The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP013435	Burkholderia latens strain AU17928 isolate AU17928 chromosome 1, complete sequence	3331737	47719	98990	3331737	plate,tail,integrase,tRNA	Pseudomonas_phage(25.0%)	43	97400:97441	105233:105274
WP_040143246.1|47719_49018_+|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_040143244.1|49100_50183_+	peptide chain release factor 1	NA	A0A0S4KWG0	Pseudomonas_phage	46.6	6.7e-08
WP_040143242.1|50190_51033_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_006477066.1|51100_51412_+	Grx4 family monothiol glutaredoxin	NA	NA	NA	NA	NA
WP_069240785.1|51425_52022_+	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
WP_059545386.1|52231_53023_+	dioxygenase	NA	NA	NA	NA	NA
WP_040143236.1|53141_54740_-	APC family permease	NA	NA	NA	NA	NA
WP_006477070.1|55159_55363_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	71.6	1.4e-20
WP_040143234.1|55468_56719_-	Hsp70 family protein	NA	NA	NA	NA	NA
WP_059545390.1|56916_57522_-	nitroreductase family protein	NA	NA	NA	NA	NA
WP_040143230.1|57693_58977_-	MFS transporter	NA	NA	NA	NA	NA
WP_069240786.1|59193_59829_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_069240787.1|59911_60484_+	DUF1415 domain-containing protein	NA	NA	NA	NA	NA
WP_069240788.1|60556_61447_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_040143222.1|61536_62670_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_040143220.1|62819_63314_-	LEA type 2 family protein	NA	NA	NA	NA	NA
WP_069240789.1|63956_66125_+	peptidase M1	NA	A0A0P0IY26	Acinetobacter_phage	26.4	1.2e-48
WP_059545400.1|66223_67252_-	transporter	NA	NA	NA	NA	NA
WP_069240790.1|67456_68434_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_040143215.1|68555_69401_+	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_069240791.1|69702_73641_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_040143211.1|73637_74627_+	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
WP_040143209.1|74631_75597_+	OmpA family protein	NA	NA	NA	NA	NA
WP_040143207.1|76011_77133_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_069240792.1|77172_79839_-	type VI secretion system ATPase TssH	NA	A0A223W0B1	Agrobacterium_phage	31.9	2.9e-89
WP_059545409.1|79883_80984_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_069240793.1|80947_82780_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_040143199.1|82857_83343_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_040143197.1|83405_83909_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_040143195.1|83979_85470_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_040143193.1|85485_86001_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_059545411.1|86050_86686_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_040143189.1|87061_87673_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_040143187.1|87776_89123_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_059545413.1|89119_89902_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_059545415.1|89987_90305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040143179.1|91585_92386_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_040143177.1|92498_92702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069240795.1|93085_94021_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_069240796.1|94397_95834_+	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_040143172.1|95846_96224_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_069240797.1|96220_97216_+	NAD(P)H-quinone oxidoreductase	NA	NA	NA	NA	NA
97400:97441	attL	CGGCTGCAGGACTCGAACCCGCCACCTGATGATTACAAATCA	NA	NA	NA	NA
WP_069240798.1|97625_98990_+|integrase	integrase family protein	integrase	NA	NA	NA	NA
WP_069240798.1|97625_98990_+|integrase	integrase family protein	integrase	NA	NA	NA	NA
105233:105274	attR	CGGCTGCAGGACTCGAACCCGCCACCTGATGATTACAAATCA	NA	NA	NA	NA
>prophage 2
NZ_CP013435	Burkholderia latens strain AU17928 isolate AU17928 chromosome 1, complete sequence	3331737	331929	396220	3331737	terminase,plate,holin,head,capsid,transposase,tail,integrase	Burkholderia_phage(85.42%)	69	389395:389445	399278:399328
WP_069240860.1|331929_333741_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_083252942.1|333792_334044_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_069240861.1|334055_334787_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082721606.1|336089_336365_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_083252943.1|336420_337164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069240864.1|337214_337952_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069241907.1|338002_338740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069240865.1|338790_339534_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069240866.1|339584_340328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156788993.1|340330_343192_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069240867.1|343212_344220_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_069240868.1|344224_346756_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	30.9	3.7e-33
WP_167432629.1|347043_347187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167432633.1|347916_348090_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069240870.1|348093_348900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069240871.1|348979_349216_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069240872.1|349646_350282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_135801118.1|351342_352552_+|transposase	IS3 family transposase	transposase	A0A1B0Z042	Pseudomonas_phage	63.1	1.6e-98
WP_069240873.1|354363_354771_+|transposase	transposase	transposase	B6DZU5	Stx2-converting_phage	37.2	1.6e-15
WP_006764055.1|354767_355115_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	72.9	1.2e-40
WP_069240874.1|355144_356707_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	54.5	4.6e-151
WP_059524049.1|356747_357344_+	plasmid pRiA4b ORF-3 family protein	NA	A0A2H4PDG5	Mycobacterium_phage	38.6	4.6e-27
WP_069240875.1|358007_359759_-	oxidoreductase	NA	E5E3S6	Burkholderia_phage	89.1	0.0e+00
WP_059459482.1|359903_360728_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S5NPS0	Burkholderia_phage	90.9	1.5e-132
WP_059459483.1|360763_361783_+|capsid	phage major capsid protein, P2 family	capsid	A0A1S5NPT2	Burkholderia_phage	90.6	3.0e-175
WP_069240876.1|361779_362466_+|terminase	terminase endonuclease subunit	terminase	A0A1S5NNA5	Burkholderia_phage	96.9	5.3e-120
WP_069240877.1|362570_363053_+|head	head completion/stabilization protein	head	A0A1S5NNA6	Burkholderia_phage	92.5	6.5e-80
WP_069240878.1|363052_363265_+|tail	tail protein X	tail	A0A1S5NR68	Burkholderia_phage	95.7	7.6e-33
WP_012327676.1|363267_363642_+|holin	phage holin family protein	holin	A0A1S5NRL1	Burkholderia_phage	100.0	7.8e-57
WP_069240879.1|363641_363962_+|holin	phage holin family protein	holin	A0A1S5NTF8	Burkholderia_phage	95.3	1.0e-49
WP_069240880.1|363954_364755_+	DUF3380 domain-containing protein	NA	A0A1S5NV50	Burkholderia_phage	96.6	1.3e-138
WP_069240881.1|364751_365243_+	hypothetical protein	NA	A0A1S5NQ26	Burkholderia_phage	94.5	2.9e-75
WP_069240882.1|365239_365650_+|tail	phage tail protein	tail	A0A1S5NPS3	Burkholderia_phage	96.3	2.0e-69
WP_069240883.1|365649_366099_+	phage virion morphogenesis protein	NA	A0A1S5NPT5	Burkholderia_phage	93.3	5.3e-68
WP_069240884.1|366249_367626_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_069240885.1|367847_368555_+|plate	phage baseplate assembly protein V	plate	A0A1S5NNH1	Burkholderia_phage	83.8	1.2e-95
WP_069240886.1|368551_368917_+	GPW/gp25 family protein	NA	A0A1S5NNH3	Burkholderia_phage	93.4	2.0e-57
WP_069240887.1|368913_369819_+|plate	baseplate J/gp47 family protein	plate	A0A1S5NR72	Burkholderia_phage	97.3	9.1e-160
WP_069240888.1|369811_370363_+|tail	phage tail protein I	tail	A0A1S5NRL9	Burkholderia_phage	97.3	4.9e-100
WP_069240889.1|370368_371928_+|tail	phage tail protein	tail	A0A1S5NTG6	Burkholderia_phage	38.2	9.2e-51
WP_069240890.1|371924_372356_+|tail	phage tail assembly chaperone	tail	R4JMH4	Burkholderia_phage	78.3	3.6e-58
WP_014724672.1|372415_372754_+	hypothetical protein	NA	A0A1S5NQ35	Burkholderia_phage	57.1	1.4e-25
WP_081052976.1|372903_373086_+	Com family DNA-binding transcriptional regulator	NA	A0A1S5NPS9	Burkholderia_phage	98.3	8.2e-28
WP_069240891.1|373063_373813_+	site-specific DNA-methyltransferase	NA	A0A1S5NPU0	Burkholderia_phage	96.0	1.5e-139
WP_069240892.1|373924_375097_+|tail	phage tail sheath protein	tail	A0A1S5NNH8	Burkholderia_phage	95.1	2.7e-220
WP_014724668.1|375126_375636_+|tail	phage major tail tube protein	tail	E5E3Q2	Burkholderia_phage	92.9	1.2e-87
WP_059606529.1|375668_375980_+|tail	phage tail assembly protein	tail	A0A1S5NNH9	Burkholderia_phage	91.2	1.4e-43
WP_014724666.1|375979_376099_+|tail	GpE family phage tail protein	tail	A0A1S5NR79	Burkholderia_phage	100.0	6.1e-16
WP_069240893.1|376095_378858_+	hypothetical protein	NA	E5E3P9	Burkholderia_phage	85.8	0.0e+00
WP_006757087.1|378871_379300_+|tail	phage tail protein	tail	A0A1S5NTH4	Burkholderia_phage	97.2	1.5e-72
WP_069240894.1|379296_380448_+	phage late control D family protein	NA	A0A1S5NV58	Burkholderia_phage	97.1	6.1e-193
WP_069240895.1|380529_381012_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083252945.1|381064_381862_-	alpha/beta hydrolase	NA	A0A1S5NPT4	Burkholderia_phage	70.7	1.6e-67
WP_069240896.1|381916_382372_-	helix-turn-helix domain-containing protein	NA	A0A1S5NPU3	Burkholderia_phage	88.2	3.5e-67
WP_006757082.1|382695_382974_+	hypothetical protein	NA	A0A1S5NNI6	Burkholderia_phage	100.0	1.4e-47
WP_069240897.1|382985_383234_+	ogr/Delta-like zinc finger family protein	NA	A0A1S5NNI9	Burkholderia_phage	96.3	4.4e-40
WP_069240898.1|383322_383517_+	hypothetical protein	NA	A0A1S5NR87	Burkholderia_phage	90.6	1.5e-24
WP_069240899.1|383521_383716_+	hypothetical protein	NA	E5E3T6	Burkholderia_phage	60.9	2.9e-15
WP_069241909.1|383759_383954_+	hypothetical protein	NA	E5E3T5	Burkholderia_phage	90.6	3.6e-21
WP_069240900.1|383957_384320_+	hypothetical protein	NA	A0A1S5NQ52	Burkholderia_phage	92.5	1.9e-44
WP_069240901.1|384316_384565_+	hypothetical protein	NA	A0A1S5NPT7	Burkholderia_phage	80.5	8.6e-28
WP_069240902.1|384567_387363_+	toprim domain-containing protein	NA	A0A1S5NPU9	Burkholderia_phage	97.0	0.0e+00
WP_174554661.1|387683_388046_+	hypothetical protein	NA	A0A1S5NNJ0	Burkholderia_phage	71.0	2.1e-14
WP_069240903.1|388253_389330_+|integrase	site-specific integrase	integrase	A0A1S5NNJ1	Burkholderia_phage	98.3	1.5e-206
389395:389445	attL	TTGGCGCGCCCGGCTGGGATCGAACCAGCAACCCCTGCCTTCGGAGGGCAG	NA	NA	NA	NA
WP_069240904.1|389576_390716_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_083252946.1|390730_390997_-	pyocin activator PrtN family protein	NA	I6NSR8	Burkholderia_phage	69.5	3.9e-26
WP_083252947.1|391486_392437_-	hypothetical protein	NA	A0A2I7S9G1	Vibrio_phage	32.1	1.7e-36
WP_069240907.1|392642_393881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069241900.1|394714_396220_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
399278:399328	attR	TTGGCGCGCCCGGCTGGGATCGAACCAGCAACCCCTGCCTTCGGAGGGCAG	NA	NA	NA	NA
>prophage 3
NZ_CP013435	Burkholderia latens strain AU17928 isolate AU17928 chromosome 1, complete sequence	3331737	1064082	1072385	3331737		Bacillus_phage(16.67%)	8	NA	NA
WP_069241112.1|1064082_1065483_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	38.3	6.7e-77
WP_083252959.1|1065490_1066441_+	D-glycero-beta-D-manno-heptose-7-phosphate kinase	NA	A0A2H4N7X4	Lake_Baikal_phage	27.8	1.0e-15
WP_059543826.1|1066505_1067498_+	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	31.2	5.3e-28
WP_040143699.1|1067571_1067916_+	helix-hairpin-helix domain-containing protein	NA	NA	NA	NA	NA
WP_040143700.1|1068134_1069037_+	cysteine synthase CysM	NA	A0A1X9I5F1	Streptococcus_phage	40.2	9.7e-53
WP_059543825.1|1069127_1070351_-	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_040143702.1|1070521_1071445_+	histone deacetylase family protein	NA	A0A2K9KZC4	Tupanvirus	35.2	4.6e-42
WP_069241114.1|1071467_1072385_-	alpha/beta hydrolase	NA	A7XCB7	Tanapox_virus	27.0	2.0e-21
>prophage 4
NZ_CP013435	Burkholderia latens strain AU17928 isolate AU17928 chromosome 1, complete sequence	3331737	1260652	1299933	3331737	plate,terminase,head,tail,integrase	Burkholderia_phage(21.62%)	61	1254763:1254780	1271395:1271412
1254763:1254780	attL	GCGCGAGCGCGGCGGCCG	NA	NA	NA	NA
WP_069241172.1|1260652_1261684_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B1P9F9	Acinetobacter_phage	35.7	9.1e-47
WP_069241173.1|1261680_1261902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069241174.1|1261901_1262264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156789005.1|1262266_1262458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069241176.1|1262511_1262913_-	ASCH domain-containing protein	NA	A0A2H4IB20	Erwinia_phage	38.4	1.6e-15
WP_069241177.1|1263369_1264413_-	hypothetical protein	NA	B5TA88	Burkholderia_phage	66.1	2.9e-16
WP_083252962.1|1264427_1265102_-	DNA cytosine methyltransferase	NA	A0A0H5AU88	Pseudomonas_phage	59.6	3.8e-70
WP_069241178.1|1265285_1265873_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069241933.1|1265900_1266581_-	YqaJ viral recombinase family protein	NA	A0A0U2BXF3	Paracoccus_phage	38.5	6.0e-31
WP_069241179.1|1266573_1267425_-	hypothetical protein	NA	A0A2H4J1F0	uncultured_Caudovirales_phage	56.8	8.5e-59
WP_069241181.1|1268793_1269000_-	hypothetical protein	NA	Q3HQW6	Burkholderia_phage	55.2	1.5e-09
WP_069241182.1|1269001_1269496_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_069241183.1|1269492_1269831_-	hypothetical protein	NA	Q3HQW8	Burkholderia_phage	64.9	3.1e-12
WP_069241184.1|1269879_1270062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069241185.1|1270090_1270312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069241186.1|1270447_1270903_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156789006.1|1271086_1271455_-	hypothetical protein	NA	NA	NA	NA	NA
1271395:1271412	attR	GCGCGAGCGCGGCGGCCG	NA	NA	NA	NA
WP_167432637.1|1271475_1272201_-	hypothetical protein	NA	A4JX44	Burkholderia_virus	40.2	5.6e-11
WP_156789007.1|1272226_1272610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069241190.1|1272606_1272843_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069241191.1|1272839_1273049_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069241192.1|1273125_1273593_+	hypothetical protein	NA	A0A2D1GMW7	Marinobacter_phage	50.7	1.6e-35
WP_069241193.1|1273589_1274624_+	DUF1376 domain-containing protein	NA	A9YWY6	Burkholderia_phage	65.8	8.8e-58
WP_069241194.1|1274627_1275542_+	hypothetical protein	NA	A0A0U1UNR3	Pseudomonas_phage	44.3	6.4e-20
WP_069241195.1|1275538_1275730_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069241196.1|1275726_1276062_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156789008.1|1276058_1276265_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069241197.1|1276261_1276582_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069241198.1|1276575_1277046_+	RusA family crossover junction endodeoxyribonuclease	NA	Q8SDG7	Lactococcus_phage	34.6	6.7e-05
WP_069241199.1|1277047_1277233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156789009.1|1277234_1277405_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156789010.1|1277401_1277578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069241200.1|1277574_1277865_+	hypothetical protein	NA	E5FFF4	Burkholderia_phage	55.4	2.8e-14
WP_069241934.1|1277954_1278389_+	hypothetical protein	NA	A0A1W6DY69	Salmonella_phage	43.0	5.5e-22
WP_156789011.1|1278428_1278629_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083252963.1|1278642_1280109_+|terminase	PBSX family phage terminase large subunit	terminase	A0A2I7R3U9	Vibrio_phage	46.0	1.3e-115
WP_069241201.1|1280157_1280691_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069241202.1|1280708_1282340_+	DUF1073 domain-containing protein	NA	A0A2R3UAL5	Myoviridae_environmental_samples	35.6	8.9e-73
WP_069241203.1|1282339_1283149_+|head	phage head morphogenesis protein	head	H9C0V1	Aeromonas_phage	44.2	1.3e-48
WP_156789012.1|1283126_1284365_+	DUF2213 domain-containing protein	NA	A0A219YCD3	Aeromonas_phage	34.7	3.0e-44
WP_069241205.1|1284377_1284854_+	hypothetical protein	NA	A0A077KAW3	Edwardsiella_phage	40.5	2.0e-20
WP_069241206.1|1284850_1285861_+	DUF2184 domain-containing protein	NA	A0A219YBB0	Aeromonas_phage	46.5	2.8e-69
WP_069241207.1|1285862_1286273_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069241208.1|1286269_1286692_+	DUF4054 domain-containing protein	NA	NA	NA	NA	NA
WP_069241209.1|1286678_1287140_+	hypothetical protein	NA	A0A190XCA2	Acinetobacter_phage	41.5	4.5e-22
WP_069241210.1|1287136_1287526_+	hypothetical protein	NA	H9C0W3	Aeromonas_phage	41.5	5.5e-21
WP_069241211.1|1287533_1288079_+	hypothetical protein	NA	A0A077KC88	Edwardsiella_phage	28.2	3.0e-09
WP_069241212.1|1288082_1289804_+	DUF3383 domain-containing protein	NA	E2GLU1	Acinetobacter_phage	35.3	6.1e-72
WP_069241213.1|1289814_1290249_+	hypothetical protein	NA	H9C0W6	Aeromonas_phage	44.4	2.0e-27
WP_069241214.1|1290250_1290691_+	hypothetical protein	NA	K4IBX0	Acinetobacter_phage	36.6	2.2e-10
WP_069241936.1|1290687_1290861_+	transcription elongation factor GreA	NA	H9C0W8	Aeromonas_phage	53.2	5.4e-05
WP_156789013.1|1290863_1292693_+	hypothetical protein	NA	Q4L1H3	Burkholderia_phage	28.5	4.0e-37
WP_069241216.1|1292694_1293369_+	hypothetical protein	NA	I2GUF2	Acinetobacter_phage	37.6	2.7e-23
WP_069241217.1|1293368_1293671_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069241218.1|1293667_1294537_+	hypothetical protein	NA	H9C0X5	Aeromonas_phage	32.2	1.4e-29
WP_069241219.1|1294526_1295282_+	oxidoreductase	NA	A0A2R3UAK1	Myoviridae_environmental_samples	48.2	1.3e-34
WP_069241220.1|1295281_1295632_+	hypothetical protein	NA	Q2NP92	Xanthomonas_phage	37.8	2.2e-05
WP_069241221.1|1295640_1296876_+|plate	baseplate J/gp47 family protein	plate	A0A2R3UAL9	Myoviridae_environmental_samples	45.1	3.0e-89
WP_069241222.1|1296872_1297544_+	DUF2612 domain-containing protein	NA	A0A219YBB5	Aeromonas_phage	50.5	1.0e-46
WP_069241937.1|1297971_1298673_+|tail	phage tail protein	tail	A9YX14	Burkholderia_phage	60.7	3.3e-64
WP_069241223.1|1298784_1299933_-	acyltransferase	NA	A9YX16	Burkholderia_phage	30.3	4.7e-28
>prophage 5
NZ_CP013435	Burkholderia latens strain AU17928 isolate AU17928 chromosome 1, complete sequence	3331737	3277215	3289553	3331737		Acidithiobacillus_phage(76.92%)	16	NA	NA
WP_069240801.1|3277215_3278013_+	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	37.2	5.8e-33
WP_083252993.1|3278018_3279431_-	hypothetical protein	NA	K4HZY1	Acidithiobacillus_phage	67.0	9.8e-177
WP_059844642.1|3279417_3279675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069241877.1|3279671_3280409_-	hypothetical protein	NA	K4HZA0	Acidithiobacillus_phage	74.3	3.4e-104
WP_069241878.1|3280405_3280870_-	hypothetical protein	NA	K4I3X7	Acidithiobacillus_phage	67.5	6.9e-55
WP_069242013.1|3280884_3281511_-	hypothetical protein	NA	K4ICM8	Acidithiobacillus_phage	66.0	1.5e-73
WP_069241879.1|3281513_3282335_-	ATP-binding protein	NA	K4HZX9	Acidithiobacillus_phage	81.9	3.1e-130
WP_069241880.1|3282334_3283087_-	Bro-N domain-containing protein	NA	K4I1D2	Acidithiobacillus_phage	68.5	4.1e-89
WP_069242014.1|3283089_3283575_-	hypothetical protein	NA	K4HZ96	Acidithiobacillus_phage	67.7	3.3e-55
WP_069241881.1|3283586_3283844_-	helix-turn-helix domain-containing protein	NA	A0A1Y0T2P6	Pseudomonas_phage	38.8	2.8e-05
WP_069242015.1|3284013_3284490_-	hypothetical protein	NA	K4HZX2	Acidithiobacillus_phage	40.4	2.4e-10
WP_069241882.1|3284501_3285920_-	recombinase family protein	NA	K4ICM1	Acidithiobacillus_phage	55.4	1.3e-133
WP_069241883.1|3285916_3286390_-	DUF2924 domain-containing protein	NA	K4I3X1	Acidithiobacillus_phage	49.6	3.4e-33
WP_083252994.1|3286386_3286602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069241884.1|3286785_3288621_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_083252995.1|3288683_3289553_-	ImmA/IrrE family metallo-endopeptidase	NA	Q854W5	Mycobacterium_virus	28.5	2.5e-05
>prophage 1
NZ_CP013436	Burkholderia latens strain AU17928 isolate AU17928 plasmid pAU17928, complete sequence	45481	22094	31577	45481	transposase	Leptospira_phage(50.0%)	9	NA	NA
WP_069240766.1|22094_23675_-|transposase	IS66 family transposase	transposase	S5VLC8	Leptospira_phage	32.3	3.8e-36
WP_059760883.1|23705_24059_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	41.3	8.8e-18
WP_083252996.1|24034_24550_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_027821151.1|25628_25982_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	43.0	2.8e-16
WP_069242034.1|25981_26374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069241900.1|26366_27872_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	30.8	1.2e-15
WP_069240801.1|27864_28662_+	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	37.2	5.8e-33
WP_156789042.1|29510_30434_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069242035.1|30599_31577_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	5.8e-43
