1|224445_225447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069265114.1|225421_228130_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	27.1	1.0e-49
WP_155624630.1|228411_228831_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059889025.1|228911_229637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059889026.1|229767_230544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059889027.1|230574_230832_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155772663.1|231372_231834_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081062961.1|233360_233564_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069264987.1|234099_235797_-	MCP four helix bundle domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	28.9	2.2e-18
WP_045579527.1|236007_237198_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_081062960.1|239570_240080_+	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	67.1	1.5e-26
WP_011880233.1|239963_240317_-	BON domain-containing protein	NA	NA	NA	NA	NA
WP_069264988.1|241050_242124_+	VIT1/CCC1 transporter family protein	NA	NA	NA	NA	NA
WP_080938712.1|242214_242637_+	DUF3331 domain-containing protein	NA	NA	NA	NA	NA
WP_162486633.1|242525_242828_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_081333301.1|243797_244556_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_069264994.1|244710_245559_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_069265118.1|245800_246829_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_069264996.1|246899_247730_-	oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	24.9	1.3e-08
WP_069264999.1|248092_248563_+	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_081333286.1|248660_249632_+	patatin-like phospholipase family protein	NA	A0A141ZNL4	Faustovirus	27.6	4.3e-06
WP_155772664.1|251025_251376_-	hypothetical protein	NA	NA	NA	NA	NA
250248:250274	attR	TGCGTATTTCGGACGAACGTGACCGGC	NA	NA	NA	NA
WP_171026924.1|251442_252640_+|transposase	IS3 family transposase	transposase	A0A1B0Z042	Pseudomonas_phage	65.5	3.9e-102
WP_155772665.1|252996_253203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081333287.1|253446_253650_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_069265002.1|253683_253998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069265003.1|254506_254776_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069265123.1|254930_255569_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_069265004.1|255919_257467_-	GGDEF domain-containing protein	NA	A9J564	Pseudomonas_phage	35.8	9.9e-05
WP_069265006.1|257991_259473_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	34.7	4.5e-15
WP_069265124.1|259997_261071_-	GlxA family transcriptional regulator	NA	NA	NA	NA	NA
WP_069265126.1|261369_262626_-	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_069265008.1|262951_263869_-	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	28.6	2.9e-20
WP_069265009.1|264016_264919_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_011880273.1|264963_267945_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	26.6	1.2e-80
WP_011880272.1|268344_269400_-	NAD(P)/FAD-dependent oxidoreductase	NA	G3MA85	Bacillus_virus	26.2	2.6e-12
WP_080938715.1|269904_270612_+	succinate dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_011880269.1|271043_271256_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069263239.1|271464_271716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069264828.1|271750_273280_-|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	46.1	2.7e-124
>prophage 2
NZ_CP013434	Burkholderia vietnamiensis strain AU1233 chromosome 2, complete sequence	1257529	276748	372671	1257529	transposase,protease,integrase	Acinetobacter_phage(14.29%)	83	277042:277060	373654:373669
WP_155772666.1|276748_277922_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	47.5	1.9e-72
277042:277060	attL	GTCGCGGTGAAGTACGGCG	NA	NA	NA	NA
WP_081333288.1|277885_278488_-	hemerythrin domain-containing protein	NA	NA	NA	NA	NA
277042:277060	attL	GTCGCGGTGAAGTACGGCG	NA	NA	NA	NA
WP_011880262.1|278513_279713_-	NnrS family protein	NA	NA	NA	NA	NA
WP_011880261.1|279709_280222_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_011880260.1|280668_282360_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_155772667.1|282367_282610_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069265014.1|282787_283903_-	glycine betaine/L-proline ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.6	1.9e-29
WP_069227432.1|283895_284783_-	proline/glycine betaine ABC transporter permease	NA	NA	NA	NA	NA
WP_069265016.1|284850_286176_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_069265018.1|286194_287088_-	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_069265020.1|287092_288592_-	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_172820476.1|288653_289373_-	FCD domain-containing protein	NA	NA	NA	NA	NA
WP_069265024.1|290013_291144_+	hybrid-cluster NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_081333289.1|291211_292441_+	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_069265026.1|292499_293702_+	formaldehyde dehydrogenase, glutathione-independent	NA	A0A2P1ELD9	Moumouvirus	29.2	1.9e-11
WP_081333290.1|294156_294585_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_069265028.1|294581_296534_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_069265030.1|296530_298432_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081059964.1|298842_299370_-	TniQ family protein	NA	NA	NA	NA	NA
WP_009687734.1|299347_300217_-	TniB family NTP-binding protein	NA	NA	NA	NA	NA
WP_069265133.1|300225_301854_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_011880259.1|302111_302462_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059890401.1|302501_303449_-|transposase	IS5-like element ISBvi6 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	43.3	2.1e-58
WP_011880257.1|303535_304315_-	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_011880256.1|304315_305494_-	acetate/propionate family kinase	NA	NA	NA	NA	NA
WP_011880255.1|305505_306447_-	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_012464895.1|306455_306650_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011880254.1|306697_308926_-	DUF3141 domain-containing protein	NA	NA	NA	NA	NA
WP_081061566.1|309050_310577_-	TolC family protein	NA	NA	NA	NA	NA
WP_011880252.1|310584_311712_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_011880251.1|311714_314543_-	ribosome-associated ATPase/putative transporter RbbA	NA	A0A2H4PQG7	Staphylococcus_phage	32.2	1.6e-24
WP_011880250.1|314546_315545_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
315362:315380	attR	CGCCGTACTTCACCGCGAC	NA	NA	NA	NA
WP_134206856.1|315548_315902_-	hypothetical protein	NA	NA	NA	NA	NA
315362:315380	attR	CGCCGTACTTCACCGCGAC	NA	NA	NA	NA
WP_011880249.1|316342_317374_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_043292645.1|317417_318281_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011880246.1|318701_319880_-	acetate/propionate family kinase	NA	NA	NA	NA	NA
WP_105772918.1|319936_320533_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011880244.1|320666_321416_-	acetoacetyl-CoA reductase	NA	A0A0K0KVL6	Prochlorococcus_phage	26.1	7.4e-06
WP_011880243.1|321417_321870_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060081749.1|322168_322966_-	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	37.2	4.4e-33
WP_011880242.1|322958_324464_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	30.8	5.4e-16
WP_007182911.1|325019_325820_-	cytochrome c4	NA	NA	NA	NA	NA
WP_011880241.1|325816_327442_-	b(o/a)3-type cytochrome-c oxidase subunit 1	NA	NA	NA	NA	NA
WP_011880240.1|327431_328019_-	cytochrome c oxidase subunit II	NA	NA	NA	NA	NA
WP_007182914.1|328029_328230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007182915.1|328239_329583_-	cytochrome c	NA	NA	NA	NA	NA
WP_007182916.1|329579_330287_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_011880238.1|331174_331813_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_011880236.1|332472_332772_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_012218130.1|332873_333368_+	response regulator	NA	NA	NA	NA	NA
WP_155121928.1|333600_334687_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	35.2	3.2e-42
WP_081061553.1|335009_335432_-	DUF3331 domain-containing protein	NA	NA	NA	NA	NA
WP_011880234.1|335524_336598_-	VIT1/CCC1 transporter family protein	NA	NA	NA	NA	NA
WP_011880233.1|337331_337685_+	BON domain-containing protein	NA	NA	NA	NA	NA
WP_069265033.1|338768_340250_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	35.2	4.1e-16
WP_011885805.1|340311_340854_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_011880229.1|340829_341111_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	32.1	5.0e-08
WP_155625227.1|342171_342988_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_155121863.1|342997_344172_-|transposase	IS3-like element ISBvi4 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	48.9	6.9e-75
WP_011880225.1|344538_345066_-	TniQ family protein	NA	NA	NA	NA	NA
WP_011880224.1|345043_345913_-	TniB family NTP-binding protein	NA	NA	NA	NA	NA
WP_085954470.1|346562_347379_+|transposase	IS5-like element ISBcen20 family transposase	transposase	NA	NA	NA	NA
WP_043292639.1|348852_349104_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011880221.1|349299_349602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011880220.1|349633_350593_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_011880219.1|350589_351723_-	nucleotide-binding protein	NA	NA	NA	NA	NA
WP_011880218.1|351712_352120_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011880217.1|352407_352746_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_011880216.1|352771_353188_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_105784261.1|353966_354266_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011880212.1|357514_357880_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155772669.1|358483_358687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106919343.1|358933_359751_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_126221109.1|359909_360473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155768328.1|360475_361147_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106919311.1|361073_362310_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	98.2	1.1e-160
WP_155768329.1|362367_363294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081333292.1|363191_365225_+|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_069224914.1|365351_367451_+	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	28.2	4.0e-41
WP_059475418.1|367462_368881_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_126221193.1|368912_370346_+	TolC family protein	NA	NA	NA	NA	NA
WP_126221107.1|370472_370877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046424735.1|370973_372671_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
373654:373669	attR	CGCGGCGCGAATCACG	NA	NA	NA	NA
