The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP017114	Cobetia marina strain JCM 21022 chromosome, complete genome	4176400	1304454	1341438	4176400	protease,holin,capsid,portal,integrase,head,tail,terminase	Pseudomonas_phage(18.18%)	46	1304273:1304293	1344103:1344123
1304273:1304293	attL	CGACTCCTGCAGGGGGCGCCA	NA	NA	NA	NA
WP_084209645.1|1304454_1305699_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JAT5	uncultured_Caudovirales_phage	55.0	9.7e-128
WP_167592979.1|1305667_1305901_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_160317839.1|1305914_1306064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_084208161.1|1306248_1307163_-	DNA cytosine methyltransferase	NA	G1BSJ2	Mycobacterium_virus	41.1	1.9e-24
WP_054554917.1|1307159_1307774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_084208162.1|1307883_1308429_-	single-stranded DNA-binding protein	NA	A0A291LCB6	Klebsiella_phage	71.8	1.6e-39
WP_084208163.1|1308995_1309271_-	hypothetical protein	NA	NA	NA	NA	NA
WP_084208164.1|1309450_1309921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_084208165.1|1310091_1310787_-	helix-turn-helix transcriptional regulator	NA	W6MVG5	Pseudomonas_phage	45.1	3.0e-46
WP_167592980.1|1310936_1311155_+	helix-turn-helix domain-containing protein	NA	J7I423	Pseudomonas_phage	52.2	1.5e-07
WP_084208167.1|1311217_1311712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054557037.1|1311793_1312114_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054557038.1|1312128_1312371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_084208168.1|1312367_1313264_+	hypothetical protein	NA	A0A1W6JP36	Morganella_phage	43.5	5.5e-08
WP_157109436.1|1313205_1313949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_084208170.1|1314479_1314764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_084208171.1|1314760_1315297_+	VRR-NUC domain-containing protein	NA	A0A2D1GNH3	Pseudomonas_phage	47.0	7.3e-24
WP_084208172.1|1315332_1315890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152965448.1|1316771_1317002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_084208174.1|1317059_1317590_+	glycoside hydrolase family 104 protein	NA	A0A173GBW4	Salmonella_phage	56.3	1.5e-42
WP_054557045.1|1317634_1317988_+|holin	phage holin, lambda family	holin	A0A1W6JTC7	Pseudomonas_phage	49.5	2.3e-18
WP_084208175.1|1317975_1318401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_084208176.1|1318448_1318631_-	DUF2188 domain-containing protein	NA	NA	NA	NA	NA
WP_084208177.1|1318881_1319181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_084208178.1|1319186_1319378_-	DUF2188 domain-containing protein	NA	NA	NA	NA	NA
WP_084208179.1|1319451_1319826_+	HNH endonuclease	NA	C7BGG5	Burkholderia_phage	47.1	6.9e-21
WP_054557049.1|1319938_1320418_+|terminase	phage terminase small subunit P27 family	terminase	A0A1V0E8B7	Vibrio_phage	45.7	6.1e-30
WP_084208180.1|1320424_1322134_+|terminase	terminase large subunit	terminase	G3EN96	Psychrobacter_phage	53.7	1.4e-172
WP_166019415.1|1322135_1322300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_084208181.1|1322296_1323517_+|portal	phage portal protein	portal	A0A1J0GUY8	Halomonas_phage	75.6	1.2e-175
WP_084208182.1|1323513_1324116_+|head,protease	HK97 family phage prohead protease	head,protease	A0A1J0GUZ0	Halomonas_phage	82.0	2.7e-91
WP_084208183.1|1324131_1325367_+|capsid	phage major capsid protein	capsid	A0A1J0GV00	Halomonas_phage	65.9	5.8e-149
WP_054557054.1|1325444_1325774_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1J0GUX7	Halomonas_phage	61.6	4.2e-30
WP_084208184.1|1325781_1326327_+|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
WP_084208185.1|1326338_1326917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054557057.1|1326913_1327354_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054557058.1|1327357_1328104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_084208186.1|1328116_1328308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_084208187.1|1328379_1332183_+	hypothetical protein	NA	A0A2I7S7Q1	Vibrio_phage	28.8	7.1e-12
WP_084208188.1|1332229_1332646_+	hypothetical protein	NA	B7SYE8	Stenotrophomonas_phage	40.1	2.1e-10
WP_084208189.1|1332642_1332936_-	hypothetical protein	NA	NA	NA	NA	NA
WP_084208190.1|1333156_1336534_+	hypothetical protein	NA	A0A0M4U447	Ralstonia_phage	35.7	2.3e-184
WP_084208191.1|1336620_1337823_+	hypothetical protein	NA	A0A0M5TJJ3	Ralstonia_phage	27.0	1.3e-17
WP_084208192.1|1337819_1338947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043336616.1|1338943_1339345_+	hypothetical protein	NA	Q6VT61	Vibrio_phage	37.6	1.3e-14
WP_084208193.1|1339353_1341438_+	hypothetical protein	NA	A0A0M4UKC5	Ralstonia_phage	39.8	2.5e-67
1344103:1344123	attR	CGACTCCTGCAGGGGGCGCCA	NA	NA	NA	NA
>prophage 2
NZ_CP017114	Cobetia marina strain JCM 21022 chromosome, complete genome	4176400	3395240	3403576	4176400		Acinetobacter_phage(50.0%)	8	NA	NA
WP_084209798.1|3395240_3396350_+	sn-glycerol-3-phosphate import ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	35.5	2.3e-24
WP_084209257.1|3396542_3397334_+	glycerophosphoryl diester phosphodiesterase	NA	R9R1S6	Lactococcus_phage	33.6	2.2e-08
WP_167593051.1|3397341_3398127_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_084209799.1|3398182_3398992_+	HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_084209259.1|3399181_3400009_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	50.4	4.0e-61
WP_084209260.1|3400008_3401055_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	56.5	1.8e-98
WP_084209800.1|3401130_3401721_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	59.9	5.5e-65
WP_077373081.1|3402088_3403576_-	anthranilate synthase component I	NA	S4VT78	Pandoravirus	33.0	8.0e-36
