The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP012460	Enterococcus faecium strain ISMMS_VRE_7 chromosome, complete genome	2850245	179033	254358	2850245	portal,terminase,capsid,tail,holin,tRNA,plate,transposase	Enterococcus_phage(25.0%)	87	NA	NA
WP_086956687.1|179033_180196_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	51.3	1.6e-79
WP_002287966.1|180404_180779_+	iron-sulfur cluster biosynthesis family protein	NA	NA	NA	NA	NA
WP_002348865.1|180892_181522_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_002296289.1|182152_182317_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002294080.1|182611_183940_+	C1 family peptidase	NA	R4TV59	Phaeocystis_globosa_virus	38.1	7.3e-73
WP_002287963.1|184141_184975_+	fructosamine kinase family protein	NA	NA	NA	NA	NA
WP_002287962.1|184990_185728_+	acyl-ACP thioesterase	NA	NA	NA	NA	NA
WP_002287961.1|185882_186851_-	asparaginase	NA	NA	NA	NA	NA
WP_002287960.1|187082_187916_+	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_002287959.1|187949_188789_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_002287958.1|188814_189375_+	haloacid dehalogenase	NA	A0A0H3UZF4	Geobacillus_virus	45.1	2.3e-28
WP_002287957.1|189573_191295_+	septation ring formation regulator EzrA	NA	NA	NA	NA	NA
WP_002287956.1|191459_192602_+	cysteine desulfurase	NA	NA	NA	NA	NA
WP_002287954.1|194400_195048_+	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_002287953.1|195440_198086_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	42.9	4.0e-163
WP_002294071.1|198395_199709_+	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_002287951.1|199698_200352_+	HAD family phosphatase	NA	NA	NA	NA	NA
WP_002304462.1|200406_201078_+	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_002303263.1|200972_202325_-	recombinase family protein	NA	D2IZV7	Enterococcus_phage	55.3	1.7e-133
WP_002303264.1|202390_203680_-	DUF4041 domain-containing protein	NA	M1NRY5	Streptococcus_phage	74.0	5.6e-46
WP_002303265.1|203766_204471_-	LexA family transcriptional regulator	NA	D7RWF2	Brochothrix_phage	42.4	6.2e-39
WP_002303266.1|204670_204937_+	helix-turn-helix transcriptional regulator	NA	A0A1W6JP54	Staphylococcus_phage	52.7	5.4e-12
WP_002303268.1|204949_205108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002304464.1|205104_205335_-	DUF2188 domain-containing protein	NA	E8ZD70	Streptococcus_phage	49.3	4.4e-10
WP_002299038.1|205406_205562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002303270.1|205718_205874_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002299325.1|205870_206095_-	DUF2188 domain-containing protein	NA	E8ZD70	Streptococcus_phage	81.1	2.2e-27
WP_002303273.1|206361_206697_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002303275.1|206929_207871_+	YqaJ viral recombinase family protein	NA	D2IZK1	Enterococcus_phage	78.9	2.7e-146
WP_002303277.1|207872_208763_+	recombinase RecT	NA	D2IYT9	Enterococcus_phage	84.5	6.2e-137
WP_002303278.1|208805_209606_+	hypothetical protein	NA	B4XYS6	Lactobacillus_phage	54.5	8.9e-58
WP_002304468.1|209620_210472_+	ATP-binding protein	NA	A0A0P0I3L9	Lactobacillus_phage	30.2	3.0e-27
WP_002304469.1|210468_210828_+	DUF1064 domain-containing protein	NA	A0A1P8BKR1	Lactococcus_phage	47.5	6.8e-18
WP_002292988.1|210842_211004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002350868.1|211000_211327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002304472.1|211323_212139_+	prohibitin family protein	NA	A0A288TXV9	Enterococcus_phage	69.4	1.8e-82
WP_002304473.1|212277_212589_+	MazG-like family protein	NA	A0A0D3MVS9	Staphylococcus_phage	58.0	5.3e-27
WP_002304474.1|212585_212816_+	hypothetical protein	NA	A0A0S2MYD2	Enterococcus_phage	50.7	8.8e-11
WP_002304475.1|212822_213026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286693.1|213022_213319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002322045.1|213395_213809_+	autolysin	NA	C9E2P5	Enterococcus_phage	80.3	2.5e-56
WP_002304480.1|213821_214208_+	hypothetical protein	NA	O34053	Streptococcus_phage	55.2	1.9e-29
WP_002311618.1|214758_214983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002304484.1|215000_215429_+	hypothetical protein	NA	A0A1P8BMH5	Lactococcus_phage	63.1	2.6e-40
WP_002304486.1|215406_216825_+|terminase	phage terminase large subunit	terminase	A0A090EUA8	Clostridium_phage	51.5	2.5e-124
WP_002343932.1|216836_218372_+|portal	phage portal protein	portal	NA	NA	NA	NA
WP_033582200.1|218451_219330_+|capsid	minor capsid protein	capsid	NA	NA	NA	NA
WP_002304492.1|219331_219649_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002312520.1|219775_220399_+	DUF4355 domain-containing protein	NA	NA	NA	NA	NA
WP_002312521.1|220413_221304_+	DUF5309 domain-containing protein	NA	NA	NA	NA	NA
WP_002311614.1|221326_221542_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002298050.1|221553_221895_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002298048.1|221894_222266_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002298046.1|222258_222654_+	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
WP_002298045.1|222655_223033_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002303295.1|223033_223642_+|tail	tail protein	tail	NA	NA	NA	NA
WP_002303297.1|223641_223983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305859.1|224224_227014_+	tape measure protein	NA	D7RWD8	Brochothrix_phage	40.2	8.4e-71
WP_002303299.1|227003_227744_+|tail	tail protein	tail	NA	NA	NA	NA
WP_002347081.1|227740_230503_+|tail	phage tail protein	tail	Q9AZX5	Lactococcus_phage	39.1	6.0e-138
WP_002350776.1|230515_231424_+|plate	phage baseplate upper protein	plate	A0A1P8BLW0	Lactococcus_phage	25.2	7.8e-10
WP_002301866.1|231423_232041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002350775.1|232044_232494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002342973.1|232493_233018_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002350774.1|233045_233453_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002298029.1|233452_233590_+	XkdX family protein	NA	NA	NA	NA	NA
WP_002286686.1|233627_233921_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286683.1|233917_234142_+|holin	phage holin	holin	NA	NA	NA	NA
WP_002312527.1|234138_235164_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A139ZVY1	Enterococcus_phage	61.3	3.6e-64
WP_086953915.1|235233_236572_+|transposase	IS3-like element ISEnfa3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.7	2.6e-78
WP_002324322.1|236801_237980_-|transposase	IS256-like element ISEfm2 family transposase	transposase	NA	NA	NA	NA
WP_002305550.1|238329_238782_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002318238.1|238768_239275_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002324322.1|239379_240558_+|transposase	IS256-like element ISEfm2 family transposase	transposase	NA	NA	NA	NA
WP_002294067.1|241829_242030_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	71.2	3.7e-21
WP_002287948.1|242283_243963_-	ribonuclease J	NA	NA	NA	NA	NA
WP_002287947.1|243964_244177_-	DNA-dependent RNA polymerase auxiliary subunit epsilon family protein	NA	NA	NA	NA	NA
WP_002296290.1|244569_246300_+	multidrug efflux ABC transporter subunit EfrA	NA	W8CYL7	Bacillus_phage	27.6	2.1e-43
WP_002289400.1|246296_248057_+	multidrug efflux ABC transporter subunit EfrB	NA	W8CYL7	Bacillus_phage	28.6	2.5e-52
WP_002296291.1|248151_248349_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002289401.1|248501_248987_+	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_002289402.1|249090_249684_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	55.6	8.9e-55
WP_002289403.1|249863_250391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002289404.1|250481_251219_+	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	40.0	2.3e-12
WP_002289405.1|251222_252140_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_002289406.1|252141_253371_+	GTPase HflX	NA	NA	NA	NA	NA
WP_000222572.1|253404_254358_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP012460	Enterococcus faecium strain ISMMS_VRE_7 chromosome, complete genome	2850245	430870	606969	2850245	portal,integrase,terminase,head,capsid,tail,protease,tRNA,plate,transposase	Streptococcus_phage(20.31%)	176	575971:575989	593082:593100
WP_002305598.1|430870_431788_+|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_002348661.1|431789_433865_+|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_002326711.1|434146_435325_-|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_002348662.1|435590_436370_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296209.1|436415_437360_+	LCP family protein	NA	NA	NA	NA	NA
WP_002348663.1|437375_438155_+	tyrosine protein kinase	NA	NA	NA	NA	NA
WP_002348664.1|438166_438865_+	CpsD/CapB family tyrosine-protein kinase	NA	A0A1X9I5D6	Streptococcus_phage	37.1	6.0e-26
WP_002312256.1|438892_439657_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002312258.1|439977_441429_+	sugar transferase	NA	NA	NA	NA	NA
WP_002312259.1|441806_443057_+	nucleotide sugar dehydrogenase	NA	M1IB49	Acanthocystis_turfacea_Chlorella_virus	50.4	8.9e-105
WP_002325817.1|443070_443532_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002291721.1|443548_444028_+	EpsH	NA	NA	NA	NA	NA
WP_002312264.1|444047_445115_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_002312270.1|445682_446744_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	36.5	1.5e-12
WP_002348666.1|447061_447652_+	poly-gamma-glutamate biosynthesis protein	NA	NA	NA	NA	NA
WP_002312274.1|447678_448989_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002312275.1|448985_449705_+	glycosyl transferase	NA	A0A2K9L639	Tupanvirus	25.0	2.6e-08
WP_002312276.1|449719_450805_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_002348669.1|450940_452473_+	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_002312280.1|452650_452872_+	transferase	NA	NA	NA	NA	NA
WP_002312281.1|453453_454071_+	VanZ family protein	NA	NA	NA	NA	NA
WP_002312282.1|454067_454598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010782560.1|455463_456423_-|transposase	IS30-like element IS6770 family transposase	transposase	NA	NA	NA	NA
WP_002312284.1|457227_457428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002312285.1|457606_458557_-	membrane protein insertase YidC	NA	NA	NA	NA	NA
WP_002289551.1|458994_459270_-	acylphosphatase	NA	NA	NA	NA	NA
WP_002294889.1|459377_460142_+	RNA methyltransferase	NA	A0A2D1A6G0	Rhodococcus_phage	26.1	1.7e-05
WP_002348853.1|460264_460768_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_002289547.1|461984_463253_+	voltage-gated chloride channel family protein	NA	A0A1X9I5Z9	Streptococcus_phage	31.1	2.2e-42
WP_002340453.1|463279_464479_-	YdcF family protein	NA	NA	NA	NA	NA
WP_002304680.1|464597_465905_-	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_002288760.1|466375_467494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002297185.1|467945_469241_-|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	3.8e-10
WP_002323868.1|469518_469839_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288762.1|470290_470491_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	74.2	2.5e-22
WP_002304681.1|470637_473427_+	DEAD/DEAH box helicase family protein	NA	A0A1X9I5C8	Streptococcus_phage	30.9	1.1e-89
WP_002348809.1|473473_474001_+	DUF5590 domain-containing protein	NA	NA	NA	NA	NA
WP_002304682.1|474021_475212_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_002288767.1|475251_476550_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	30.3	1.2e-59
WP_002304684.1|477602_478277_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_002326717.1|478273_478615_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288776.1|478644_479004_+	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_002304688.1|479527_481609_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	35.6	2.4e-115
WP_002288779.1|481919_483386_+	amino acid permease	NA	NA	NA	NA	NA
WP_002304690.1|484000_484540_+	topology modulation protein	NA	A0A097BYE2	Leuconostoc_phage	34.5	3.8e-20
WP_002294855.1|484613_485054_+	CopY/TcrY family copper transport repressor	NA	NA	NA	NA	NA
WP_002289040.1|485066_485276_+	copper chaperone CopZ	NA	NA	NA	NA	NA
WP_002304699.1|493445_494387_-	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_002304700.1|494531_495380_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_002294839.1|495733_496546_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002304701.1|496699_497023_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002294835.1|497096_497666_+	prevent-host-death protein	NA	NA	NA	NA	NA
WP_002301695.1|498102_498795_+	hypothetical protein	NA	Q9MCC6	Lactobacillus_phage	43.4	4.0e-30
WP_099745852.1|498834_500174_-|transposase	IS3-like element ISEnfa3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.7	3.4e-78
WP_099098442.1|500278_501440_+|transposase	IS3-like element ISEfa8 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	54.2	1.8e-80
WP_016252743.1|501742_502561_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_002326711.1|502812_503991_-|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_002324322.1|504198_505377_+|transposase	IS256-like element ISEfm2 family transposase	transposase	NA	NA	NA	NA
WP_002301623.1|505459_506434_+	choloylglycine hydrolase family protein	NA	M1HVK5	Paramecium_bursaria_Chlorella_virus	31.8	7.1e-25
WP_010782561.1|506556_507516_-|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	26.8	2.2e-10
WP_002326708.1|508257_508575_+	SdpI family protein	NA	NA	NA	NA	NA
WP_002289810.1|508665_509031_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002300070.1|509238_509721_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002289807.1|509917_510808_+	phosphate ABC transporter substrate-binding protein PstS family protein	NA	NA	NA	NA	NA
WP_002326707.1|511094_512369_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	35.9	9.5e-54
WP_002297196.1|512641_515113_+	cation-translocating P-type ATPase	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	28.8	7.0e-45
WP_002303966.1|515215_516952_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	34.1	1.2e-27
WP_002293705.1|516948_517653_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.2	1.4e-38
WP_002297194.1|517783_518287_+	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_002293708.1|518246_518585_+	putative DNA-binding protein	NA	NA	NA	NA	NA
WP_002293709.1|518605_520024_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_002293710.1|520135_520714_+	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_002297192.1|520717_521239_+	dihydrofolate reductase	NA	NA	NA	NA	NA
WP_002293714.1|521317_521872_-	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	29.3	2.3e-12
WP_002290274.1|522124_522400_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_002290277.1|522411_522663_+	KH domain-containing protein	NA	NA	NA	NA	NA
WP_002297190.1|522787_523579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002293716.1|523748_524270_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_002293717.1|524259_525021_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_002286913.1|525156_525504_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_002288970.1|525761_526055_+	DUF2087 domain-containing protein	NA	NA	NA	NA	NA
WP_002324322.1|526778_527957_-|transposase	IS256-like element ISEfm2 family transposase	transposase	NA	NA	NA	NA
WP_002296840.1|528245_529433_+|transposase	IS256-like element IS16 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.3	8.2e-92
WP_002303963.1|529704_532032_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_025477176.1|532157_532487_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157999241.1|532526_533531_+	isopeptide-forming domain-containing fimbrial protein	NA	NA	NA	NA	NA
WP_002288982.1|535162_536335_+	class C sortase	NA	NA	NA	NA	NA
WP_002303955.1|536496_536952_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002288984.1|537540_537963_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002322902.1|538128_539322_-	MFS transporter	NA	NA	NA	NA	NA
WP_002302962.1|539545_539923_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002321036.1|539910_540249_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002288989.1|540382_540826_+	LysR family transcriptional regulator substrate-binding protein	NA	NA	NA	NA	NA
WP_002303949.1|541087_541903_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_002300930.1|541912_542575_+	DUF624 domain-containing protein	NA	NA	NA	NA	NA
WP_002289620.1|542779_544444_+	acetolactate synthase AlsS	NA	NA	NA	NA	NA
WP_002289619.1|544456_545167_+	acetolactate decarboxylase	NA	NA	NA	NA	NA
WP_002289618.1|545296_545794_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_002289617.1|545978_546239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002321266.1|546600_546840_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000997695.1|547176_548355_-|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_002302293.1|548793_549096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002288592.1|549852_550626_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_002288595.1|550769_551120_+	SdpI family protein	NA	NA	NA	NA	NA
WP_002288590.1|551100_551817_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.7	1.0e-33
WP_002288588.1|551816_553265_+	HAMP domain-containing histidine kinase	NA	A0A1V0SGX0	Hokovirus	29.3	1.7e-19
WP_002288586.1|553334_553844_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296838.1|553833_554559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002303943.1|554781_556902_-	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	58.0	8.2e-220
WP_002288581.1|557131_558310_+	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	48.9	3.9e-102
WP_002288579.1|558325_559084_+	type I 3-dehydroquinate dehydratase	NA	W6LP76	Streptococcus_phage	36.4	1.9e-25
WP_002288577.1|559106_559592_+|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
WP_002288576.1|559662_560916_-	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4PQX1	Staphylococcus_phage	55.3	7.7e-24
WP_002288575.1|561032_562382_+	NADP-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_002288574.1|562493_563840_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_000122610.1|564058_565351_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	38.9	3.2e-57
WP_002326704.1|566088_566997_-|transposase	IS982-like element ISEfm1 family transposase	transposase	NA	NA	NA	NA
WP_002311774.1|567209_568169_+|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	27.2	7.5e-11
WP_002293931.1|568421_568571_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002297633.1|569032_569245_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002287775.1|569522_571322_-	glycerophosphoryl diester phosphodiesterase membrane domain-containing protein	NA	I6XE30	Staphylococcus_phage	26.5	5.3e-10
WP_002287776.1|571445_572042_-	TVP38/TMEM64 family protein	NA	M1Q152	Streptococcus_phage	41.7	8.7e-34
WP_002301399.1|572231_573191_-|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	26.8	2.2e-10
WP_002296337.1|573456_573801_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_002296335.1|574312_574663_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002348678.1|574628_575960_-	DUF1576 domain-containing protein	NA	NA	NA	NA	NA
575971:575989	attL	CTTTTTCATTTTCTTTAAC	NA	NA	NA	NA
WP_002296332.1|576215_576782_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_069314710.1|577065_578271_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1S5S7K9	Streptococcus_phage	37.4	7.3e-64
WP_069314711.1|578408_578849_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002317583.1|578934_579135_-	hypothetical protein	NA	A0A097BY73	Enterococcus_phage	87.9	2.5e-25
WP_069314712.1|579163_579586_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0B5CTZ7	Listeria_phage	50.7	3.6e-34
WP_033655448.1|579602_580022_-	helix-turn-helix transcriptional regulator	NA	A0A0M4QX29	Bacillus_phage	62.3	3.0e-41
WP_002353431.1|580326_580521_+	hypothetical protein	NA	M1IFE9	Streptococcus_phage	53.1	1.1e-11
WP_002342110.1|580531_580798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069314713.1|580810_580990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286568.1|581032_581503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002286562.1|581589_582288_+	phage regulatory protein	NA	D2IYT0	Enterococcus_phage	34.6	1.7e-25
WP_002286559.1|582465_582807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286557.1|582799_583471_+	DUF1071 domain-containing protein	NA	A0A1B1P7F0	Bacillus_phage	47.4	4.2e-29
WP_069314714.1|583476_584163_+	hypothetical protein	NA	C9E2N1	Enterococcus_phage	70.0	2.2e-89
WP_069314715.1|584169_585021_+	phage replisome organizer N-terminal domain-containing protein	NA	A0A1S5SFJ6	Streptococcus_phage	67.1	2.1e-49
WP_069314716.1|585032_585302_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002301521.1|585306_585471_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010721325.1|585463_585766_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069314717.1|585762_585924_+	antitoxin	NA	NA	NA	NA	NA
WP_069314718.1|585926_586226_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069314719.1|586225_586516_+	hypothetical protein	NA	D2IZR3	Enterococcus_phage	42.4	2.4e-13
WP_069314720.1|586515_587040_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048946628.1|587036_587255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069314721.1|587565_588141_+	DUF1642 domain-containing protein	NA	A0A0E3T929	Enterococcus_phage	32.1	2.1e-16
WP_069314722.1|588151_588442_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002333292.1|588438_588612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069314723.1|588608_588839_+	hypothetical protein	NA	A0A0S2MYD2	Enterococcus_phage	50.7	8.8e-11
WP_002309099.1|588845_589049_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069314724.1|589045_589339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050397116.1|589368_589809_+	transcriptional regulator	NA	D2IYV6	Enterococcus_phage	37.7	9.0e-20
WP_010725701.1|589883_590351_+	ArpU family phage transcriptional regulator	NA	D7RWH7	Brochothrix_phage	29.1	2.4e-07
WP_154212406.1|590675_590819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069314725.1|591123_591510_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069314726.1|591490_591877_+	hypothetical protein	NA	A0A1B1P7N8	Bacillus_phage	37.3	8.7e-11
WP_002317992.1|591873_592254_+	HNH endonuclease	NA	A0A1B1P7N1	Bacillus_phage	67.2	9.1e-45
WP_002301332.1|592365_592818_+	hypothetical protein	NA	A0A2H4JFK0	uncultured_Caudovirales_phage	68.5	8.0e-48
WP_069314727.1|592814_594542_+|terminase	terminase large subunit	terminase	A0A2H4JDG5	uncultured_Caudovirales_phage	73.3	7.6e-264
593082:593100	attR	GTTAAAGAAAATGAAAAAG	NA	NA	NA	NA
WP_069314752.1|594605_595793_+|portal	phage portal protein	portal	A0A1B2APW5	Phage_Wrath	66.0	1.6e-143
WP_069314728.1|595764_596334_+|head,protease	HK97 family phage prohead protease	head,protease	A0A1B2APW1	Phage_Wrath	68.4	1.1e-65
WP_069314729.1|596346_597711_+|capsid	phage major capsid protein	capsid	A0A1B2APY9	Phage_Wrath	69.4	2.2e-125
WP_002301326.1|597712_597991_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1C8E967	Bacillus_phage	62.7	3.5e-22
WP_069314730.1|597971_598298_+|head	phage head closure protein	head	A0A0N7IRA3	Lactobacillus_phage	53.4	1.7e-23
WP_010725764.1|598287_598626_+	hypothetical protein	NA	A0A1B1P7P2	Bacillus_phage	47.7	6.6e-23
WP_069314731.1|598615_598981_+	HK97 gp10 family phage protein	NA	A0A2H4JDG0	uncultured_Caudovirales_phage	41.1	7.7e-17
WP_069314732.1|598987_599614_+|tail	phage tail protein	tail	A0A2H4JGN2	uncultured_Caudovirales_phage	34.5	4.4e-28
WP_069314733.1|599613_600078_+	hypothetical protein	NA	A0A2H4J956	uncultured_Caudovirales_phage	40.3	1.7e-16
WP_069314734.1|600272_602576_+|tail	phage tail tape measure protein	tail	Q8W5Z7	Listeria_phage	48.3	2.1e-83
WP_069314753.1|602587_603292_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_069314735.1|603288_606048_+|tail	phage tail protein	tail	D7RWE0	Brochothrix_phage	55.6	6.8e-49
WP_002350776.1|606060_606969_+|plate	phage baseplate upper protein	plate	A0A1P8BLW0	Lactococcus_phage	25.2	7.8e-10
>prophage 3
NZ_CP012460	Enterococcus faecium strain ISMMS_VRE_7 chromosome, complete genome	2850245	633203	704201	2850245	tRNA,transposase,protease	Streptococcus_phage(20.0%)	60	NA	NA
WP_002326809.1|633203_634499_-|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	5.0e-10
WP_002288442.1|634670_635372_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_002288439.1|635832_637062_+	arginine deiminase	NA	NA	NA	NA	NA
WP_002288437.1|637152_638172_+	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_002288434.1|638286_639234_+	carbamate kinase	NA	NA	NA	NA	NA
WP_002288432.1|639653_641345_+|tRNA	arginine--tRNA ligase	tRNA	A0A2I2L3K1	Orpheovirus	32.6	2.9e-74
WP_002288430.1|641797_642343_-	phosphonoacetaldehyde hydrolase	NA	NA	NA	NA	NA
WP_002326699.1|642346_642475_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002293881.1|643774_644254_-	ArgR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002293880.1|644612_645395_+	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_002293878.1|645493_646375_+	elongation factor Ts	NA	NA	NA	NA	NA
WP_002293877.1|646510_647233_+	UMP kinase	NA	NA	NA	NA	NA
WP_002293875.1|647235_647793_+	ribosome recycling factor	NA	NA	NA	NA	NA
WP_002287107.1|648111_649362_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
WP_002294134.1|649770_650583_+	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	46.8	2.0e-25
WP_002294135.1|650579_651380_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_002294136.1|651540_652809_+|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_002294137.1|652876_654586_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_002294138.1|654797_659150_+	PolC-type DNA polymerase III	NA	A0A0K2SUJ2	Clostridium_phage	41.4	3.9e-22
WP_002288499.1|659293_659767_+	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_002301262.1|659790_660966_+	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_002288501.1|660987_661281_+	YlxR family protein	NA	NA	NA	NA	NA
WP_002288509.1|661277_661589_+	YlxQ-related RNA-binding protein	NA	NA	NA	NA	NA
WP_002294141.1|661601_663908_+	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	23.7	3.6e-19
WP_002294142.1|663934_664282_+	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_002294143.1|664389_664611_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002288520.1|667788_668712_+|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_069314738.1|668715_669657_+	riboflavin biosynthesis protein RibF	NA	NA	NA	NA	NA
WP_002288522.1|670008_670794_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002296527.1|670806_671601_+	sugar transporter	NA	NA	NA	NA	NA
WP_002296526.1|671780_672233_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002294467.1|672697_673066_-	DUF1801 domain-containing protein	NA	NA	NA	NA	NA
WP_002294466.1|673215_673698_+|tRNA	prolyl-tRNA editing protein	tRNA	NA	NA	NA	NA
WP_002289537.1|673734_674745_+	LD-carboxypeptidase	NA	NA	NA	NA	NA
WP_002289536.1|674859_675573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002289535.1|675762_676353_-	glutamine amidotransferase	NA	NA	NA	NA	NA
WP_002300943.1|676836_677064_+	adenosine deaminase	NA	NA	NA	NA	NA
WP_002289534.1|677079_678246_+	oxygen-independent coproporphyrinogen III oxidase	NA	A0A0N7G7K6	Chrysochromulina_ericina_virus	32.8	5.5e-08
WP_002289532.1|678479_679523_+	heat-inducible transcriptional repressor HrcA	NA	NA	NA	NA	NA
WP_002296525.1|679616_680180_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_002292134.1|680230_682060_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	48.8	2.2e-136
WP_002289374.1|682210_683377_+	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	25.7	1.9e-24
WP_002297185.1|683563_684859_-|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	3.8e-10
WP_158294578.1|684926_685646_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002296523.1|685621_685795_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002292113.1|685839_686577_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	44.7	2.8e-34
WP_002296521.1|686578_688081_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_002294444.1|688339_690334_+	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_002296519.1|690343_693160_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	57.4	3.6e-311
WP_002294441.1|693422_694688_+	D-aspartate ligase	NA	NA	NA	NA	NA
WP_002296517.1|694691_695423_+	aspartate racemase	NA	NA	NA	NA	NA
WP_002289695.1|695557_696442_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	31.4	5.4e-08
WP_069314739.1|696438_697437_+	YvcK family protein	NA	A1IMD5	Streptococcus_phage	62.9	1.3e-114
WP_002289698.1|697470_698406_+	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	39.1	2.0e-53
WP_002321528.1|698948_699599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002326695.1|699785_700367_+	DUF443 family protein	NA	NA	NA	NA	NA
WP_000222572.1|700363_701317_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_002321467.1|701889_702141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002287830.1|702174_702453_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000997695.1|703022_704201_+|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP012460	Enterococcus faecium strain ISMMS_VRE_7 chromosome, complete genome	2850245	790278	839141	2850245	tRNA,integrase,transposase,protease	Streptococcus_phage(23.08%)	49	790153:790170	823310:823327
790153:790170	attL	AAAATAAGAAAATGTTGT	NA	NA	NA	NA
WP_002288335.1|790278_790980_+|tRNA	tRNA (adenine-N(1))-methyltransferase	tRNA	NA	NA	NA	NA
WP_002288338.1|790976_792098_+	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_002288340.1|792112_793345_+	peptidase T	NA	NA	NA	NA	NA
WP_002288343.1|793476_794385_+	YegS/Rv2252/BmrU family lipid kinase	NA	NA	NA	NA	NA
WP_002305633.1|794419_794692_+	DUF1294 domain-containing protein	NA	NA	NA	NA	NA
WP_069314742.1|794702_795749_+	flippase-like domain-containing protein	NA	NA	NA	NA	NA
WP_002301554.1|795999_798609_+	ATP-dependent chaperone ClpB	NA	A0A2I7SAX5	Vibrio_phage	35.0	1.6e-132
WP_002321495.1|798759_799446_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002288352.1|799423_799918_-	nucleoside deoxyribosyltransferase	NA	A0A1W6JK28	Lactococcus_phage	56.5	7.2e-42
WP_002288353.1|799937_801158_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002288355.1|801304_803140_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.4	3.4e-20
WP_002288357.1|803233_804361_-|integrase	site-specific integrase	integrase	A0A2I7SCV1	Paenibacillus_phage	55.5	1.8e-109
WP_000222572.1|804417_805371_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_000997695.1|805526_806705_-|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_002289415.1|807754_808168_-	Hsp20/alpha crystallin family protein	NA	A0A1B2LRT2	Wolbachia_phage	31.5	2.1e-07
WP_002303864.1|808623_809109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002305631.1|809247_809493_-	DUF378 domain-containing protein	NA	NA	NA	NA	NA
WP_002289420.1|809685_810486_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	26.2	2.6e-09
WP_002348791.1|810504_812373_+	HTH domain-containing protein	NA	NA	NA	NA	NA
WP_002289422.1|812365_812857_+	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002289423.1|812844_813399_+	PTS glucitol/sorbitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_002289425.1|813416_814412_+	PTS glucitol/sorbitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_002287107.1|814553_815804_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
WP_002296624.1|816212_816611_+	PTS glucitol/sorbitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_002311093.1|816594_817290_+	fructose-6-phosphate aldolase	NA	E3SKN5	Synechococcus_phage	31.5	1.0e-22
WP_002296627.1|817873_818761_-	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_002296628.1|818945_819785_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_002296629.1|819980_820955_+	LPXTG-anchored fibrinogen/nidogen-binding adhesin SgrA	NA	NA	NA	NA	NA
WP_002296631.1|821252_821609_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296632.1|821611_822769_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002296633.1|822794_823235_-	Spx/MgsR family RNA polymerase-binding regulatory protein	NA	NA	NA	NA	NA
WP_002296634.1|823394_823901_+	cysteine hydrolase	NA	NA	NA	NA	NA
823310:823327	attR	AAAATAAGAAAATGTTGT	NA	NA	NA	NA
WP_002311095.1|824068_825982_+	MucBP domain-containing protein	NA	NA	NA	NA	NA
WP_002296637.1|825986_826988_+	alpha/beta hydrolase	NA	M1PGN2	Moumouvirus	31.8	2.5e-09
WP_002296638.1|827189_827396_-	DUF3955 domain-containing protein	NA	NA	NA	NA	NA
WP_002296639.1|828041_828890_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002321675.1|828888_829956_+	decarboxylating 6-phosphogluconate dehydrogenase	NA	A0A1D8KGX1	Synechococcus_phage	35.3	3.9e-53
WP_002296641.1|829957_830959_+	2-hydroxyacid dehydrogenase	NA	M1H9J0	Paramecium_bursaria_Chlorella_virus	29.0	2.8e-24
WP_002321677.1|830955_831240_+	alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_002303106.1|831272_832070_+	iron-containing alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_002296646.1|832083_832917_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002303107.1|832934_833792_+	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
WP_002296648.1|833813_834323_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002296650.1|834359_834761_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002321678.1|834872_835226_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296653.1|835259_835703_+	PTS fructose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002296654.1|835719_836805_+	mannonate dehydratase	NA	NA	NA	NA	NA
WP_002296656.1|836797_837511_+	HAD family phosphatase	NA	A0A1D8KPI1	Synechococcus_phage	23.0	5.4e-06
WP_002302440.1|837839_839141_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	33.6	1.6e-48
>prophage 5
NZ_CP012460	Enterococcus faecium strain ISMMS_VRE_7 chromosome, complete genome	2850245	1134877	1143938	2850245		Synechococcus_phage(16.67%)	9	NA	NA
WP_002288010.1|1134877_1135456_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	37.4	1.3e-26
WP_002288011.1|1135452_1136505_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.7	2.7e-62
WP_002288013.1|1136527_1137967_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	33.1	5.3e-53
WP_002288015.1|1137951_1140174_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	41.3	1.9e-150
WP_002288017.1|1140174_1140846_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_002295474.1|1140847_1141102_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_002288021.1|1141101_1141830_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	E3SPA9	Prochlorococcus_phage	41.4	4.6e-45
WP_002297115.1|1142085_1142463_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288023.1|1142642_1143938_-	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	33.1	4.5e-19
>prophage 6
NZ_CP012460	Enterococcus faecium strain ISMMS_VRE_7 chromosome, complete genome	2850245	1171807	1211319	2850245	transposase,protease	Bacillus_virus(25.0%)	35	NA	NA
WP_002296623.1|1171807_1173103_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	37.5	3.9e-55
WP_002347134.1|1173091_1173574_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000997695.1|1173733_1174912_-|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_002295437.1|1176034_1176325_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000997695.1|1177471_1178650_-|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_002326685.1|1178964_1179588_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A249XZV3	Enterococcus_phage	56.4	3.9e-37
WP_002297012.1|1179671_1180394_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_002297010.1|1180383_1181121_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_002297008.1|1181132_1182125_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002297003.1|1182139_1182883_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002289757.1|1183123_1184446_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_002289763.1|1184432_1185398_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.9	2.0e-27
WP_002289765.1|1185394_1186933_-	ABC transporter permease/substrate-binding protein	NA	NA	NA	NA	NA
WP_002289767.1|1187348_1187636_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002297002.1|1187769_1188438_+	YitT family protein	NA	NA	NA	NA	NA
WP_002289257.1|1188728_1189469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002289258.1|1189598_1190546_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_002289259.1|1190674_1191439_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_002297001.1|1191442_1191832_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002289260.1|1191966_1192509_+	DUF2179 domain-containing protein	NA	NA	NA	NA	NA
WP_002326711.1|1192651_1193830_-|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_002289266.1|1194002_1194635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296999.1|1194768_1194894_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002289262.1|1195027_1195921_-	DUF1803 domain-containing protein	NA	NA	NA	NA	NA
WP_002289263.1|1196102_1197029_-	manganese-dependent inorganic pyrophosphatase	NA	NA	NA	NA	NA
WP_002289264.1|1197113_1197875_-	pyruvate formate lyase-activating protein	NA	NA	NA	NA	NA
WP_002289265.1|1198118_1200350_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	42.5	2.4e-169
WP_002303213.1|1200626_1203077_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	31.6	9.2e-98
WP_002303746.1|1203088_1205134_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	41.3	2.4e-115
WP_002296996.1|1205299_1205734_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_002296995.1|1205860_1206499_+	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_002297218.1|1206679_1207975_+|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002296994.1|1208152_1209028_-	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
WP_002290223.1|1209109_1209901_-	GTP-sensing pleiotropic transcriptional regulator CodY	NA	NA	NA	NA	NA
WP_002288421.1|1209918_1211319_-|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A173GFL6	Erwinia_phage	28.8	1.7e-43
>prophage 7
NZ_CP012460	Enterococcus faecium strain ISMMS_VRE_7 chromosome, complete genome	2850245	1411735	1495116	2850245	portal,head,integrase,terminase,capsid,tail,protease,holin,transposase	Enterococcus_phage(23.81%)	99	1430827:1430842	1497383:1497398
WP_002326809.1|1411735_1413031_+|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	5.0e-10
WP_002318627.1|1413140_1413434_-	iron-sulfur cluster biosynthesis protein	NA	NA	NA	NA	NA
WP_002289151.1|1413461_1414127_-	TrkA family potassium uptake protein	NA	NA	NA	NA	NA
WP_002348688.1|1414266_1414899_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_002348689.1|1414905_1415973_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_002295408.1|1415969_1416701_-	cell wall-active antibiotics response protein	NA	NA	NA	NA	NA
WP_002295409.1|1416868_1417348_-	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_002348690.1|1417483_1418659_-	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_002297066.1|1418823_1419984_+	serine hydrolase	NA	A0A2R4AS58	Mycobacterium_phage	25.2	3.2e-08
WP_002298534.1|1420023_1420971_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A1V0SKV4	Klosneuvirus	38.1	6.6e-52
WP_002298532.1|1421103_1422495_-	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_002298530.1|1422620_1423031_+	glycerol-3-phosphate cytidylyltransferase	NA	A0A1V0SGE7	Hokovirus	40.7	2.4e-19
WP_002297946.1|1424566_1425994_-	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_002297947.1|1425990_1427133_-	CDP-glycerol glycerophosphotransferase family protein	NA	NA	NA	NA	NA
WP_002297948.1|1427136_1428132_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_002297949.1|1428245_1429235_-	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	33.6	7.7e-11
WP_002348694.1|1429206_1430016_-	glycosyltransferase	NA	F2Y1U7	Organic_Lake_phycodnavirus	31.9	3.6e-14
WP_010782577.1|1430074_1431466_-	sugar transferase	NA	NA	NA	NA	NA
1430827:1430842	attL	GCTTCTTCTCTTTTTT	NA	NA	NA	NA
WP_002348696.1|1431753_1433892_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_002348697.1|1433930_1435517_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_002297957.1|1435506_1436727_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.9	1.1e-11
WP_002289081.1|1436738_1437545_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_010782578.1|1437852_1439127_+|transposase	ISL3-like element IS1476 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	36.1	8.6e-55
WP_002348825.1|1439261_1440542_-	EpaQ family protein	NA	NA	NA	NA	NA
WP_002348826.1|1440585_1442619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002286428.1|1442652_1443504_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	39.0	1.7e-38
WP_002294532.1|1443601_1444630_-	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	42.9	6.4e-69
WP_002286442.1|1444651_1445224_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	49.2	8.3e-42
WP_002286449.1|1445237_1446104_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	62.5	3.7e-102
WP_002321540.1|1446203_1446938_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_002286453.1|1446915_1447743_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_002286455.1|1447742_1448543_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_002286457.1|1448535_1449675_-	undecaprenyl/decaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase	NA	NA	NA	NA	NA
WP_002286461.1|1449750_1450674_-	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_002294533.1|1450705_1451470_-	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_002297963.1|1451627_1452068_+	flavodoxin	NA	NA	NA	NA	NA
WP_002286467.1|1452245_1452815_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002348827.1|1453071_1454304_+	aminopeptidase	NA	NA	NA	NA	NA
WP_076005172.1|1454608_1454809_+|integrase	tyrosine-type recombinase/integrase	integrase	Q9AZR0	Lactococcus_phage	75.7	4.6e-08
WP_002286680.1|1455057_1455360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286473.1|1455395_1455767_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296902.1|1455768_1456170_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002286474.1|1456183_1456591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087046766.1|1457513_1458676_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	54.2	4.1e-80
WP_002349643.1|1459615_1460641_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A139ZVY1	Enterococcus_phage	61.3	2.8e-64
WP_002286683.1|1460637_1460862_-|holin	phage holin	holin	NA	NA	NA	NA
WP_002286686.1|1460858_1461152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296594.1|1461189_1461327_-	XkdX family protein	NA	NA	NA	NA	NA
WP_002286491.1|1461328_1461775_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002290627.1|1461771_1461921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002286495.1|1461937_1464064_-	hypothetical protein	NA	A0A060AI60	Enterococcus_phage	40.1	1.4e-62
WP_002286497.1|1464087_1466379_-|tail	phage tail protein	tail	A0A1D3SNL1	Enterococcus_phage	30.0	9.6e-89
WP_002286500.1|1466388_1467126_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_002348716.1|1467176_1470608_-|tail	phage tail tape measure protein	tail	A0A1D3SNL5	Enterococcus_phage	44.4	3.1e-67
WP_002286510.1|1470809_1471172_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002286512.1|1471191_1471800_-	hypothetical protein	NA	Q8W5Z9	Listeria_phage	41.1	3.0e-34
WP_002286516.1|1471811_1472216_-	hypothetical protein	NA	R4IBU7	Listeria_phage	29.5	6.1e-07
WP_002296598.1|1472208_1472610_-	hypothetical protein	NA	A0A1B1P759	Bacillus_phage	33.3	1.1e-13
WP_002286522.1|1472599_1472953_-|head	phage head closure protein	head	NA	NA	NA	NA
WP_002286523.1|1472942_1473254_-	hypothetical protein	NA	A0A1B1P751	Bacillus_phage	42.1	6.3e-12
WP_002286524.1|1473250_1474126_-	hypothetical protein	NA	D2IYX3	Enterococcus_phage	74.2	5.6e-130
WP_002286525.1|1474135_1475296_-|capsid	phage major capsid protein	capsid	A0A1B1P752	Bacillus_phage	50.1	1.8e-99
WP_002286527.1|1475295_1475982_-|protease	Clp protease ClpP	protease	A0A2I6PDD0	Staphylococcus_phage	39.7	1.0e-30
WP_002286530.1|1475944_1477123_-|portal	phage portal protein	portal	A0A1B1P754	Bacillus_phage	40.4	5.4e-80
WP_002286533.1|1477142_1478837_-|terminase	terminase large subunit	terminase	A0A1B1P766	Bacillus_phage	49.6	3.0e-148
WP_002286538.1|1478814_1479129_-|terminase	terminase	terminase	A0A1S7FYW6	Listeria_phage	37.9	3.3e-08
WP_002296599.1|1479231_1479513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002286540.1|1479517_1479862_-	HNH endonuclease	NA	A0A1B1P757	Bacillus_phage	57.1	3.8e-26
WP_002296600.1|1479887_1480055_-	thymidylate synthase	NA	NA	NA	NA	NA
WP_002311723.1|1480250_1480457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002300143.1|1480910_1481186_+	hypothetical protein	NA	A0A2H4JEH2	uncultured_Caudovirales_phage	45.7	9.9e-17
WP_002296602.1|1481182_1481335_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002286542.1|1481643_1482057_-	autolysin	NA	C9E2P5	Enterococcus_phage	81.0	1.5e-56
WP_002286693.1|1482133_1482430_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002286545.1|1482426_1482984_-	DUF1642 domain-containing protein	NA	A0A0C5KKV2	Enterococcus_phage	36.2	2.8e-10
WP_002286547.1|1482980_1483400_-	YopX family protein	NA	D2IZL0	Enterococcus_phage	54.3	4.1e-30
WP_002322165.1|1483396_1483615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002286550.1|1483601_1483958_-	DUF1140 family protein	NA	A0A2H4JAZ4	uncultured_Caudovirales_phage	37.4	3.1e-10
WP_002286694.1|1483957_1484263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296606.1|1484259_1484421_-	antitoxin	NA	NA	NA	NA	NA
WP_002286695.1|1484417_1484720_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296607.1|1484712_1484877_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002286696.1|1484881_1485151_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002286552.1|1485162_1485912_-	helix-turn-helix domain-containing protein	NA	A0A1L2BY83	Clostridium_phage	54.0	1.7e-31
WP_002286553.1|1485914_1486601_-	hypothetical protein	NA	C9E2N1	Enterococcus_phage	69.1	3.2e-88
WP_002286557.1|1486606_1487278_-	DUF1071 domain-containing protein	NA	A0A1B1P7F0	Bacillus_phage	47.4	4.2e-29
WP_002286559.1|1487270_1487612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002286562.1|1487789_1488488_-	phage regulatory protein	NA	D2IYT0	Enterococcus_phage	34.6	1.7e-25
WP_002286568.1|1488574_1489045_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296610.1|1489087_1489267_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002286573.1|1489253_1489592_-	DUF771 domain-containing protein	NA	NA	NA	NA	NA
WP_002296611.1|1489607_1489811_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002290310.1|1489825_1490602_-	phage antirepressor	NA	A0A1Q1PVU2	Staphylococcus_phage	53.8	1.1e-73
WP_002296612.1|1490900_1491221_+	helix-turn-helix transcriptional regulator	NA	A0A1S5SDR1	Streptococcus_phage	40.2	2.0e-13
WP_002348715.1|1491238_1491670_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_002303013.1|1491799_1492261_+	SHOCT domain-containing protein	NA	A0A0F6N4L7	Staphylococcus_phage	34.8	4.5e-06
WP_002296616.1|1492294_1492930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296617.1|1493042_1493678_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286587.1|1493976_1495116_+|integrase	site-specific integrase	integrase	Q9AZR0	Lactococcus_phage	47.1	2.6e-95
1497383:1497398	attR	GCTTCTTCTCTTTTTT	NA	NA	NA	NA
>prophage 8
NZ_CP012460	Enterococcus faecium strain ISMMS_VRE_7 chromosome, complete genome	2850245	1566270	1574742	2850245		Streptococcus_phage(66.67%)	9	NA	NA
WP_002288083.1|1566270_1568460_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A0C5KKX3	Enterococcus_phage	66.6	1.8e-286
WP_002288081.1|1568774_1569377_+	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A288TZV3	Enterococcus_phage	58.6	1.7e-53
WP_002294035.1|1569430_1570552_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_002288078.1|1570660_1571533_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	60.4	3.1e-88
WP_002288076.1|1571601_1571949_-	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	41.1	5.1e-18
WP_002288073.1|1571941_1572766_-	stage 0 sporulation family protein	NA	NA	NA	NA	NA
WP_002288071.1|1572801_1573740_-	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	34.4	3.3e-35
WP_002292340.1|1573753_1574083_-	cyclic-di-AMP receptor	NA	NA	NA	NA	NA
WP_002294039.1|1574097_1574742_-	dTMP kinase	NA	M1PSC7	Streptococcus_phage	52.6	4.2e-58
>prophage 9
NZ_CP012460	Enterococcus faecium strain ISMMS_VRE_7 chromosome, complete genome	2850245	2009218	2056050	2850245	tRNA,transposase	Streptococcus_phage(40.0%)	44	NA	NA
WP_000997695.1|2009218_2010397_+|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_002321965.1|2010435_2010957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296909.1|2010922_2012560_+	membrane protein	NA	NA	NA	NA	NA
WP_002294728.1|2012704_2013445_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_002294730.1|2013635_2014271_-	DUF998 domain-containing protein	NA	NA	NA	NA	NA
WP_002294732.1|2014417_2015659_-	serine/threonine transporter SstT	NA	NA	NA	NA	NA
WP_025478783.1|2016868_2018917_+	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_002296623.1|2018963_2020259_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	37.5	3.9e-55
WP_002294735.1|2020457_2021174_-	DUF4767 domain-containing protein	NA	NA	NA	NA	NA
WP_000222572.1|2021272_2022226_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_002296256.1|2022317_2023316_-	DUF4767 domain-containing protein	NA	NA	NA	NA	NA
WP_002304106.1|2023390_2023687_-	peptidase	NA	NA	NA	NA	NA
WP_002296258.1|2023679_2023973_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296259.1|2024118_2024670_-	DUF1643 domain-containing protein	NA	NA	NA	NA	NA
WP_002296261.1|2024843_2025143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296262.1|2025169_2025436_-	DUF960 domain-containing protein	NA	NA	NA	NA	NA
WP_002340421.1|2025782_2026466_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002295755.1|2026502_2027000_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002326839.1|2027055_2027964_-|transposase	IS982-like element ISEfm1 family transposase	transposase	NA	NA	NA	NA
WP_002296391.1|2028443_2029235_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_002296392.1|2029425_2030061_-	DUF998 domain-containing protein	NA	NA	NA	NA	NA
WP_002291912.1|2030326_2031379_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002291914.1|2031391_2032330_-	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
WP_002296570.1|2032780_2033431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002301781.1|2033530_2034040_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	34.8	2.8e-17
WP_002331215.1|2034402_2034786_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002336652.1|2035026_2035641_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002336651.1|2036456_2037431_-	tagatose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_002336650.1|2037449_2037905_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_002336649.1|2037932_2039378_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_002331209.1|2039374_2040310_-	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_002331208.1|2040477_2041236_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002345001.1|2041730_2042930_-	MFS transporter	NA	NA	NA	NA	NA
WP_002331206.1|2043372_2043864_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002331205.1|2043890_2045036_-	galactonate dehydratase	NA	Q6A202	Oenococcus_phage	33.4	1.2e-52
WP_002336647.1|2045050_2046418_-	PTS galactitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_002331203.1|2046442_2046721_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002336646.1|2046739_2047198_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_002336645.1|2047209_2047830_-	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_002336644.1|2047840_2049883_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_010782519.1|2050260_2051400_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_002348733.1|2051396_2051981_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_010782518.1|2052170_2055203_-	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	23.2	4.0e-18
WP_001015311.1|2055369_2056050_+|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	1.5e-127
>prophage 10
NZ_CP012460	Enterococcus faecium strain ISMMS_VRE_7 chromosome, complete genome	2850245	2071569	2079306	2850245		Streptococcus_phage(66.67%)	6	NA	NA
WP_002345009.1|2071569_2071962_-	conjugal transfer protein	NA	A0A1S5SEX7	Streptococcus_phage	99.2	4.6e-68
WP_002345010.1|2072048_2072546_-	antirestriction protein ArdA	NA	A0A1S5SF25	Streptococcus_phage	97.6	1.3e-88
WP_032509114.1|2072662_2072887_-	hypothetical protein	NA	A0A1S5SEY0	Streptococcus_phage	97.1	8.5e-27
WP_002286940.1|2072990_2074901_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	29.8	7.1e-37
WP_000398284.1|2075684_2076890_-	replication initiation factor domain-containing protein	NA	A0A1S5SEX3	Streptococcus_phage	100.0	2.8e-233
WP_002297361.1|2077446_2079306_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	26.0	2.8e-30
>prophage 11
NZ_CP012460	Enterococcus faecium strain ISMMS_VRE_7 chromosome, complete genome	2850245	2110650	2200393	2850245	holin,tRNA,transposase	Lysinibacillus_phage(18.18%)	71	NA	NA
WP_086953915.1|2110650_2111990_-|transposase	IS3-like element ISEnfa3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.7	2.6e-78
WP_002300788.1|2112615_2113095_-	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_069314750.1|2115372_2116983_+|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	47.8	9.3e-123
WP_010782512.1|2116890_2119488_-	bifunctional acetaldehyde-CoA/alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_002300794.1|2119792_2120173_-	preprotein translocase subunit YajC	NA	NA	NA	NA	NA
WP_002294183.1|2120269_2121415_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	40.9	2.5e-82
WP_002341590.1|2121643_2122597_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_002294185.1|2122699_2123398_+	DUF975 family protein	NA	NA	NA	NA	NA
WP_002289743.1|2123565_2126205_-	cation-translocating P-type ATPase	NA	A0A1J0FA34	Only_Syngen_Nebraska_virus	31.2	1.6e-84
WP_002326809.1|2126914_2128210_-|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	5.0e-10
WP_002319878.1|2128371_2129667_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	37.2	1.5e-54
WP_002341590.1|2129757_2130711_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_002350806.1|2132387_2133419_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_002348889.1|2133611_2134787_+|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	Q6GZ03	Mycoplasma_phage	32.9	1.0e-17
WP_002293405.1|2134790_2135432_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002301114.1|2135428_2136346_+	osmoprotectant ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002301116.1|2136342_2137014_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002301121.1|2138244_2138511_-	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_002294199.1|2138510_2138774_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_002348885.1|2139248_2139434_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002294202.1|2139575_2141399_-	APC family permease	NA	NA	NA	NA	NA
WP_002294203.1|2141995_2144701_-	YhgE/Pip domain-containing protein	NA	NA	NA	NA	NA
WP_002301399.1|2144926_2145886_-|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	26.8	2.2e-10
WP_016171130.1|2146152_2147448_+|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.2	1.1e-09
WP_002294206.1|2147593_2148541_-	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_002293413.1|2148730_2149000_+	30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_002289874.1|2149175_2149538_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	A0A291I9M9	Lactobacillus_phage	37.8	7.6e-09
WP_002294207.1|2149548_2150670_-	alanine racemase	NA	NA	NA	NA	NA
WP_002294209.1|2150685_2151036_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_002294211.1|2151165_2152677_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	36.2	6.6e-62
WP_002317074.1|2152998_2154351_-	UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D- alanine ligase	NA	NA	NA	NA	NA
WP_002293424.1|2154503_2155580_-	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_002329999.1|2155775_2157521_+	AarF/ABC1/UbiB kinase family protein	NA	M4R0M8	Ostreococcus_lucimarinus_virus	28.1	1.3e-40
WP_002294214.1|2157769_2158237_-	YaiI/YqxD family protein	NA	NA	NA	NA	NA
WP_002294217.1|2158220_2159594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296548.1|2159914_2160403_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002294220.1|2160424_2161027_-	TVP38/TMEM64 family protein	NA	M1Q152	Streptococcus_phage	30.6	3.6e-19
WP_086953915.1|2161095_2162435_-|transposase	IS3-like element ISEnfa3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.7	2.6e-78
WP_002289751.1|2162949_2163579_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	40.2	3.1e-34
WP_002289749.1|2163662_2164358_-	noncanonical pyrimidine nucleotidase, YjjG family	NA	NA	NA	NA	NA
WP_002348768.1|2164370_2165087_-	pseudouridine synthase	NA	NA	NA	NA	NA
WP_002299254.1|2165416_2166025_+	50S ribosomal protein L25/general stress protein Ctc	NA	NA	NA	NA	NA
WP_002289744.1|2166349_2166673_+	DUF960 domain-containing protein	NA	NA	NA	NA	NA
WP_002289277.1|2166854_2168225_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_002326809.1|2169817_2171113_+|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	5.0e-10
WP_002294228.1|2171488_2172790_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_002321207.1|2173143_2175102_-	KUP/HAK/KT family potassium transporter	NA	M1HZV6	Acanthocystis_turfacea_Chlorella_virus	34.0	1.6e-63
WP_002289280.1|2175278_2175545_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_002297086.1|2176054_2178181_-	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
WP_002289282.1|2178368_2178638_-	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_002289284.1|2178888_2179452_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	37.1	2.3e-12
WP_002294232.1|2179704_2180226_-	transcription repressor NadR	NA	NA	NA	NA	NA
WP_002301156.1|2180228_2181071_-	chorismate mutase	NA	NA	NA	NA	NA
WP_002294236.1|2181063_2181789_-	NAD-dependent protein deacylase	NA	NA	NA	NA	NA
WP_002293448.1|2181964_2182261_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002294240.1|2184432_2185173_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.7	5.5e-30
WP_002294242.1|2185340_2186690_+	amino acid permease	NA	NA	NA	NA	NA
WP_002297079.1|2186817_2187408_-	DUF1211 domain-containing protein	NA	NA	NA	NA	NA
WP_002294246.1|2187554_2188907_+	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
WP_002289815.1|2189706_2190081_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002294249.1|2190197_2190680_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_002341570.1|2190731_2191310_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002289812.1|2191338_2192340_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.8	2.3e-07
WP_002290528.1|2192352_2192955_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_002294252.1|2193124_2193571_-	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_002294254.1|2193647_2194361_-	trehalose operon repressor	NA	A0A291LID1	Streptomyces_phage	39.7	1.2e-05
WP_002348864.1|2194583_2196572_+	PTS system trehalose-specific EIIBC component	NA	NA	NA	NA	NA
WP_002296127.1|2196651_2198199_-|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_002287659.1|2198300_2198654_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_002285758.1|2198643_2198838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002297218.1|2199097_2200393_+|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
>prophage 12
NZ_CP012460	Enterococcus faecium strain ISMMS_VRE_7 chromosome, complete genome	2850245	2413632	2464680	2850245	integrase,transposase	Bacillus_phage(25.0%)	58	2442038:2442053	2452282:2452297
WP_002318021.1|2413632_2414799_-|integrase	site-specific integrase	integrase	A0A172LN96	Lactococcus_phage	34.0	3.3e-45
WP_002322813.1|2414853_2415504_-	helix-turn-helix transcriptional regulator	NA	Q20DG0	Lactobacillus_phage	33.3	3.2e-05
WP_002348874.1|2415578_2415782_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002321715.1|2415789_2416116_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002348875.1|2416270_2417314_+	replication initiator protein A	NA	NA	NA	NA	NA
WP_002348876.1|2417315_2417534_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016252733.1|2417520_2420166_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002322855.1|2420179_2420368_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002348879.1|2420379_2420991_+	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
WP_002348880.1|2420975_2422367_+	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_002322858.1|2422582_2422885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002348881.1|2422877_2423225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010782540.1|2423284_2424559_-|transposase	ISL3-like element IS1476 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	36.1	6.6e-55
WP_010782541.1|2424732_2424879_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002322860.1|2425015_2425330_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002322861.1|2425428_2425677_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_002322862.1|2425905_2426679_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002348835.1|2426783_2427029_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002322864.1|2427088_2427238_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002348834.1|2427404_2427884_+	DUF3841 domain-containing protein	NA	NA	NA	NA	NA
WP_002350767.1|2428061_2429558_+	RNA-directed DNA polymerase	NA	Q2P9X6	Enterobacteria_phage	34.3	8.5e-70
WP_002322866.1|2429703_2430018_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_002322867.1|2430133_2431393_+	M20 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_002322868.1|2431404_2431863_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002348831.1|2431937_2432717_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002322870.1|2432965_2434513_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_002322871.1|2434533_2435913_+	M24 family metallopeptidase	NA	NA	NA	NA	NA
WP_010782508.1|2435953_2437399_-|transposase	IS1182-like element ISEfa7 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	47.8	2.2e-123
WP_002298774.1|2437623_2438598_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_002312606.1|2438579_2439041_+	PTS fructose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002298777.1|2439090_2439555_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002298779.1|2439568_2440318_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002298780.1|2440317_2441148_+	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
WP_002322873.1|2441147_2441795_+	HAD family phosphatase	NA	M1I5S4	Acanthocystis_turfacea_Chlorella_virus	27.4	4.5e-12
WP_002298782.1|2441892_2442669_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
2442038:2442053	attL	ACCTTTTCTAAAATAA	NA	NA	NA	NA
WP_002364278.1|2444218_2444629_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002348684.1|2444709_2445330_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002297291.1|2445659_2446886_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_002320809.1|2446957_2447116_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002297292.1|2447803_2448544_+	metal ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	33.2	5.7e-19
WP_002297293.1|2448635_2449823_-|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	28.7	4.6e-26
WP_002297294.1|2450144_2450987_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_002297302.1|2451947_2452181_+	iron-dependent repressor	NA	NA	NA	NA	NA
WP_071858995.1|2452511_2453096_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
2452282:2452297	attR	TTATTTTAGAAAAGGT	NA	NA	NA	NA
WP_002297304.1|2453226_2453895_+	cobalt transporter	NA	NA	NA	NA	NA
WP_002297306.1|2453905_2455321_+	energy-coupling factor ABC transporter ATP-binding protein	NA	A0A1V0SGN0	Hokovirus	26.4	5.8e-20
WP_002297308.1|2455338_2455908_+	MptD family putative ECF transporter S component	NA	NA	NA	NA	NA
WP_002297309.1|2456017_2457772_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	24.8	1.3e-24
WP_002321752.1|2457731_2459498_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.1	3.5e-30
WP_002297316.1|2460020_2460290_+	30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_002297318.1|2460304_2460484_+	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_002297319.1|2460515_2460893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002297320.1|2460913_2461063_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_002304819.1|2461086_2462070_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_002322279.1|2462099_2462222_+	putative metal homeostasis protein	NA	NA	NA	NA	NA
WP_002297324.1|2462239_2463763_+	zinc ABC transporter substrate-binding protein AdcA	NA	NA	NA	NA	NA
WP_002304820.1|2463786_2464026_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002297325.1|2464218_2464680_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.0	1.5e-12
>prophage 13
NZ_CP012460	Enterococcus faecium strain ISMMS_VRE_7 chromosome, complete genome	2850245	2501818	2510850	2850245		Streptococcus_phage(83.33%)	10	NA	NA
WP_002297353.1|2501818_2503003_-	replication initiation factor domain-containing protein	NA	A0A1S5SEX3	Streptococcus_phage	61.6	2.9e-142
WP_002297354.1|2503261_2503552_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002297357.1|2504759_2504924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002297358.1|2504916_2505591_-	zeta toxin family protein	NA	NA	NA	NA	NA
WP_002297360.1|2505668_2505908_-	hypothetical protein	NA	A0A1S5SFB5	Streptococcus_phage	80.3	2.1e-23
WP_002297361.1|2506001_2507861_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	26.0	2.8e-30
WP_002343904.1|2508575_2509721_-	DUF87 domain-containing protein	NA	A0A1S5SFB5	Streptococcus_phage	62.8	6.0e-132
WP_002297364.1|2509803_2510139_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002297365.1|2510148_2510523_-	YdcP family protein	NA	A0A1S5SF96	Streptococcus_phage	66.1	2.4e-34
WP_002297366.1|2510535_2510850_-	YdcP family protein	NA	A0A1S5SF38	Streptococcus_phage	53.4	1.0e-25
>prophage 14
NZ_CP012460	Enterococcus faecium strain ISMMS_VRE_7 chromosome, complete genome	2850245	2593379	2714899	2850245	holin,tRNA,transposase,protease	Bacillus_phage(22.22%)	87	NA	NA
WP_002287372.1|2593379_2594318_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	29.7	5.2e-09
WP_002287374.1|2594317_2595676_+	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_002287376.1|2595688_2596429_+	Stp1/IreP family PP2C-type Ser/Thr phosphatase	NA	NA	NA	NA	NA
WP_002287377.1|2596425_2598495_+	Stk1 family PASTA domain-containing Ser/Thr kinase	NA	A0A1V0SDC3	Indivirus	30.3	3.5e-21
WP_002287379.1|2598659_2599559_+	ribosome small subunit-dependent GTPase A	NA	NA	NA	NA	NA
WP_002287380.1|2599571_2600222_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_002287382.1|2600222_2600861_+	thiamine diphosphokinase	NA	NA	NA	NA	NA
WP_002296044.1|2601015_2601870_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_002287385.1|2601873_2602383_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_002322795.1|2602637_2604176_+	C40 family peptidase	NA	B5LJD6	Mycobacterium_phage	50.5	2.3e-17
WP_002297218.1|2604308_2605604_-|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002322796.1|2605765_2607565_-	M3 family oligoendopeptidase	NA	NA	NA	NA	NA
WP_002287389.1|2607687_2608194_+	VanZ family protein	NA	NA	NA	NA	NA
WP_002287391.1|2608272_2608995_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_002287397.1|2609072_2610473_-	peptidoglycan binding domain-containing protein	NA	NA	NA	NA	NA
WP_002287399.1|2610642_2611617_-	L-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_002287401.1|2611969_2612530_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_002287403.1|2612546_2616068_+	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_002287405.1|2616082_2617678_+	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_002287407.1|2617688_2617958_+	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_002287409.1|2618024_2618450_+	septum formation initiator family protein	NA	NA	NA	NA	NA
WP_002287412.1|2618495_2618966_+	RNA-binding protein S1	NA	NA	NA	NA	NA
WP_002287414.1|2619085_2620531_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	E3T4I1	Cafeteria_roenbergensis_virus	24.5	6.8e-08
WP_002287415.1|2620530_2621076_+	hypoxanthine phosphoribosyltransferase	NA	A0A1V0SEQ1	Hokovirus	25.3	4.1e-06
WP_002287418.1|2621165_2623277_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	C7U047	Ostreococcus_tauri_virus	50.3	9.1e-110
WP_002296053.1|2623493_2624381_+	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_002290055.1|2624381_2625386_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_002296055.1|2625496_2626993_+|tRNA	lysine--tRNA ligase	tRNA	A0A2K9KZX5	Tupanvirus	40.9	8.7e-91
WP_002297218.1|2635173_2636469_-|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002289731.1|2636823_2638017_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	72.0	1.3e-150
WP_002295566.1|2638146_2639619_+	MFS transporter	NA	NA	NA	NA	NA
WP_002295567.1|2639701_2640490_+	esterase family protein	NA	NA	NA	NA	NA
WP_002285876.1|2640556_2641225_-	TetR/AcrR family transcriptional regulator C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_002285883.1|2641339_2643052_+	ABC transporter ATP-binding protein	NA	F2Y302	Organic_Lake_phycodnavirus	25.4	1.2e-14
WP_002301355.1|2643054_2644827_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.4	1.2e-54
WP_086953915.1|2644952_2646291_+|transposase	IS3-like element ISEnfa3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.7	2.6e-78
WP_000997695.1|2647162_2648341_-|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_002341521.1|2648438_2648795_-	hypothetical protein	NA	U4KJ82	Streptococcus_phage	42.2	9.2e-15
WP_002304713.1|2648866_2649799_-	DUF4041 domain-containing protein	NA	M1NRY5	Streptococcus_phage	53.8	1.8e-57
WP_002301399.1|2650001_2650961_+|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	26.8	2.2e-10
WP_002301818.1|2651093_2651300_+|holin	phage holin	holin	NA	NA	NA	NA
WP_002303477.1|2651310_2652330_+	peptidoglycan recognition protein	NA	A0A1G5SA77	Enterococcus_phage	66.1	2.4e-60
WP_025479400.1|2653104_2653407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296840.1|2653503_2654691_+|transposase	IS256-like element IS16 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.3	8.2e-92
WP_000997695.1|2655098_2656277_+|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_002348687.1|2656301_2656460_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002285906.1|2656895_2657462_-	methyltransferase domain-containing protein	NA	A0A2H4PQV0	Staphylococcus_phage	42.8	2.2e-34
WP_002285909.1|2657461_2658418_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	57.4	3.3e-43
WP_002285911.1|2658417_2659074_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_002301403.1|2659443_2661462_+	LysM peptidoglycan-binding domain-containing protein	NA	Q9ZXE4	Bacillus_phage	39.6	5.8e-13
WP_002285916.1|2661888_2664303_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	72.8	0.0e+00
WP_002285917.1|2664650_2666204_+	glycosyl hydrolase	NA	NA	NA	NA	NA
WP_002285918.1|2666584_2668369_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.2	2.7e-46
WP_002285920.1|2668383_2670105_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.0	1.7e-37
WP_002303189.1|2670204_2670966_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_104674935.1|2677533_2677704_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_002285932.1|2677897_2678077_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_002297280.1|2678086_2678311_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002321621.1|2678463_2679576_+	FUSC family protein	NA	NA	NA	NA	NA
WP_002285944.1|2679653_2679947_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_002285948.1|2680114_2680429_+	PTS cellobiose transporter subunit IIB	NA	NA	NA	NA	NA
WP_002285949.1|2680449_2682429_+	BglG family transcription antiterminator	NA	NA	NA	NA	NA
WP_002285954.1|2682441_2682768_+	PTS cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002285960.1|2682783_2683302_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002285961.1|2683301_2684654_+	PTS cellobiose transporter subunit IIC	NA	NA	NA	NA	NA
WP_002285962.1|2684737_2686243_-	UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--L- lysine ligase	NA	NA	NA	NA	NA
WP_002285964.1|2686334_2686925_-	YitT family protein	NA	NA	NA	NA	NA
WP_002304848.1|2687103_2688750_+	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_002285969.1|2688798_2689518_+	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_002285971.1|2689996_2690944_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_002285972.1|2690955_2691876_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_002285974.1|2691916_2693374_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010782528.1|2693718_2694333_+	DUF624 domain-containing protein	NA	NA	NA	NA	NA
WP_002285976.1|2694325_2696050_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_002304851.1|2696046_2697498_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_002285980.1|2697970_2700124_-	GH92 family glycosyl hydrolase	NA	NA	NA	NA	NA
WP_002302559.1|2700125_2701172_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_002294491.1|2701321_2702611_+	glycoside hydrolase family 125 protein	NA	NA	NA	NA	NA
WP_002285985.1|2702623_2705326_+	alpha-mannosidase	NA	NA	NA	NA	NA
WP_002285988.1|2705310_2706168_+	ROK family protein	NA	NA	NA	NA	NA
WP_002348711.1|2706238_2707138_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_002294492.1|2707306_2709478_+	PBP1A family penicillin-binding protein	NA	NA	NA	NA	NA
WP_002285994.1|2709545_2709887_+	YlbF family regulator	NA	A0A1X9I5Y8	Streptococcus_phage	34.9	1.3e-10
WP_002302556.1|2710162_2711917_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.9	4.1e-39
WP_002285996.1|2711927_2712764_-	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_002294493.1|2712765_2713449_-	rhamnogalacturonan acetylesterase	NA	NA	NA	NA	NA
WP_002297218.1|2713603_2714899_-|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
>prophage 1
NZ_CP012461	Enterococcus faecium strain ISMMS_VRE_7 plasmid ISMMS_VRE7_p1, complete sequence	200151	3800	56962	200151	transposase,integrase	Streptococcus_phage(12.5%)	44	35004:35019	44508:44523
WP_002336713.1|3800_4481_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.1	5.8e-127
WP_002331328.1|4976_5198_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002342384.1|5213_6056_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002342383.1|6118_7921_+	3'-5' exoribonuclease	NA	A0A0A7RWA3	Clostridium_phage	30.4	7.6e-33
WP_016171164.1|7979_8888_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_002340501.1|10495_10675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002313084.1|10720_11326_-	recombinase family protein	NA	A0A219YA40	Aeromonas_phage	32.6	3.6e-19
WP_016171162.1|12360_13332_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	22.4	1.2e-05
WP_016171161.1|13471_14785_+	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002348858.1|14827_15694_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_002313079.1|15690_16539_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_002322556.1|16552_18025_+	glycoside hydrolase family 32 protein	NA	NA	NA	NA	NA
WP_016171159.1|18041_18914_+	ROK family protein	NA	NA	NA	NA	NA
WP_002292678.1|22177_22507_+	AbrB family transcriptional regulator	NA	NA	NA	NA	NA
WP_002313074.1|22496_22784_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_002292680.1|23069_23927_+	ParA family protein	NA	F0PIG8	Enterococcus_phage	30.7	8.1e-33
WP_002292681.1|23927_24476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002348804.1|24735_25464_+	hypothetical protein	NA	A0A1B0T6A2	Bacillus_phage	26.5	6.3e-10
WP_010782530.1|25493_26666_+	S8 family serine peptidase	NA	A0A217EQY2	Bacillus_phage	33.5	1.5e-13
WP_010782694.1|26589_27543_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.1	1.8e-33
WP_010782532.1|27624_27975_-	ribonucleotide-diphosphate reductase subunit beta	NA	A0A096XT60	Enterococcus_phage	43.8	6.0e-19
WP_002348760.1|28023_28467_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	NA	NA	NA	NA
WP_002348761.1|28613_29279_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_025480881.1|29268_29724_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	53.5	2.3e-34
WP_002348763.1|29873_31253_+	Xaa-Pro aminopeptidase	NA	NA	NA	NA	NA
WP_002348764.1|31389_32232_+	glycosyltransferase family 8 protein	NA	NA	NA	NA	NA
WP_002348758.1|33868_35641_+	AAA family ATPase	NA	K4I1H4	Acidithiobacillus_phage	36.1	2.1e-19
35004:35019	attL	TAAAACATTTAAAAGA	NA	NA	NA	NA
WP_010782535.1|35615_36908_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010782529.1|37370_38279_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_002348634.1|38645_39944_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_002303241.1|41947_42898_+	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_002303240.1|43415_43871_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_172820227.1|44268_44814_+	hypothetical protein	NA	F2Y1B5	Organic_Lake_phycodnavirus	31.8	7.0e-14
44508:44523	attR	TAAAACATTTAAAAGA	NA	NA	NA	NA
WP_072538890.1|44907_45240_+	topoisomerase I	NA	A0A1X9I6W8	Streptococcus_phage	96.8	2.2e-42
WP_002290556.1|46374_47142_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_002290555.1|47631_48057_+	galactose-6-phosphate isomerase subunit LacA	NA	NA	NA	NA	NA
WP_002290554.1|48073_48589_+	galactose-6-phosphate isomerase subunit LacB	NA	A0A222YX14	Synechococcus_phage	36.0	3.3e-05
WP_002290553.1|48599_49532_+	tagatose-6-phosphate kinase	NA	NA	NA	NA	NA
WP_002290551.1|49534_50515_+	tagatose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_002290549.1|50858_52565_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_002290548.1|52706_54113_+	6-phospho-beta-galactosidase	NA	A0A0B5JD41	Pandoravirus	29.0	3.6e-46
WP_002305107.1|54135_54408_+	DUF3884 family protein	NA	NA	NA	NA	NA
WP_002303235.1|54428_55328_+	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
WP_102642289.1|55799_56962_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	50.9	1.5e-77
>prophage 2
NZ_CP012461	Enterococcus faecium strain ISMMS_VRE_7 plasmid ISMMS_VRE7_p1, complete sequence	200151	71434	128913	200151	transposase,integrase	Paenibacillus_phage(18.18%)	52	75875:75901	123876:123902
WP_002316137.1|71434_72607_-|transposase	IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	98.4	1.1e-133
WP_002307497.1|73280_74093_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002324322.1|74628_75807_-|transposase	IS256-like element ISEfm2 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	24.9	2.6e-29
75875:75901	attL	TATTTACACAAAATATTTTACACTCTC	NA	NA	NA	NA
WP_002301108.1|77060_77615_+|integrase	tyrosine-type recombinase/integrase	integrase	W8CYP1	Bacillus_phage	46.1	8.6e-36
WP_002326839.1|78290_79199_+|transposase	IS982-like element ISEfm1 family transposase	transposase	NA	NA	NA	NA
WP_002313278.1|79268_79748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099745858.1|80372_81535_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	53.8	1.2e-79
WP_002298088.1|81809_82352_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002330699.1|82507_82957_+	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_087121905.1|82986_84149_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	54.2	4.1e-80
WP_002301194.1|84398_85676_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002298083.1|85685_86342_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.1	1.3e-22
WP_002301195.1|86341_87718_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_069314754.1|88003_89626_-|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	47.3	7.9e-122
WP_002302275.1|90277_91249_+	radical SAM protein	NA	NA	NA	NA	NA
WP_002322470.1|91326_91563_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_077828694.1|91531_91663_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_002330694.1|91738_92122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002302270.1|92154_92940_-	histidinol phosphate phosphatase	NA	NA	NA	NA	NA
WP_002347701.1|93117_94218_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_002302267.1|94207_95032_+	alkaline phosphatase family protein	NA	NA	NA	NA	NA
WP_002330693.1|95028_95844_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_002313180.1|95840_96671_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002302261.1|96677_97709_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.6	1.8e-26
WP_016922460.1|99315_99501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002348630.1|99624_100341_+	aminotransferase class V-fold PLP-dependent enzyme	NA	Q2XUY6	environmental_halophage	50.0	4.5e-45
WP_002285815.1|101050_101704_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	33.2	4.0e-24
WP_002300494.1|101700_103020_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_002325565.1|103121_103802_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.1	1.3e-126
WP_000751236.1|103932_104385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000718009.1|104398_105088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000344083.1|105212_107564_+	DUF1906 domain-containing protein	NA	NA	NA	NA	NA
WP_002304891.1|107643_108039_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001224538.1|108363_108981_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	33.1	5.1e-13
WP_000366408.1|109021_109321_+	BRCT domain-containing protein	NA	NA	NA	NA	NA
WP_000824191.1|109354_109522_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002304893.1|109566_110130_-	recombinase family protein	NA	A0A1V0E035	Clostridioides_phage	34.9	2.2e-18
WP_002319817.1|110157_110838_-|transposase	IS6-like element ISS1N family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	84.1	2.5e-109
WP_000195429.1|112781_113954_-|transposase	IS256-like element IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	100.0	3.5e-135
WP_010782692.1|114583_115264_+|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.1	5.8e-127
WP_002300493.1|115603_116773_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_002296127.1|116978_118526_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	28.9	1.7e-44
WP_002287659.1|118627_118981_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	38.7	5.7e-17
WP_002285758.1|118970_119165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002287874.1|120235_121063_+	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	NA	NA	NA	NA
WP_002287875.1|121077_121926_+	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_002287876.1|121935_122331_+	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_073120200.1|123279_123576_-|transposase	IS3 family transposase	transposase	A0A0C5AEB1	Paenibacillus_phage	59.2	6.7e-19
WP_002346943.1|123927_125106_-|transposase	IS256-like element ISEf1 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	25.3	4.0e-30
123876:123902	attR	GAGAGTGTAAAATATTTTGTGTAAATA	NA	NA	NA	NA
WP_002313174.1|125356_125617_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002301811.1|125890_127183_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	41.0	6.1e-32
WP_087043335.1|127751_128913_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	51.3	1.2e-79
>prophage 3
NZ_CP012461	Enterococcus faecium strain ISMMS_VRE_7 plasmid ISMMS_VRE7_p1, complete sequence	200151	135019	198511	200151	transposase,integrase,bacteriocin,holin	Streptococcus_phage(25.0%)	59	155482:155541	198883:198956
WP_000222572.1|135019_135973_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.8	3.7e-34
WP_002301591.1|136080_137166_-	tyrosine recombinase XerS	NA	NA	NA	NA	NA
WP_002287870.1|139241_139760_-	ClbS/DfsB family four-helix bundle protein	NA	NA	NA	NA	NA
WP_086956687.1|140877_142039_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	51.3	1.6e-79
WP_002300328.1|142537_143014_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002289252.1|143026_144529_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_002289253.1|144542_145232_-	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_002289254.1|145392_146211_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002289255.1|146440_146671_+	resolvase	NA	NA	NA	NA	NA
WP_002301718.1|147256_147712_-|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.6	1.3e-13
WP_086953894.1|147954_149380_+|transposase	IS3-like element ISEfa10 family transposase	transposase	A0A1B1P773	Bacillus_phage	40.2	2.3e-48
WP_002302077.1|149550_150513_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	25.8	2.3e-20
WP_002302078.1|150514_151954_-	sucrose-6-phosphate hydrolase	NA	S6ATV4	Bacillus_phage	25.1	1.4e-16
WP_002303302.1|152138_154085_+	PTS beta-glucoside transporter subunit IIBCA	NA	NA	NA	NA	NA
WP_002305879.1|154348_155221_+	ROK family protein	NA	NA	NA	NA	NA
155482:155541	attL	GGTTCTGTTGCAAAGTTTTAAATCTACTATCAAATAAGGTAGAATAATAGAAAAAGATAG	NA	NA	NA	NA
WP_002322465.1|156236_156836_-	bacteriophage abortive infection AbiH family protein	NA	NA	NA	NA	NA
WP_002301839.1|156899_157499_-|integrase	tyrosine-type recombinase/integrase	integrase	D2XR58	Bacillus_phage	36.1	1.3e-29
WP_002300846.1|158452_158635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305884.1|158618_158804_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_002300843.1|159046_160567_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	31.6	1.1e-48
WP_002285758.1|160748_160943_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002287659.1|160932_161286_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	38.7	5.7e-17
WP_002303202.1|161387_162935_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	28.9	2.8e-44
WP_002300842.1|163106_163679_-	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_002300841.1|163685_164348_-	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_002300840.1|164363_164879_-	YjbQ family protein	NA	NA	NA	NA	NA
WP_002300838.1|164880_165165_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002300836.1|165198_166527_-	PTS galactitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_002300835.1|166540_166996_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_002332708.1|168940_169849_-|transposase	IS982-like element ISEfm1 family transposase	transposase	NA	NA	NA	NA
WP_002348774.1|170485_171805_-|transposase	IS1380-like element IS1678 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	82.7	6.3e-210
WP_000997695.1|172064_173243_-|transposase	IS256-like element ISEf1 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	25.6	3.0e-30
WP_002300807.1|173614_173878_-|bacteriocin	uberolysin/carnocyclin family circular bacteriocin	bacteriocin	NA	NA	NA	NA
WP_000222572.1|173998_174952_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.8	3.7e-34
WP_002311569.1|175920_176277_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002300804.1|176335_176515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002300801.1|176959_177232_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002300799.1|177241_177397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002300797.1|177412_177664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002305810.1|177663_177870_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002305809.1|178312_178537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002295624.1|178726_178849_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_002303482.1|179007_179241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002303483.1|179773_180673_-	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_002303484.1|180685_181282_-	type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein	NA	NA	NA	NA	NA
WP_002295632.1|181362_181512_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002303486.1|181627_183637_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	52.6	1.6e-111
WP_002353594.1|183647_185117_-	toprim domain-containing protein	NA	NA	NA	NA	NA
WP_002305801.1|185177_187550_-	hypothetical protein	NA	B5SP25	Lactococcus_phage	29.7	3.4e-12
WP_002297404.1|187959_189210_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
WP_002295674.1|189446_189788_-	DUF5406 domain-containing protein	NA	F0PIH7	Enterococcus_phage	62.5	1.5e-35
WP_002323647.1|190406_190739_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002303636.1|191562_192603_-	replication initiator protein A	NA	NA	NA	NA	NA
WP_002348857.1|193954_194149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002323589.1|194854_196003_-|transposase	transposase	transposase	A0A288TXV8	Enterococcus_phage	93.7	9.0e-205
WP_002287522.1|196019_196424_-|transposase	IS200/IS605-like element ISEfa4 family transposase	transposase	A0A286QN76	Streptococcus_phage	73.8	1.3e-52
WP_002303208.1|196782_197037_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002290394.1|197037_197355_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_010782695.1|197830_198511_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	98.2	3.2e-125
198883:198956	attR	GGTTCTGTTGCAAAGTTTTAAATCTACTATCAAATAAGGTAGAATAATAGAAAAAGATAGCAGGAGGAATGACG	NA	NA	NA	NA
>prophage 1
NZ_CP012464	Enterococcus faecium strain ISMMS_VRE_7 plasmid ISMMS_VRE7_p4, complete sequence	38586	298	9608	38586	transposase	Streptococcus_phage(50.0%)	8	NA	NA
WP_016171137.1|298_1624_-	Y-family DNA polymerase	NA	M1Q231	Streptococcus_phage	43.8	4.1e-100
WP_002299575.1|1792_2377_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	51.7	5.9e-43
WP_002299573.1|2587_2791_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002288787.1|2800_3223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010782630.1|3536_4151_+	recombinase family protein	NA	M9Q1K0	Clostridium_phage	30.9	4.9e-16
WP_016171138.1|4300_5560_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	38.2	1.1e-54
WP_001015311.1|5613_6294_+|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	1.5e-127
WP_000443455.1|8132_9608_-	RNA-directed DNA polymerase	NA	Q2P9X6	Enterobacteria_phage	34.8	3.5e-68
>prophage 2
NZ_CP012464	Enterococcus faecium strain ISMMS_VRE_7 plasmid ISMMS_VRE7_p4, complete sequence	38586	25580	34477	38586	transposase	Streptococcus_phage(100.0%)	10	NA	NA
WP_001015311.1|25580_26261_+|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	1.5e-127
WP_002321977.1|26290_26833_-	HTH domain-containing protein	NA	A0A1B0RXM1	Streptococcus_phage	98.3	2.4e-91
WP_001096887.1|27108_27903_-	aminoglycoside O-phosphotransferase APH(3')-IIIa	NA	E4ZFP6	Streptococcus_phage	100.0	2.3e-154
WP_000627290.1|27995_28538_-	streptothricin N-acetyltransferase Sat4	NA	A0A1B0RXL7	Streptococcus_phage	100.0	8.9e-94
WP_000662263.1|29479_30214_-	class I SAM-dependent methyltransferase	NA	A0A1X9I6N4	Streptococcus_phage	100.0	1.5e-141
WP_000228166.1|30194_31064_-	nucleotidyltransferase domain-containing protein	NA	A0A1X9I6C9	Streptococcus_phage	95.8	4.3e-159
WP_000567888.1|31166_31412_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_001038792.1|32705_33443_-	23S rRNA (adenine(2058)-N(6))-methyltransferase Erm(B)	NA	E4ZFQ0	Streptococcus_phage	99.2	7.0e-134
WP_001814874.1|33567_33651_-	23S rRNA methyltransferase attenuation leader peptide	NA	NA	NA	NA	NA
WP_002343844.1|33796_34477_+|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	98.7	6.5e-126
