The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP013463	Burkholderia ubonensis strain MSMB1471WGS chromosome 1, complete sequence	3531036	180666	209826	3531036	integrase,plate,tail,holin	Burkholderia_phage(80.0%)	35	172734:172753	185290:185309
172734:172753	attL	CGAGCGCGCGCAGCGCGGCG	NA	NA	NA	NA
WP_069236708.1|180666_181743_-|integrase	site-specific integrase	integrase	A0A1S5NNJ1	Burkholderia_phage	84.3	6.1e-171
WP_080340739.1|181610_182060_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_080436232.1|182069_182429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069236709.1|182425_185218_-	toprim domain-containing protein	NA	E5E3N5	Burkholderia_phage	92.1	0.0e+00
WP_069236710.1|185221_185485_-	hypothetical protein	NA	E5E3N6	Burkholderia_phage	65.1	5.0e-18
185290:185309	attR	CGAGCGCGCGCAGCGCGGCG	NA	NA	NA	NA
WP_010095912.1|185688_185937_-	ogr/Delta-like zinc finger family protein	NA	K4PAZ0	Burkholderia_phage	91.5	5.9e-37
WP_010095910.1|186061_186277_-	hypothetical protein	NA	E5E3U1	Burkholderia_phage	81.4	2.0e-20
WP_155122560.1|186403_186859_+	transcriptional regulator	NA	E5E3U2	Burkholderia_phage	62.9	1.2e-43
WP_059586364.1|187230_187527_+	hypothetical protein	NA	E5E3U3	Burkholderia_phage	50.5	7.1e-13
WP_060375305.1|187658_188744_-	phage late control D family protein	NA	K4PAY4	Burkholderia_phage	70.5	3.5e-134
WP_060308450.1|188740_189196_-|tail	phage tail protein	tail	K4NXK5	Burkholderia_phage	66.7	6.6e-42
WP_069236711.1|189227_191771_-	hypothetical protein	NA	E5E3U6	Burkholderia_phage	49.0	2.8e-142
WP_076481858.1|191786_191900_-|tail	GpE family phage tail protein	tail	E5E3U7	Burkholderia_phage	75.7	4.0e-09
WP_060323165.1|191908_192292_-|tail	phage tail assembly protein	tail	A4JWS5	Burkholderia_virus	63.9	1.3e-27
WP_080431718.1|192361_192865_-|tail	phage major tail tube protein	tail	E5E3U9	Burkholderia_phage	74.3	3.1e-69
WP_060323159.1|192899_194072_-|tail	phage tail sheath protein	tail	A4JWS7	Burkholderia_virus	83.0	3.5e-188
WP_069236712.1|194127_195000_-|tail	tail fiber assembly protein	tail	E5E3Q6	Burkholderia_phage	72.5	6.6e-115
WP_069236713.1|195010_196588_-|tail	phage tail protein	tail	E5FFH1	Burkholderia_phage	65.1	3.1e-139
WP_069236714.1|196594_197137_-|tail	phage tail protein I	tail	E5FFH2	Burkholderia_phage	72.1	5.6e-72
WP_060323150.1|197129_198044_-|plate	baseplate J/gp47 family protein	plate	E5FFH3	Burkholderia_phage	73.6	1.7e-121
WP_059609406.1|198040_198403_-	GPW/gp25 family protein	NA	K4PAX6	Burkholderia_phage	66.7	5.4e-39
WP_042586752.1|198399_199083_-|plate	phage baseplate assembly protein V	plate	E5E3V6	Burkholderia_phage	67.3	1.2e-76
WP_069237309.1|199587_200031_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_069236715.1|200033_201089_-	hypothetical protein	NA	A4JWL8	Burkholderia_virus	43.4	5.1e-53
WP_060323140.1|201085_201652_-|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	50.3	1.7e-39
WP_059476704.1|201644_202556_-|plate	baseplate J/gp47 family protein	plate	E5FFH3	Burkholderia_phage	49.8	1.5e-74
WP_060308486.1|202552_203008_-|tail	phage tail protein	tail	E5E3V9	Burkholderia_phage	56.5	2.4e-31
WP_080487037.1|203124_203565_-	protein lysB	NA	K4NXJ2	Burkholderia_phage	45.9	3.5e-16
WP_060323136.1|203561_204395_-	N-acetylmuramidase family protein	NA	A4JWZ0	Burkholderia_virus	67.7	3.2e-95
WP_010095863.1|204398_204665_-|holin	phage holin family protein	holin	K4NX91	Burkholderia_phage	68.2	1.2e-24
WP_010095861.1|204666_205011_-	membrane protein	NA	A4JWU2	Burkholderia_virus	79.6	6.7e-39
WP_060323133.1|205026_205233_-|tail	tail protein X	tail	E5E3W5	Burkholderia_phage	72.1	6.4e-21
WP_069237310.1|205654_206125_-	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_060308613.1|206316_207858_+	TIGR04222 domain-containing membrane protein	NA	NA	NA	NA	NA
WP_059962402.1|208155_209826_+	MCP four helix bundle domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.2	2.1e-21
>prophage 2
NZ_CP013463	Burkholderia ubonensis strain MSMB1471WGS chromosome 1, complete sequence	3531036	453661	495385	3531036	protease,transposase,plate	uncultured_Caudovirales_phage(50.0%)	38	NA	NA
WP_069236753.1|453661_454171_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	48.6	1.2e-20
WP_155122617.1|455043_456168_-	heptosyltransferase	NA	NA	NA	NA	NA
WP_155122618.1|456173_457403_-	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_059617973.1|457542_458406_-	beta-1,4-mannosyl-glycoprotein beta-1,4-N-acetylglucosaminyltransferase	NA	A0A0P0YM34	Yellowstone_lake_phycodnavirus	30.3	8.5e-22
WP_069236754.1|458521_459346_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_069236755.1|459685_459967_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_069236756.1|460889_463787_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	26.7	1.9e-49
WP_069236757.1|463790_464339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059963007.1|464363_466304_+	TIGR02594 family protein	NA	A0A1U9ZAE8	Proteus_phage	36.2	8.3e-09
WP_060302504.1|466332_466842_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069236758.1|466915_467467_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069236759.1|467669_467930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059931479.1|468290_468494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045566772.1|468596_469397_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_069236760.1|469718_472892_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	27.6	1.8e-53
WP_155122563.1|472929_477567_+	RHS domain-containing protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	49.3	5.9e-45
WP_059962993.1|477568_477952_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080410724.1|478597_478852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059958899.1|478907_479147_-	type I addiction module toxin, SymE family	NA	NA	NA	NA	NA
WP_080410723.1|479220_479562_-	helix-turn-helix transcriptional regulator	NA	Q0H244	Geobacillus_phage	41.7	3.3e-06
WP_141715289.1|479785_479989_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059962985.1|480078_480342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063802372.1|480410_480596_-	type I addiction module toxin, SymE family	NA	NA	NA	NA	NA
WP_069236761.1|480822_481044_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069237315.1|481138_482536_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_069236762.1|482932_484762_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	43.9	6.8e-13
WP_060302519.1|484924_485248_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059536594.1|485368_486148_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_059962968.1|486144_487491_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_059962965.1|487593_488205_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_141715287.1|488191_488416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059962962.1|488580_489222_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_042582986.1|489265_489793_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_059536578.1|489808_491299_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_010096526.1|491367_491871_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_042582988.1|491934_492420_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_060323571.1|492485_494321_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_059962957.1|494284_495385_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
>prophage 3
NZ_CP013463	Burkholderia ubonensis strain MSMB1471WGS chromosome 1, complete sequence	3531036	789365	802359	3531036		Hokovirus(12.5%)	11	NA	NA
WP_059971004.1|789365_791318_+	molecular chaperone DnaK	NA	A0A1V0SH73	Hokovirus	49.2	3.5e-148
WP_059611180.1|791574_792708_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	37.9	2.4e-24
WP_069236809.1|792712_794575_+	aminodeoxychorismate synthase component I	NA	S4VT78	Pandoravirus	36.9	1.9e-55
WP_042583171.1|794720_795536_-	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	30.5	2.8e-35
WP_060305116.1|795577_796264_-	deoxynucleoside kinase	NA	A0A0M3UL55	Enterococcus_phage	23.7	1.2e-05
WP_010091451.1|796260_796806_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_059971010.1|796839_798360_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	33.3	1.4e-24
WP_059971013.1|798365_799043_-	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_080487052.1|799054_799993_-	DnaA regulatory inactivator Hda	NA	NA	NA	NA	NA
WP_060305121.1|800018_801074_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	45.9	4.9e-72
WP_063897314.1|801168_802359_-	Tet(A)/Tet(B)/Tet(C) family tetracycline efflux MFS transporter	NA	A0A2H4UVM2	Bodo_saltans_virus	25.0	6.9e-06
>prophage 4
NZ_CP013463	Burkholderia ubonensis strain MSMB1471WGS chromosome 1, complete sequence	3531036	901841	908839	3531036		Enterobacteria_phage(50.0%)	7	NA	NA
WP_069236829.1|901841_902903_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	47.0	5.4e-87
WP_069236830.1|902914_903808_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	58.5	3.7e-97
WP_069236831.1|903792_904344_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	53.0	8.8e-49
WP_069236832.1|904340_905240_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.7	2.2e-25
WP_069237322.1|905379_906825_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	29.3	4.7e-57
WP_069236833.1|906824_907619_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_069236834.1|907618_908839_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.4	2.5e-11
>prophage 1
NZ_CP013464	Burkholderia ubonensis strain MSMB1471WGS chromosome 2, complete sequence	3094056	634653	692867	3094056	plate	uncultured_Caudovirales_phage(25.0%)	46	NA	NA
WP_059483243.1|634653_635085_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_060301662.1|635097_635760_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_080431676.1|635756_637103_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_080487105.1|637160_638549_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_069237544.1|638810_641162_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	29.4	6.3e-11
WP_080487106.1|641085_642012_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_069237546.1|642074_644729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069238216.1|645349_645790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060304451.1|647773_648214_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060304901.1|648839_649280_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080431766.1|649347_649599_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_060304904.1|649678_650875_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060304453.1|650871_654408_+	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_069237547.1|654424_656239_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_069238217.1|656337_657318_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_080487107.1|657349_658063_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_155122639.1|658140_658860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059967241.1|658866_659298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059967239.1|659385_660987_-	tyrosinase family protein	NA	NA	NA	NA	NA
WP_069237549.1|661573_662434_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069237550.1|662430_662679_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059532241.1|662772_663156_+	avidin/streptavidin family protein	NA	NA	NA	NA	NA
WP_080410839.1|663443_665237_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_060304470.1|665282_667250_-	glycosyltransferase	NA	M1HVH2	Acanthocystis_turfacea_Chlorella_virus	26.4	2.9e-25
WP_069237551.1|667252_668590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059967229.1|668610_670068_-	multidrug transporter	NA	NA	NA	NA	NA
WP_042588734.1|670812_671217_+	TIGR02594 family protein	NA	A0A249Y3Q7	Serratia_phage	43.7	1.7e-28
WP_059967429.1|671245_672682_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_059967427.1|672692_674267_-	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_060326518.1|674298_675390_-	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_010098074.1|675454_675886_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_060304478.1|675935_676874_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_059647429.1|676975_677404_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_069237552.1|677665_678913_+	aconitase X catalytic domain-containing protein	NA	NA	NA	NA	NA
WP_069237553.1|678905_679412_+	DUF126 domain-containing protein	NA	NA	NA	NA	NA
WP_069237554.1|679546_680656_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_069237555.1|680733_682767_+	NADPH-dependent 2,4-dienoyl-CoA reductase	NA	NA	NA	NA	NA
WP_059967217.1|682794_683199_-	DUF2471 domain-containing protein	NA	NA	NA	NA	NA
WP_069237556.1|683342_684236_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_059967213.1|684323_685112_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_060304490.1|685119_685545_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_069237557.1|685541_688271_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	32.4	1.4e-86
WP_006479553.1|688409_688895_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_069237558.1|688987_690766_-	OmpA family protein	NA	NA	NA	NA	NA
WP_069237559.1|690762_691518_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_069237560.1|691514_692867_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 2
NZ_CP013464	Burkholderia ubonensis strain MSMB1471WGS chromosome 2, complete sequence	3094056	1498376	1551992	3094056	lysis,capsid	Burkholderia_phage(61.54%)	74	NA	NA
WP_069237767.1|1498376_1499513_-	hypothetical protein	NA	C5IHJ5	Burkholderia_virus	65.7	8.2e-33
WP_080487118.1|1499660_1501160_-	Lar family restriction alleviation protein	NA	NA	NA	NA	NA
WP_069238245.1|1501176_1503081_-	DNA methyltransferase	NA	Q9ZXI4	Pseudomonas_virus	59.7	1.1e-167
WP_069237769.1|1503317_1503728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069237770.1|1503729_1503924_-	hypothetical protein	NA	A9YX20	Burkholderia_phage	87.7	3.6e-21
WP_069237771.1|1503920_1504361_-	hypothetical protein	NA	A9YX19	Burkholderia_phage	87.0	5.7e-75
WP_069237772.1|1504443_1505088_-	1-pyrroline-5-carboxylate dehydrogenase	NA	A9YX18	Burkholderia_phage	81.5	8.8e-16
WP_069237773.1|1505084_1506851_-	AAA family ATPase	NA	H2BD46	Pseudomonas_phage	36.5	4.6e-75
WP_069237774.1|1506847_1507726_-	cell division protein FtsK	NA	J7I0T4	Pseudomonas_phage	40.1	3.5e-23
WP_069238246.1|1507756_1508941_-	hypothetical protein	NA	A0A2I7RZ22	Vibrio_phage	35.0	4.9e-20
WP_069237775.1|1509033_1509843_-	PD-(D/E)XK nuclease family protein	NA	J7HXJ4	Pseudomonas_phage	58.6	8.3e-88
WP_069237776.1|1509839_1510136_-	KTSC domain-containing protein	NA	A9YWW2	Burkholderia_phage	75.8	1.3e-35
WP_069237778.1|1510579_1510936_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069237779.1|1510932_1511115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069237780.1|1511114_1511360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069237781.1|1511361_1511568_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069237782.1|1511564_1511903_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069237783.1|1512032_1512293_-	hypothetical protein	NA	G8CT95	Vibrio_phage	57.9	2.4e-12
WP_080487119.1|1512331_1512544_-	hypothetical protein	NA	A0A0U1VYM8	Pseudomonas_phage	53.6	8.7e-13
WP_069237784.1|1512602_1513019_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080487164.1|1514194_1514596_-	hypothetical protein	NA	C7BGF7	Burkholderia_phage	74.4	5.2e-51
WP_059726797.1|1515048_1515423_+	hypothetical protein	NA	A9YWX9	Burkholderia_phage	86.3	4.6e-57
WP_080487120.1|1515419_1515641_+	hypothetical protein	NA	A9YWY0	Burkholderia_phage	83.1	1.4e-26
WP_069237787.1|1515634_1515859_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069237788.1|1515855_1517094_+	phosphoadenosine phosphosulfate reductase family protein	NA	R9TRT5	Rhizobium_phage	69.8	1.7e-169
WP_069237789.1|1517090_1517951_+	DNA adenine methylase	NA	A0A0K1LM14	Caulobacter_phage	52.5	1.3e-78
WP_069237790.1|1517950_1518427_+	hypothetical protein	NA	Q6JIG5	Burkholderia_virus	77.7	3.8e-64
WP_069237791.1|1518435_1518660_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069238248.1|1519412_1519844_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155122662.1|1519897_1520101_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069237792.1|1520097_1520568_+	RusA family crossover junction endodeoxyribonuclease	NA	A9YWY9	Burkholderia_phage	84.0	8.5e-69
WP_069237793.1|1520579_1520906_+	hypothetical protein	NA	A9YWZ0	Burkholderia_phage	90.7	8.0e-42
WP_069237794.1|1520902_1521496_+	DNA-binding protein	NA	A9YWZ1	Burkholderia_phage	89.5	2.5e-97
WP_069237795.1|1521753_1521990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069237796.1|1522112_1522772_+	hypothetical protein	NA	A9YWZ4	Burkholderia_phage	93.2	3.2e-114
WP_069237797.1|1522790_1523270_+	DUF2280 domain-containing protein	NA	A9YWZ5	Burkholderia_phage	95.0	3.0e-77
WP_069237798.1|1523271_1524867_+	TerL protein	NA	A9YWZ6	Burkholderia_phage	96.4	3.2e-309
WP_069237799.1|1524863_1526345_+	DUF1073 domain-containing protein	NA	A9YWZ7	Burkholderia_phage	87.9	7.4e-252
WP_069237800.1|1526341_1527097_+|capsid	minor capsid protein	capsid	A9YWZ8	Burkholderia_phage	81.6	8.5e-111
WP_155122663.1|1527241_1527409_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069237801.1|1527410_1528862_+	DUF2213 domain-containing protein	NA	A9YX03	Burkholderia_phage	73.1	5.9e-177
WP_069237802.1|1528871_1529378_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069237803.1|1529447_1530539_+	DUF2184 domain-containing protein	NA	A9YX23	Burkholderia_phage	94.4	4.8e-155
WP_069237804.1|1530540_1531023_+	hypothetical protein	NA	A9YX24	Burkholderia_phage	58.8	8.1e-14
WP_069237805.1|1531087_1531468_+	DUF4054 domain-containing protein	NA	A9YX25	Burkholderia_phage	87.4	6.1e-57
WP_069237806.1|1531495_1531972_+	hypothetical protein	NA	A9YX26	Burkholderia_phage	84.7	7.3e-68
WP_069237807.1|1532004_1532325_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069237808.1|1532383_1532761_+	hypothetical protein	NA	A9YX28	Burkholderia_phage	81.3	2.5e-55
WP_069237809.1|1532757_1533348_+	hypothetical protein	NA	A9YX29	Burkholderia_phage	91.8	5.3e-100
WP_069237810.1|1533357_1534833_+	DUF3383 domain-containing protein	NA	A0A0M4RD26	Salmonella_phage	46.1	5.1e-59
WP_069237811.1|1534848_1535289_+	DUF3277 family protein	NA	A0A0P0IKY2	Acinetobacter_phage	61.0	9.8e-43
WP_069237812.1|1535291_1535843_+	hypothetical protein	NA	A0A0N7IRF3	Acinetobacter_phage	34.6	2.8e-18
WP_155122664.1|1535839_1536046_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069237813.1|1536026_1538036_+	mannosyl-glycoprotein endo-beta-N-acetylglucosamidase	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	35.0	1.1e-35
WP_069237814.1|1538032_1538608_+	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	37.6	1.2e-19
WP_059867535.1|1538607_1538925_+	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	40.0	3.1e-14
WP_069237815.1|1538921_1539890_+	hypothetical protein	NA	A9YX04	Burkholderia_phage	86.6	3.5e-141
WP_069237816.1|1539886_1540264_-	hypothetical protein	NA	A9YX05	Burkholderia_phage	88.8	9.3e-58
WP_069237817.1|1540267_1541011_+	hypothetical protein	NA	A9YX06	Burkholderia_phage	90.3	1.8e-121
WP_069237818.1|1541019_1541373_+	hypothetical protein	NA	A9YX11	Burkholderia_phage	88.0	1.1e-52
WP_069237819.1|1541369_1542551_+	hypothetical protein	NA	A9YX12	Burkholderia_phage	83.0	6.3e-177
WP_069237820.1|1542550_1543213_+	DUF2612 domain-containing protein	NA	A9YX13	Burkholderia_phage	85.0	5.9e-108
WP_069237821.1|1543277_1544282_+	hypothetical protein	NA	A9YX14	Burkholderia_phage	39.7	2.4e-68
WP_069237822.1|1544412_1545411_-	acyltransferase	NA	NA	NA	NA	NA
WP_080487122.1|1545809_1547000_-	FkbM family methyltransferase	NA	A0A0A0V284	uncultured_virus	33.8	1.1e-11
WP_009927668.1|1547012_1547195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069237823.1|1547187_1547685_+	lysozyme	NA	Q3HQU9	Burkholderia_phage	75.2	1.2e-65
WP_069237824.1|1547681_1548230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069237825.1|1548226_1548775_+|lysis	lysis protein	lysis	Q8W6S5	Burkholderia_virus	79.8	1.2e-61
WP_069237826.1|1548788_1549244_-	hypothetical protein	NA	C7BGE3	Burkholderia_phage	47.5	2.8e-32
WP_069237827.1|1549326_1549959_+	SOS response-associated peptidase family protein	NA	C7BGE4	Burkholderia_phage	75.8	3.4e-97
WP_155122665.1|1549960_1550842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069237828.1|1551122_1551533_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_010089472.1|1551788_1551992_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	71.6	1.4e-20
>prophage 1
NZ_CP013465	Burkholderia ubonensis strain MSMB1471WGS chromosome 3, complete sequence	824232	112546	119445	824232		Burkholderia_virus(75.0%)	11	NA	NA
WP_069238333.1|112546_112876_-	helix-turn-helix domain-containing protein	NA	R4JEU7	Burkholderia_phage	58.7	3.5e-29
WP_069238334.1|113276_113603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080487170.1|114743_114923_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069238336.1|114919_115171_+	hypothetical protein	NA	A4JWW6	Burkholderia_virus	49.3	1.4e-09
WP_069238337.1|115167_115389_+	hypothetical protein	NA	A4JWW5	Burkholderia_virus	64.7	2.2e-14
WP_069238338.1|115583_115892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069238339.1|116002_117787_+	replication endonuclease	NA	A4JWW0	Burkholderia_virus	81.7	3.2e-289
WP_155122734.1|117810_118065_+	ogr/Delta-like zinc finger family protein	NA	A4JWV9	Burkholderia_virus	74.7	9.7e-27
WP_069238341.1|118061_118274_+	ogr/Delta-like zinc finger family protein	NA	A4JWV8	Burkholderia_virus	70.0	8.1e-19
WP_069238342.1|118468_118723_+	hypothetical protein	NA	E5FFJ7	Burkholderia_phage	66.3	6.1e-21
WP_069238343.1|118809_119445_+	AAA family ATPase	NA	A4JWV7	Burkholderia_virus	66.8	6.1e-70
>prophage 2
NZ_CP013465	Burkholderia ubonensis strain MSMB1471WGS chromosome 3, complete sequence	824232	124322	134154	824232	transposase,tail,terminase	Burkholderia_phage(62.5%)	9	NA	NA
WP_069238542.1|124322_126089_-|terminase	terminase	terminase	E5FFI8	Burkholderia_phage	71.7	7.5e-251
WP_069238346.1|128309_129020_+|tail	phage tail protein	tail	A4JWS2	Burkholderia_virus	63.2	3.0e-41
WP_010089500.1|129016_130084_+	phage late control D family protein	NA	A4JWS1	Burkholderia_virus	74.3	6.3e-144
WP_010089499.1|130125_130464_-	hypothetical protein	NA	R4JEU5	Burkholderia_phage	65.2	1.1e-36
WP_060305804.1|130463_131084_-	type VI secretion system amidase effector protein Tae4	NA	R4JJZ3	Burkholderia_phage	88.8	4.0e-106
WP_060305801.1|131087_131642_-	PAAR domain-containing protein	NA	R4JMI1	Burkholderia_phage	89.1	8.7e-97
WP_033354587.1|131794_132127_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060305798.1|132211_132754_-	hypothetical protein	NA	R4JDM9	Burkholderia_phage	77.7	4.1e-75
WP_069238347.1|133131_134154_-|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	27.7	9.7e-09
