The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP012693	Escherichia coli strain FORC_028 chromosome, complete genome	5704396	978892	985799	5704396	transposase,integrase	Stx2-converting_phage(50.0%)	6	978742:978758	987827:987843
978742:978758	attL	TCCCTTCGCCCGCTCCA	NA	NA	NA	NA
WP_000935135.1|978892_980500_+|integrase	site-specific integrase	integrase	A0A059XK29	uncultured_phage	28.0	4.3e-11
WP_000852869.1|980492_981152_+	DUF4145 domain-containing protein	NA	M1PSB6	Streptococcus_phage	33.9	3.6e-33
WP_000082600.1|982060_982789_+	Rha family transcriptional regulator	NA	B5AX29	Iodobacteriophage	41.2	7.1e-14
WP_001339397.1|983183_983861_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|983860_984208_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381395.1|984227_985799_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
987827:987843	attR	TCCCTTCGCCCGCTCCA	NA	NA	NA	NA
>prophage 2
NZ_CP012693	Escherichia coli strain FORC_028 chromosome, complete genome	5704396	1137793	1144933	5704396		Escherichia_phage(83.33%)	6	NA	NA
WP_001278994.1|1137793_1138432_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590392.1|1138428_1139691_-	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_000847985.1|1139687_1140596_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001297141.1|1140791_1141559_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_001141347.1|1141609_1142266_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	47.2	5.6e-50
WP_001272924.1|1142371_1144933_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
>prophage 3
NZ_CP012693	Escherichia coli strain FORC_028 chromosome, complete genome	5704396	1217714	1317368	5704396	holin,integrase,capsid,tRNA,terminase,head,tail	Stx2-converting_phage(36.92%)	99	1223104:1223128	1278905:1278929
WP_000577251.1|1217714_1219433_+	ATP-binding protein	NA	A0A1B5FPD5	Escherichia_phage	100.0	6.5e-308
WP_000214985.1|1219434_1221183_+	hypothetical protein	NA	A0A1B5FPH1	Escherichia_phage	100.0	0.0e+00
WP_000448925.1|1221254_1221671_-	hypothetical protein	NA	A0A1B5FPM5	Escherichia_phage	100.0	1.1e-72
WP_001341819.1|1221709_1222939_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	100.0	1.5e-234
1223104:1223128	attL	GTGGAGCTGGCGGGAGTTGAACCCG	NA	NA	NA	NA
WP_001431537.1|1223237_1224146_-	DUF4760 domain-containing protein	NA	A0A1B5FPC5	Escherichia_phage	100.0	2.3e-171
WP_000516611.1|1224628_1225804_-|integrase	site-specific integrase	integrase	I6PDJ1	Cronobacter_phage	91.2	4.6e-204
WP_000557643.1|1225976_1226123_-	hypothetical protein	NA	A0A0P0ZDP5	Stx2-converting_phage	90.9	1.7e-20
WP_000457722.1|1226126_1226369_-	DUF4222 domain-containing protein	NA	Q6H9Z8	Enterobacteria_phage	82.5	1.8e-30
WP_000206753.1|1226453_1227317_-	DUF551 domain-containing protein	NA	A0A088CE95	Shigella_phage	53.6	3.2e-69
WP_000034210.1|1227318_1227648_-	ead/Ea22-like family protein	NA	A0A0H4ISY5	Shigella_phage	37.5	1.1e-25
WP_000476199.1|1227644_1227884_-	hypothetical protein	NA	S5MQM0	Escherichia_phage	96.2	3.7e-36
WP_000158004.1|1227876_1228080_-	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	95.5	5.2e-31
WP_000335005.1|1228076_1228955_-	phosphoadenosine phosphosulfate reductase family protein	NA	A0A2R2Z314	Escherichia_phage	94.9	1.9e-170
WP_000008174.1|1228945_1229482_-	5'-deoxynucleotidase	NA	A5LH62	Enterobacteria_phage	99.4	2.8e-100
WP_000081319.1|1229610_1230435_-	YfdQ family protein	NA	Q8SBF9	Shigella_phage	98.9	5.0e-149
WP_000135680.1|1230500_1230863_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000559922.1|1231333_1231849_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001020633.1|1232168_1232861_-	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	99.6	3.9e-126
WP_001191674.1|1232958_1233219_+	helix-turn-helix transcriptional regulator	NA	S5FKP1	Shigella_phage	100.0	7.1e-41
WP_000515845.1|1233211_1233763_+	protein YmfL	NA	S5FXP0	Shigella_phage	99.5	3.4e-101
WP_001250269.1|1233938_1234118_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000104954.1|1234107_1235049_+	helix-turn-helix domain-containing protein	NA	S5FM81	Shigella_phage	99.7	4.3e-144
WP_001305611.1|1235045_1235540_+	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	99.4	1.5e-87
WP_000066917.1|1235539_1236193_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.5	1.9e-127
WP_000210187.1|1236189_1236516_+	LexA family transcriptional regulator	NA	A5LH73	Enterobacteria_phage	100.0	1.6e-53
WP_000767117.1|1236512_1236902_+	RusA family crossover junction endodeoxyribonuclease	NA	K7PH72	Enterobacteria_phage	100.0	7.1e-69
WP_024220650.1|1236921_1237731_+	KilA-N domain-containing protein	NA	Q8SBE6	Shigella_phage	97.8	4.5e-150
WP_001379493.1|1237738_1238728_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.7	7.3e-195
WP_001205460.1|1238745_1239087_+	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	90.3	4.2e-57
WP_001131907.1|1239099_1239648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032212763.1|1241681_1243619_+	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	96.7	0.0e+00
WP_000143462.1|1243754_1243934_+	DUF1378 family protein	NA	A0A0P0ZCJ7	Stx2-converting_phage	100.0	3.7e-25
WP_001290231.1|1243974_1244247_+	DUF826 domain-containing protein	NA	A0A0P0ZBB8	Stx2-converting_phage	100.0	2.2e-21
WP_000284519.1|1244323_1244539_+|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	98.6	7.7e-33
WP_000731236.1|1244543_1244888_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	100.0	1.0e-58
WP_000992122.1|1244938_1245472_+	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	98.3	2.8e-100
WP_000459342.1|1245631_1245769_+	hypothetical protein	NA	Q687G2	Enterobacteria_phage	95.6	3.7e-17
WP_047091958.1|1245990_1246176_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	98.3	1.3e-17
WP_000736096.1|1246261_1246486_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000095736.1|1246854_1247082_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_001365481.1|1247123_1247489_+	HNH endonuclease	NA	A0A0P0ZCH0	Stx2-converting_phage	98.3	5.8e-65
WP_000958416.1|1247781_1248345_+|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_062878316.1|1248341_1250003_+|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	98.9	0.0e+00
WP_000173037.1|1250066_1252004_+|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	99.4	0.0e+00
WP_001063023.1|1252048_1252270_+	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	98.6	3.8e-35
WP_000125996.1|1254796_1255123_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	99.1	1.6e-53
WP_001007889.1|1255133_1255484_+|head	phage head closure protein	head	A0A0P0ZDP7	Stx2-converting_phage	100.0	2.7e-59
WP_000573391.1|1255480_1255927_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133393.1|1255923_1256268_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	9.4e-57
WP_001275441.1|1256334_1257051_+	immunoglobulin domain-containing protein	NA	A0A0P0ZDV1	Stx2-converting_phage	99.6	3.6e-127
WP_000710952.1|1257065_1257440_+|tail	phage tail assembly chaperone	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_122993730.1|1257535_1257745_+	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	92.8	2.6e-30
WP_069358368.1|1257795_1261038_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	93.0	0.0e+00
WP_000807964.1|1261030_1261372_+|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
WP_001368648.1|1261371_1262070_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	6.8e-131
WP_000194787.1|1262080_1262824_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.2	2.1e-146
WP_122996338.1|1262769_1263402_+|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	97.1	4.9e-104
WP_069358369.1|1263640_1267114_+	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	97.3	0.0e+00
WP_001427270.1|1267181_1267781_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	98.5	1.7e-109
WP_000268987.1|1267845_1269159_+|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.6	4.8e-77
WP_001023420.1|1269160_1269430_+|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	100.0	3.8e-45
WP_115801847.1|1269536_1269626_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301673.1|1269645_1271994_+	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_001370486.1|1272585_1275987_+	type III secretion system effector EspN	NA	A0A0N7KZG3	Stx2-converting_phage	39.3	1.3e-219
WP_000938111.1|1276363_1277725_-	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	29.6	4.3e-52
WP_000162574.1|1279479_1279962_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
1278905:1278929	attR	GTGGAGCTGGCGGGAGTTGAACCCG	NA	NA	NA	NA
WP_000600190.1|1280093_1280570_+	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_001117838.1|1280559_1280850_+	RnfH family protein	NA	NA	NA	NA	NA
WP_001203437.1|1280911_1281253_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_000880910.1|1281401_1283063_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001059169.1|1283148_1284027_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_001296310.1|1284149_1284743_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_010723175.1|1284797_1286084_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001338897.1|1286104_1286896_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_000460032.1|1287062_1288424_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_000256450.1|1288672_1288921_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000043335.1|1288939_1289488_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000264777.1|1289518_1290286_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000065253.1|1290327_1290675_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000589828.1|1290751_1291234_-	OmpA family protein	NA	NA	NA	NA	NA
WP_000969036.1|1291249_1292476_-	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_001212391.1|1292465_1292984_-	YfiR family protein	NA	NA	NA	NA	NA
WP_000976004.1|1293133_1293499_-	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001168054.1|1293708_1294779_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	5.3e-90
WP_000225221.1|1294789_1295911_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_000200116.1|1295953_1297114_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_001386991.1|1297212_1297260_-	pheA operon leader peptide PheL	NA	NA	NA	NA	NA
WP_000178456.1|1297363_1297705_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_000197686.1|1297975_1298713_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000079094.1|1298847_1299828_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000040115.1|1299824_1300556_+	polyphenol oxidase	NA	NA	NA	NA	NA
WP_001235102.1|1300685_1303259_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
WP_000841103.1|1309112_1310411_+	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
WP_001300818.1|1310407_1310731_-	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000949265.1|1310776_1312132_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_000083007.1|1312245_1314906_-	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_001341635.1|1314937_1315636_-|tRNA	tRNA-uridine aminocarboxypropyltransferase	tRNA	NA	NA	NA	NA
WP_001098726.1|1315704_1316124_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_000997403.1|1316330_1317368_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
>prophage 4
NZ_CP012693	Escherichia coli strain FORC_028 chromosome, complete genome	5704396	1566286	1611704	5704396	lysis,holin,transposase,integrase,terminase,head,portal	Enterobacteria_phage(43.48%)	50	1577494:1577509	1610621:1610636
WP_000381395.1|1566286_1567858_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|1567877_1568225_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|1568224_1568902_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000100143.1|1569374_1570391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000839828.1|1571034_1573395_+	type I restriction enzyme HsdR N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_000160236.1|1574707_1574863_-	hypothetical protein	NA	NA	NA	NA	NA
1577494:1577509	attL	ATGGTGTCCCCTGCAG	NA	NA	NA	NA
WP_001163428.1|1577582_1577783_-	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
WP_000545713.1|1577840_1578008_-	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	96.4	1.2e-25
WP_001368678.1|1578043_1578343_-	hypothetical protein	NA	Q9G076	Enterobacteria_phage	100.0	2.4e-53
WP_000376716.1|1578500_1578779_-	DUF4752 family protein	NA	K7P6P7	Enterobacteria_phage	98.9	5.4e-47
WP_000156090.1|1578778_1579366_-	DUF551 domain-containing protein	NA	Q9G077	Enterobacteria_phage	100.0	7.5e-115
WP_001375782.1|1579362_1579980_-	hypothetical protein	NA	Q9G078	Enterobacteria_phage	100.0	3.7e-112
WP_000060377.1|1579983_1580172_-	hypothetical protein	NA	Q9G079	Enterobacteria_phage	100.0	1.7e-28
WP_000052365.1|1580173_1580842_-	ead/Ea22-like family protein	NA	A0A088CC42	Shigella_phage	79.7	9.3e-69
WP_000812180.1|1580838_1581426_-	hypothetical protein	NA	K7PGR4	Enterobacteria_phage	97.5	5.0e-58
WP_001111303.1|1581597_1581891_-	DUF2856 family protein	NA	K7P7E6	Enterobacteria_phage	100.0	5.0e-51
WP_001429854.1|1581914_1582091_-	hypothetical protein	NA	K7P6P8	Enterobacteria_phage	98.3	3.7e-25
WP_085948186.1|1582218_1583374_+|transposase	IS3-like element IS600 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_001448457.1|1583415_1583565_-	hypothetical protein	NA	A0A2I6PID1	Escherichia_phage	100.0	1.2e-21
WP_085948186.1|1583728_1584884_+|transposase	IS3-like element IS600 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_044164962.1|1584877_1585090_+	protein ninF	NA	A0A2D1GLV4	Escherichia_phage	100.0	7.6e-25
WP_001107956.1|1585082_1585688_+	recombination protein NinG	NA	A0A1I9LJQ2	Stx_converting_phage	98.0	5.6e-97
WP_000144614.1|1585684_1585891_+	phage NinH family protein	NA	Q716C0	Shigella_phage	100.0	7.3e-33
WP_001271146.1|1585868_1586534_+	serine/threonine protein phosphatase	NA	K7P721	Enterobacteria_phage	97.7	1.6e-129
WP_001235461.1|1586530_1587154_+	antitermination protein	NA	K7PM87	Enterobacteria_phage	100.0	3.0e-114
WP_000783734.1|1588226_1588550_+|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
WP_000229392.1|1588533_1589010_+	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	100.0	1.7e-88
WP_000092296.1|1589006_1589444_+|lysis	lysis protein	lysis	K7P710	Enterobacteria_phage	97.2	1.1e-70
WP_001016387.1|1589649_1590168_+	Rha family transcriptional regulator	NA	A0A2D1GLJ3	Escherichia_phage	99.4	1.2e-92
WP_000999682.1|1590451_1590823_+	hypothetical protein	NA	A0A0F6TJP2	Escherichia_coli_O157_typing_phage	88.6	3.2e-55
WP_000807788.1|1590926_1591169_+	DUF2560 family protein	NA	A5VW77	Enterobacteria_phage	100.0	1.3e-36
WP_000179910.1|1591248_1591674_+	hypothetical protein	NA	Q716H4	Shigella_phage	87.9	1.8e-65
WP_000200776.1|1591670_1593083_+|terminase	PBSX family phage terminase large subunit	terminase	Q716H3	Shigella_phage	99.6	2.2e-277
WP_000852339.1|1593085_1595212_+|portal	portal protein	portal	Q9AYZ9	Salmonella_phage	99.3	0.0e+00
WP_000426731.1|1595225_1596110_+	hypothetical protein	NA	Q716H1	Shigella_phage	98.6	3.4e-143
WP_001133481.1|1596121_1597393_+|head	head protein	head	Q716H0	Shigella_phage	99.8	6.6e-241
WP_000375639.1|1597435_1597621_+	hypothetical protein	NA	Q716G9	Shigella_phage	98.4	4.6e-26
WP_000246750.1|1597595_1598078_+	packaged DNA stabilization protein p27	NA	Q716G8	Shigella_phage	100.0	3.8e-88
WP_001122374.1|1598086_1599505_+	packaged DNA stabilization protein gp10	NA	Q716G7	Shigella_phage	99.2	2.3e-274
WP_000785546.1|1599504_1600353_+	Packaged DNA stabilization protein gp26	NA	Q716G6	Shigella_phage	97.9	1.5e-100
WP_000614047.1|1600352_1600808_+	DUF2824 family protein	NA	Q716G5	Shigella_phage	98.0	3.3e-86
WP_000964882.1|1600810_1601503_+	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	100.0	9.2e-112
WP_000246938.1|1601512_1602919_+	phage DNA ejection protein	NA	I6RSG0	Salmonella_phage	55.8	1.1e-127
WP_000868968.1|1602918_1604763_+	hypothetical protein	NA	A0A192Y934	Salmonella_phage	72.1	4.0e-239
WP_000749290.1|1604777_1605263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000287055.1|1605333_1605600_-	Arc family DNA-binding protein	NA	A0A088CPT2	Enterobacteria_phage	90.5	9.5e-33
WP_001280420.1|1605721_1607845_+	right-handed parallel beta-helix repeat-containing protein	NA	A0A2D1GLP5	Escherichia_phage	36.7	2.5e-59
WP_000440209.1|1607915_1609058_+	acyltransferase	NA	A0A2H4JA46	uncultured_Caudovirales_phage	28.9	9.2e-24
WP_000958687.1|1609302_1610460_-|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	99.2	1.1e-221
WP_000368131.1|1610771_1611704_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
1610621:1610636	attR	ATGGTGTCCCCTGCAG	NA	NA	NA	NA
>prophage 5
NZ_CP012693	Escherichia coli strain FORC_028 chromosome, complete genome	5704396	1712691	1809534	5704396	lysis,holin,transposase,integrase,capsid,terminase,head,tail,portal,protease	Enterobacteria_phage(37.5%)	99	1721682:1721700	1797166:1797184
WP_000140570.1|1712691_1713594_-|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	54.8	2.5e-69
WP_001000358.1|1713787_1714978_-	anaerobic glycerol-3-phosphate dehydrogenase subunit C	NA	NA	NA	NA	NA
WP_001209922.1|1714974_1716234_-	glycerol-3-phosphate dehydrogenase subunit GlpB	NA	NA	NA	NA	NA
WP_000857257.1|1716223_1717852_-	anaerobic glycerol-3-phosphate dehydrogenase subunit A	NA	NA	NA	NA	NA
WP_000948732.1|1718124_1719483_+	glycerol-3-phosphate transporter	NA	NA	NA	NA	NA
WP_000779084.1|1719487_1720564_+	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	46.0	5.1e-08
WP_000301050.1|1721026_1721677_+	lipopolysaccharide kinase InaA	NA	NA	NA	NA	NA
1721682:1721700	attL	TGTAGGCCAGATAAGACGC	NA	NA	NA	NA
WP_000135040.1|1721730_1721985_-	ferredoxin-like diferric-tyrosyl radical cofactor maintenance protein YfaE	NA	G9IAA2	Pseudomonas_phage	73.1	2.6e-24
WP_000332036.1|1721984_1723115_-	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	78.9	2.5e-175
WP_001075177.1|1723203_1725489_-	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2D1GNB1	Pseudoalteromonas_phage	63.6	1.1e-283
WP_001341569.1|1726184_1729919_+	AIDA-I family autotransporter adhesin YfaL/EhaC	NA	A0A2L1IV18	Escherichia_phage	26.5	2.0e-19
WP_000990754.1|1730046_1730769_-	bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase	NA	NA	NA	NA	NA
WP_001281242.1|1730915_1733543_+	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	30.4	8.1e-92
WP_000012302.1|1733691_1735380_+	DUF2138 domain-containing protein	NA	NA	NA	NA	NA
WP_001215756.1|1735376_1735982_+	DUF1175 domain-containing protein	NA	NA	NA	NA	NA
WP_000533670.1|1735996_1737067_-|integrase	tyrosine-type recombinase/integrase	integrase	K7PHK0	Enterobacteria_phage	98.0	1.1e-196
WP_001444001.1|1737044_1737263_-	excisionase	NA	K7PKU2	Enterobacteria_phage	98.6	2.4e-34
WP_001281192.1|1737368_1737713_-	hypothetical protein	NA	K7PJY7	Enterobacterial_phage	100.0	5.3e-60
WP_000457736.1|1737831_1738074_-	DUF4222 domain-containing protein	NA	H6WZF9	Escherichia_phage	96.2	3.7e-36
WP_001345188.1|1738148_1738499_-	DUF551 domain-containing protein	NA	A0A077SK54	Escherichia_phage	80.2	3.3e-33
WP_001289868.1|1738495_1739101_-	ead/Ea22-like family protein	NA	A0A0K2FJF6	Enterobacteria_phage	96.9	1.7e-45
WP_000763358.1|1739097_1739319_-	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	95.9	1.6e-33
WP_000188870.1|1739417_1739633_-	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	100.0	1.0e-32
WP_000548547.1|1739709_1739901_-	DUF1382 family protein	NA	A0A1I9LJM8	Stx_converting_phage	100.0	1.9e-27
WP_001303590.1|1739873_1740056_-	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	100.0	7.4e-29
WP_085948186.1|1740508_1741665_-|transposase	IS3-like element IS600 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_000100831.1|1741996_1742782_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	99.6	5.3e-148
WP_000995439.1|1742787_1743084_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000372926.1|1743138_1743303_-	host cell division inhibitory peptide Kil	NA	A0A0P0ZC96	Stx2-converting_phage	98.1	3.2e-23
WP_001198860.1|1743271_1743436_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A0A0N6WES3	Escherichia_phage	100.0	1.4e-26
WP_000065385.1|1743508_1743877_-	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	97.5	3.8e-64
WP_000167595.1|1744026_1744497_-	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	100.0	3.7e-88
WP_000930321.1|1744630_1744969_-	hypothetical protein	NA	K7PJW2	Enterobacteria_phage	99.1	5.8e-59
WP_000256573.1|1744971_1745277_-	hypothetical protein	NA	K7PJM7	Enterobacteria_phage	99.0	7.0e-48
WP_001095982.1|1745591_1746242_-	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	100.0	4.9e-123
WP_000276885.1|1746322_1746508_+	Cro/Cl family transcriptional regulator	NA	K7PHK4	Enterobacteria_phage	100.0	1.2e-26
WP_000035947.1|1746617_1746914_+	hypothetical protein	NA	A0A0N7C1W0	Escherichia_phage	96.9	1.3e-46
WP_000185462.1|1746946_1747885_+	replication protein	NA	C1JJ53	Enterobacteria_phage	99.4	1.1e-171
WP_000788878.1|1747881_1748583_+	Replication protein 14	NA	K7P6G2	Enterobacteria_phage	99.6	1.7e-129
WP_000145926.1|1748579_1748870_+	protein ren	NA	O48423	Enterobacteria_phage	100.0	9.6e-47
WP_000229807.1|1748942_1749149_+	hypothetical protein	NA	G8C7M4	Escherichia_phage	97.1	1.8e-26
WP_000810176.1|1749156_1749603_+	recombination protein NinB	NA	A0A0N7C2V1	Escherichia_phage	92.6	3.4e-75
WP_000153270.1|1749599_1750127_+	phage N-6-adenine-methyltransferase	NA	K7PJZ4	Enterobacterial_phage	100.0	9.5e-101
WP_001254228.1|1750123_1750306_+	NinE family protein	NA	A0A1U9AJF6	Stx1_converting_phage	100.0	1.1e-29
WP_000612805.1|1750809_1752582_-	hypothetical protein	NA	A0A1U9AJG3	Stx1_converting_phage	99.8	0.0e+00
WP_001108084.1|1753138_1753705_+	HNH endonuclease	NA	A0A1U9AJK5	Stx1_converting_phage	99.5	6.6e-108
WP_001223927.1|1753679_1754282_+	recombination protein NinG	NA	A0A1U9AJF8	Stx1_converting_phage	94.6	1.6e-91
WP_001028854.1|1754278_1754944_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001235460.1|1754940_1755564_+	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.6	9.8e-113
WP_001302581.1|1755816_1756560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499454.1|1756645_1756804_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_012578864.1|1756884_1757283_-	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000284524.1|1757425_1757641_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000075153.1|1757640_1758138_+	lysozyme RrrD	NA	A0A1B5FP97	Escherichia_phage	96.4	1.6e-89
WP_001228695.1|1758354_1758537_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_000738423.1|1758627_1758921_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_001427981.1|1759280_1759475_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	95.3	7.4e-27
WP_000235436.1|1759869_1760379_+|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_024017589.1|1760350_1762279_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.4	2.7e-262
WP_000258991.1|1762262_1762469_+	gpW family protein	NA	K7PM10	Enterobacteria_phage	60.0	4.2e-12
WP_001430223.1|1762465_1764058_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.3	1.1e-184
WP_001254039.1|1764047_1765553_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.0	1.6e-100
WP_000256849.1|1765589_1765937_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	1.5e-22
WP_000522643.1|1765994_1766879_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	54.1	6.5e-94
WP_000201528.1|1766930_1767305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204544.1|1767297_1767651_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	69.2	2.5e-41
WP_000975037.1|1767665_1768241_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	58.7	7.5e-51
WP_000683071.1|1768237_1768633_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	87.0	4.2e-61
WP_001143013.1|1768640_1769393_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	93.6	1.7e-127
WP_000479086.1|1769406_1769838_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	4.8e-42
WP_000533403.1|1769864_1770278_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000082375.1|1770258_1772820_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	95.0	0.0e+00
WP_000847413.1|1772816_1773146_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	91.7	1.3e-52
WP_001152619.1|1773145_1773844_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.1	7.3e-133
WP_000194778.1|1773849_1774593_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	6.6e-148
WP_000090884.1|1774529_1775162_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.0	8.5e-96
WP_032325348.1|1775222_1778522_+	host specificity protein J	NA	A5LH43	Enterobacteria_phage	94.9	0.0e+00
WP_000839179.1|1778550_1778955_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
WP_000612626.1|1778951_1779299_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000099160.1|1779347_1780886_+|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.8	3.9e-296
WP_001230644.1|1780948_1781164_+	hypothetical protein	NA	Q9LA64	Enterobacterial_phage	95.8	2.9e-32
WP_001228241.1|1781231_1781831_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	91.0	2.4e-100
WP_069358370.1|1781895_1783209_+|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.6	3.7e-77
WP_001023397.1|1783210_1783480_+|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	98.9	3.2e-44
WP_001448330.1|1783689_1784337_+	T3SS effector NleG family protein	NA	B6DZC0	Enterobacteria_phage	43.3	2.4e-37
WP_001025664.1|1785030_1786353_-	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	85.7	2.5e-227
WP_000536535.1|1787034_1791549_+	alpha-2-macroglobulin family protein	NA	NA	NA	NA	NA
WP_001104541.1|1791549_1793199_+	YfaQ family protein	NA	NA	NA	NA	NA
WP_001225855.1|1793203_1793980_+	YfaP family protein	NA	NA	NA	NA	NA
WP_000876014.1|1794254_1797104_+	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	27.2	1.4e-41
WP_001061917.1|1797189_1797840_-	transcriptional regulator RcsB	NA	NA	NA	NA	NA
1797166:1797184	attR	GCGTCTTATCTGGCCTACA	NA	NA	NA	NA
WP_001249127.1|1797856_1800529_-	phosphotransferase RcsD	NA	NA	NA	NA	NA
WP_000865576.1|1801267_1802359_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	60.1	9.4e-119
WP_000406116.1|1802470_1803526_+	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_000786386.1|1803599_1804664_+	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	50.5	1.8e-18
WP_000884922.1|1804663_1805314_+	DNA oxidative demethylase AlkB	NA	A0A2K9L3R7	Tupanvirus	31.7	1.4e-05
WP_000422231.1|1805389_1807033_+	microcin J25 efflux ABC transporter YojI	NA	W8CYL7	Bacillus_phage	24.0	9.5e-14
WP_000758074.1|1807250_1808897_+	malate dehydrogenase (quinone)	NA	NA	NA	NA	NA
WP_000849214.1|1809045_1809534_-|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
>prophage 6
NZ_CP012693	Escherichia coli strain FORC_028 chromosome, complete genome	5704396	1905230	1915158	5704396	transposase	Enterobacteria_phage(62.5%)	9	NA	NA
WP_001240401.1|1905230_1905962_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001295431.1|1906183_1907869_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|1907865_1908585_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950404.1|1908631_1909102_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	99.4	2.0e-81
WP_000998019.1|1909533_1910919_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	89.3	3.4e-259
WP_000612591.1|1910968_1911316_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171523.1|1911312_1911693_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_001342301.1|1912024_1914025_-	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	96.0	0.0e+00
WP_001292774.1|1914021_1915158_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.1e-162
>prophage 7
NZ_CP012693	Escherichia coli strain FORC_028 chromosome, complete genome	5704396	2006600	2012902	5704396		Enterobacteria_phage(50.0%)	6	NA	NA
WP_001116073.1|2006600_2007995_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	32.3	2.2e-19
WP_000183038.1|2008169_2009063_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	3.9e-46
WP_000699427.1|2009434_2010520_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.5	1.4e-101
WP_001023633.1|2010519_2011419_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.8	5.7e-29
WP_000857547.1|2011476_2012355_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.1	2.5e-106
WP_001100797.1|2012359_2012902_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	57.3	1.9e-51
>prophage 8
NZ_CP012693	Escherichia coli strain FORC_028 chromosome, complete genome	5704396	2046538	2051856	5704396	transposase	Stx2-converting_phage(50.0%)	9	NA	NA
WP_000692323.1|2046538_2046760_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
WP_001186725.1|2046828_2047305_-	RadC family protein	NA	NA	NA	NA	NA
WP_000849582.1|2047320_2047806_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.5	2.6e-12
WP_001234620.1|2047860_2048679_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.2	2.0e-44
WP_001119729.1|2048778_2049012_-	DUF905 family protein	NA	NA	NA	NA	NA
WP_072097794.1|2049090_2049432_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000839179.1|2049520_2049925_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
WP_000612626.1|2049921_2050269_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000099148.1|2050317_2051856_+|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.6	3.3e-295
>prophage 9
NZ_CP012693	Escherichia coli strain FORC_028 chromosome, complete genome	5704396	2171579	2207741	5704396	holin,integrase,capsid,terminase,tail,head,plate,portal	Enterobacteria_phage(87.18%)	46	2170517:2170576	2207848:2207968
2170517:2170576	attL	TTTAAAATCCCTCGGCGTTCGCGCTGTGCGGGTTCAAGTCCCGCTCCGGGTACCATGGGA	NA	NA	NA	NA
WP_000078921.1|2171579_2171720_-	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	5.9e-18
WP_000488107.1|2171910_2172171_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_001317900.1|2172457_2173597_-	SEC-C domain-containing protein	NA	NA	NA	NA	NA
WP_000132847.1|2173996_2175097_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	98.6	2.1e-203
WP_000005439.1|2175254_2176439_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	98.5	3.4e-223
WP_000290450.1|2176438_2176951_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	100.0	3.2e-93
WP_000665308.1|2177005_2177371_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	97.5	3.8e-56
WP_000333495.1|2177379_2177535_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	100.0	8.8e-23
WP_000853455.1|2177521_2180329_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	96.7	0.0e+00
WP_000979950.1|2180341_2180830_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	98.1	7.5e-84
WP_000954196.1|2180986_2181559_+	serine acetyltransferase	NA	NA	NA	NA	NA
WP_000144010.1|2181602_2182181_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	88.5	2.2e-95
WP_000108513.1|2182180_2184313_-|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	66.2	8.0e-130
WP_000071738.1|2184315_2184846_-|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	98.8	4.3e-93
WP_001111967.1|2184838_2185735_-|plate	baseplate J/gp47 family protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.7	1.9e-154
WP_001067548.1|2185738_2186068_-	GPW/gp25 family protein	NA	A0A0A7NQ90	Enterobacteria_phage	100.0	2.2e-55
WP_001342219.1|2186085_2186652_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	97.3	2.5e-99
WP_000356339.1|2186663_2187299_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	100.0	1.1e-114
WP_001342220.1|2187291_2187759_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	94.8	6.7e-82
WP_000202151.1|2187782_2189660_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	82.2	1.1e-305
WP_000780555.1|2189798_2190206_-	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	95.6	4.2e-64
WP_000072343.1|2190202_2190595_-	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	98.5	2.9e-70
WP_001342221.1|2190591_2190915_-|holin	phage holin family protein	holin	A0A0A7NRY9	Enterobacteria_phage	93.5	1.7e-47
WP_000864911.1|2190917_2191118_-|tail	tail protein X	tail	A0A0A7NV57	Enterobacteria_phage	98.5	7.9e-32
WP_000063100.1|2191117_2191612_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	97.0	1.9e-87
WP_000632311.1|2191713_2192514_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	89.1	1.5e-126
WP_001055094.1|2192559_2193612_-|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	94.3	3.2e-188
WP_001262641.1|2193635_2194472_-|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	98.9	7.9e-150
WP_000613774.1|2194626_2196378_+	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	98.1	0.0e+00
WP_000087812.1|2196377_2197424_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	100.0	1.5e-206
WP_001289969.1|2197913_2198504_-	ead/Ea22-like family protein	NA	Q8HAA6	Salmonella_phage	50.7	1.8e-31
WP_000211289.1|2198567_2198879_-	plasmid partitioning/stability family protein	NA	A0A0A7NPT5	Enterobacteria_phage	95.1	1.2e-47
WP_000686499.1|2198883_2199843_-	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	99.7	2.0e-181
WP_001272084.1|2199919_2202760_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	88.5	0.0e+00
WP_000564224.1|2202756_2203146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000985152.1|2203469_2203673_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	80.6	9.5e-25
WP_000021647.1|2203759_2203873_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	91.9	2.4e-09
WP_000357025.1|2203869_2204112_-	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	97.5	3.4e-37
WP_000158976.1|2204123_2204402_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	77.2	6.9e-34
WP_000742491.1|2204412_2204763_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	81.0	1.2e-48
WP_000014504.1|2204784_2204988_-	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_001673482.1|2205059_2205197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000786769.1|2205286_2205691_+	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	1.6e-23
WP_000290352.1|2205706_2206357_+	membrane protein	NA	NA	NA	NA	NA
WP_000865208.1|2206386_2206734_+	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_001342226.1|2206739_2207741_+|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	58.2	9.3e-105
2207848:2207968	attR	TTTAAAATCCCTCGGCGTTCGCGCTGTGCGGGTTCAAGTCCCGCTCCGGGTACCATGGGAAAGATAAGAATAAAATCAAAGCAATAAGCAGTGTCGTGAAACCACCTTCGGGTGGTTTTTT	NA	NA	NA	NA
>prophage 10
NZ_CP012693	Escherichia coli strain FORC_028 chromosome, complete genome	5704396	2291776	2417130	5704396	lysis,holin,transposase,integrase,capsid,terminase,head,tail,portal,protease	Escherichia_phage(32.33%)	162	2311465:2311495	2386136:2386166
WP_000916763.1|2291776_2292007_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000204699.1|2292145_2292520_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000879280.1|2292523_2293396_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000976492.1|2293408_2293750_+	YebY family protein	NA	NA	NA	NA	NA
WP_001189091.1|2294142_2295219_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	51.7	5.3e-98
WP_001443927.1|2295184_2295466_-	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	41.2	1.7e-11
WP_001356607.1|2295572_2295761_-	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	97.9	1.6e-18
WP_042853000.1|2295753_2295948_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	7.6e-32
WP_000166317.1|2296004_2296814_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	6.8e-106
WP_000105101.1|2296806_2299458_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	77.6	0.0e+00
WP_001307773.1|2299556_2299832_-	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	96.7	3.0e-42
WP_000245534.1|2299905_2300082_-	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	89.7	4.1e-24
WP_000560218.1|2300075_2300297_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	1.8e-37
WP_001427316.1|2300717_2300870_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	2.3e-07
WP_001303511.1|2301156_2301435_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001302048.1|2301436_2301628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001169687.1|2301648_2302020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000172738.1|2302117_2302420_+	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	8.6e-06
WP_000693943.1|2302416_2302842_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_077886425.1|2302864_2303827_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	51.2	1.8e-68
WP_000450872.1|2304600_2305362_+	DUF1627 domain-containing protein	NA	A0A088CE47	Shigella_phage	67.2	3.9e-79
WP_000603384.1|2305394_2305676_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
WP_000699809.1|2305672_2305900_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_001289673.1|2305892_2306204_+	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	92.2	7.2e-56
WP_000683609.1|2306331_2306550_+	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
WP_000104474.1|2306551_2307109_+	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_000935259.1|2307342_2307555_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000756596.1|2307674_2308019_+	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000191872.1|2308140_2308413_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
WP_001265229.1|2308414_2309464_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
WP_001217413.1|2309476_2309851_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.6	5.4e-34
WP_000762928.1|2309847_2310669_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.2	4.1e-82
2311465:2311495	attL	CTGCATGGTGAATCCCCCTGTGCGGAGGGGC	NA	NA	NA	NA
WP_000143049.1|2311839_2313690_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	99.2	0.0e+00
WP_024164617.1|2314128_2314344_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	7.7e-33
WP_000075132.1|2314343_2314841_+	lysozyme RrrD	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_000092325.1|2314837_2315275_+|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	98.6	1.7e-71
WP_001448382.1|2315424_2315577_+	hypothetical protein	NA	A0A0N7CFG9	Salmonella_phage	98.0	2.4e-20
WP_085948186.1|2315617_2316774_-|transposase	IS3-like element IS600 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_074432125.1|2316847_2317309_+	Rha family transcriptional regulator	NA	A0A1R3Y613	Salmonella_virus	81.5	2.4e-63
WP_001307652.1|2317496_2317691_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.8	9.7e-27
WP_000453587.1|2318079_2318625_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_000198153.1|2320521_2320728_+	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001443752.1|2320724_2322326_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	3.6e-308
WP_000123251.1|2322306_2323626_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.9	7.6e-232
WP_001365129.1|2323635_2323968_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	5.5e-54
WP_000063258.1|2324023_2325049_+|capsid	major capsid protein	capsid	A0A2I6TCE5	Escherichia_phage	98.8	5.1e-191
WP_000158897.1|2325090_2325486_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	93.9	2.4e-56
WP_000752994.1|2325497_2325851_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	100.0	9.0e-63
WP_000975098.1|2325862_2326441_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	98.4	5.0e-79
WP_000683137.1|2326437_2326833_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	92.4	3.7e-65
WP_000235067.1|2326840_2327593_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.4	1.2e-133
WP_000479051.1|2327606_2328029_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.4e-70
WP_000533442.1|2328055_2328469_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_000081791.1|2328449_2331062_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	95.9	0.0e+00
WP_000847298.1|2331058_2331388_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001448322.1|2331387_2332086_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	4.0e-131
WP_069358375.1|2332096_2332840_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.8	2.9e-148
WP_096844540.1|2332785_2333418_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.8	3.5e-102
WP_069358376.1|2333663_2337140_+	host specificity protein J	NA	Q6H9T2	Enterobacteria_phage	96.1	0.0e+00
WP_001216290.1|2337208_2337832_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	60.4	1.1e-68
WP_069358377.1|2337896_2339219_+|tail	phage tail protein	tail	Q687E6	Enterobacteria_phage	99.8	3.4e-78
WP_001023445.1|2339220_2339490_+|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	97.8	2.1e-43
WP_012817749.1|2339614_2340367_-	type III effector	NA	NA	NA	NA	NA
WP_001058323.1|2341483_2342602_+	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_000107384.1|2342598_2344392_+	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_001186421.1|2344410_2345118_+	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000003671.1|2345114_2345702_+|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_000063972.1|2345698_2346097_+	hydrogenase-1 operon protein HyaE	NA	NA	NA	NA	NA
WP_000004899.1|2346093_2346951_+	hydrogenase expression/formation protein	NA	NA	NA	NA	NA
WP_000460810.1|2348641_2349778_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_000270305.1|2349790_2349883_+	cytochrome bd-II oxidase subunit CbdX	NA	NA	NA	NA	NA
WP_001300464.1|2349962_2351261_+	bifunctional acid phosphatase/4-phytase	NA	NA	NA	NA	NA
WP_000208650.1|2351375_2353556_-	tyrosine-protein kinase	NA	NA	NA	NA	NA
WP_000057871.1|2353575_2354022_-	protein-tyrosine-phosphatase Etp	NA	NA	NA	NA	NA
WP_001295357.1|2354009_2355149_-	polysaccharide export protein	NA	NA	NA	NA	NA
WP_000742348.1|2355194_2357291_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_001038062.1|2357290_2358037_-	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_001247610.1|2358033_2358678_-	lipoprotein GfcB	NA	NA	NA	NA	NA
WP_001295358.1|2358784_2359090_-	threonine-rich inner membrane protein GfcA	NA	NA	NA	NA	NA
WP_000087763.1|2359531_2359744_-	cold shock-like protein CspH	NA	NA	NA	NA	NA
WP_000066490.1|2360029_2360242_+	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
WP_071524879.1|2360252_2360441_+	cold-shock protein	NA	NA	NA	NA	NA
WP_001316982.1|2360415_2360646_+	protein YmcE	NA	NA	NA	NA	NA
WP_001019197.1|2360635_2360809_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000818472.1|2360856_2361930_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_001444338.1|2362001_2364746_-	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	31.9	1.0e-36
WP_044165337.1|2364840_2365914_-|integrase	tyrosine-type recombinase/integrase	integrase	K7PHK0	Enterobacteria_phage	98.0	1.0e-197
WP_001303849.1|2365891_2366110_-	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_001281774.1|2366216_2366561_-	hypothetical protein	NA	K7PJY7	Enterobacterial_phage	98.2	4.5e-59
WP_000545733.1|2366589_2366757_-	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	100.0	1.3e-27
WP_000002107.1|2366829_2367114_-	ASCH domain-containing protein	NA	A0A2D1GLL3	Escherichia_phage	100.0	1.8e-50
WP_012817743.1|2367106_2367409_-	restriction alleviation protein, Lar family	NA	Q716F5	Shigella_phage	97.0	9.4e-53
WP_000104414.1|2367405_2368023_-	hypothetical protein	NA	Q716F4	Shigella_phage	64.2	5.6e-36
WP_000034232.1|2368024_2368582_-	ead/Ea22-like family protein	NA	A5VWB3	Enterobacteria_phage	83.6	4.6e-45
WP_000812206.1|2368578_2369136_-	hypothetical protein	NA	E7C9P6	Salmonella_phage	64.3	3.2e-62
WP_001214436.1|2369132_2369297_-	DUF2737 family protein	NA	K7P7R0	Enterobacteria_phage	98.1	4.2e-23
WP_001111278.1|2369307_2369601_-	DUF2856 family protein	NA	G8C7L1	Escherichia_phage	99.0	2.5e-50
WP_000951334.1|2369624_2370008_-	hypothetical protein	NA	K7P6P8	Enterobacteria_phage	98.4	2.5e-66
WP_000031370.1|2370007_2370613_-	ERF family protein	NA	Q9MCQ9	Enterobacteria_phage	100.0	4.1e-108
WP_001243354.1|2370869_2371022_-	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	98.0	1.5e-19
WP_000638547.1|2371006_2371138_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A5VWA4	Enterobacteria_phage	100.0	1.4e-16
WP_001341800.1|2371162_2372023_-	hypothetical protein	NA	K7P7J7	Enterobacteria_phage	99.3	2.4e-37
WP_000167595.1|2372274_2372745_-	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	100.0	3.7e-88
WP_000198444.1|2372803_2373187_-	hypothetical protein	NA	G9L671	Escherichia_phage	100.0	3.9e-64
WP_000745483.1|2373675_2373840_-	hypothetical protein	NA	G9L672	Escherichia_phage	100.0	5.1e-21
WP_000957426.1|2373842_2374889_-	serine/threonine protein kinase	NA	G9L673	Escherichia_phage	100.0	5.2e-207
WP_001221211.1|2374882_2375344_-	hypothetical protein	NA	G9L674	Escherichia_phage	100.0	1.3e-77
WP_000885203.1|2375411_2375753_-	DUF3024 domain-containing protein	NA	A0A1I9LJN9	Stx_converting_phage	100.0	3.9e-63
WP_000250473.1|2375813_2376521_-	helix-turn-helix transcriptional regulator	NA	G9L676	Escherichia_phage	100.0	1.5e-133
WP_001180318.1|2376599_2376827_+	helix-turn-helix domain-containing protein	NA	G9L677	Escherichia_phage	100.0	7.8e-36
WP_000438541.1|2376965_2377262_+	hypothetical protein	NA	C1JJ56	Enterobacteria_phage	100.0	8.9e-48
WP_000185454.1|2377294_2378233_+	replication protein	NA	A0A1I9LJP3	Stx_converting_phage	100.0	1.3e-172
WP_000788928.1|2378229_2378931_+	Replication protein P	NA	C1JJ58	Enterobacteria_phage	100.0	3.4e-130
WP_000145907.1|2378927_2379218_+	protein ren	NA	A0A0N6WES4	Escherichia_phage	99.0	1.6e-46
WP_001000127.1|2379288_2379567_+	hypothetical protein	NA	Q9ZWY1	Enterobacteria_phage	100.0	3.4e-49
WP_000103679.1|2379699_2379915_+	hypothetical protein	NA	A0A1I9LJP7	Stx_converting_phage	100.0	1.3e-32
WP_001281772.1|2379925_2380162_+	restriction alleviation protein, Lar family	NA	Q8HA09	Enterobacteria_phage	100.0	1.2e-39
WP_000814576.1|2380118_2380565_+	recombination protein NinB	NA	A0A0N7C2V1	Escherichia_phage	100.0	2.4e-81
WP_000153280.1|2380561_2381089_+	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	100.0	9.5e-101
WP_001254256.1|2381085_2381268_+	NinE family protein	NA	A0A0N7C1X3	Escherichia_phage	100.0	5.7e-29
WP_000211425.1|2381542_2382277_+	phage antirepressor Ant	NA	A0A0N7C203	Escherichia_phage	99.6	9.4e-123
WP_001004024.1|2382351_2383074_+	phage antirepressor KilAC domain-containing protein	NA	A0A0N7C231	Escherichia_phage	100.0	7.8e-130
WP_001107963.1|2383073_2383679_+	recombination protein NinG	NA	A0A0P0ZCS9	Stx2-converting_phage	100.0	1.7e-98
WP_000144759.1|2383675_2383870_+	phage NinH family protein	NA	Q6H9W6	Enterobacteria_phage	100.0	8.4e-31
WP_001204852.1|2383862_2384297_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	100.0	3.6e-82
WP_000691354.1|2384803_2385751_+	Shiga toxin Stx1 subunit A	NA	Q777W4	Enterobacteria_phage	100.0	3.2e-171
WP_000752026.1|2385760_2386030_+	Shiga toxin Stx1a subunit B	NA	Q7AYI7	Enterobacteria_phage	100.0	1.6e-43
WP_069358378.1|2386529_2388467_+	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	99.8	0.0e+00
2386136:2386166	attR	CTGCATGGTGAATCCCCCTGTGCGGAGGGGC	NA	NA	NA	NA
WP_000143458.1|2388602_2388782_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290221.1|2388822_2389095_+	DUF826 domain-containing protein	NA	A0A0P0ZC09	Stx2-converting_phage	97.8	9.1e-23
WP_001072901.1|2389171_2389387_+|holin	class II holin family protein	holin	A0A2R2Z340	Escherichia_phage	100.0	1.2e-33
WP_000087733.1|2389391_2389925_+	lysozyme	NA	G9L6J6	Escherichia_phage	100.0	1.0e-102
WP_000661712.1|2390198_2390894_+	phage antirepressor protein	NA	Q5MBW0	Stx1-converting_phage	99.1	2.8e-124
WP_001280922.1|2390988_2391120_+	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	90.7	8.5e-11
WP_071529499.1|2391342_2391528_+	hypothetical protein	NA	A0A0P0ZCT3	Stx2-converting_phage	96.7	1.3e-17
WP_001109019.1|2391766_2392318_+	Rha family transcriptional regulator	NA	A0A0P0ZFJ1	Escherichia_phage	100.0	4.5e-101
WP_000828068.1|2392663_2392990_+	TonB family protein	NA	H6WZK5	Escherichia_phage	99.1	1.5e-56
WP_000095741.1|2393121_2393322_-	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	98.5	4.3e-30
WP_000829190.1|2393363_2393729_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	97.5	1.1e-63
WP_000958380.1|2394017_2394581_+|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	100.0	1.1e-89
WP_062890118.1|2394577_2396239_+|terminase	terminase large subunit	terminase	A0A0P0ZEI4	Stx2-converting_phage	99.1	0.0e+00
WP_069358379.1|2396302_2398240_+|capsid	phage major capsid protein	capsid	A0A0P0ZCT9	Stx2-converting_phage	99.1	0.0e+00
WP_001063025.1|2398284_2398506_+	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
WP_000125984.1|2401032_2401359_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001007905.1|2401369_2401720_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573391.1|2401716_2402163_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133388.1|2402159_2402504_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275476.1|2402569_2403286_+	immunoglobulin domain-containing protein	NA	A0A0P0ZD29	Stx2-converting_phage	98.7	5.6e-128
WP_001030040.1|2403291_2403666_+|tail	phage tail assembly chaperone	tail	A0A0N7KZA2	Stx2-converting_phage	99.2	3.9e-64
WP_001513217.1|2403761_2403971_+	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	100.0	1.5e-33
WP_050869705.1|2404018_2407261_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	94.3	0.0e+00
WP_000807964.1|2407253_2407595_+|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
WP_001368648.1|2407594_2408293_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	6.8e-131
WP_000194787.1|2408303_2409047_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.2	2.1e-146
WP_047085664.1|2408992_2409625_+|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	96.7	2.5e-103
WP_044165468.1|2409863_2413340_+	host specificity protein J	NA	Q687E8	Enterobacteria_phage	96.8	0.0e+00
WP_001230429.1|2413406_2414006_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	99.0	2.3e-111
WP_000279017.1|2414070_2415384_+|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.9	7.4e-78
WP_001023995.1|2415385_2415655_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A0P0ZCV7	Stx2-converting_phage	95.5	7.1e-44
WP_000767050.1|2415876_2416419_+	hypothetical protein	NA	Q9LA55	Enterobacteria_phage	68.6	8.4e-52
WP_106420821.1|2416363_2416558_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A2R2Z347	Escherichia_phage	84.6	4.1e-09
WP_001131653.1|2416548_2417130_+	T3SS effector NleG family protein	NA	H6WZN1	Escherichia_phage	64.2	5.1e-63
>prophage 11
NZ_CP012693	Escherichia coli strain FORC_028 chromosome, complete genome	5704396	2757789	2899316	5704396	lysis,holin,transposase,integrase,capsid,terminase,head,tail,portal,protease	Escherichia_phage(32.39%)	183	2762169:2762187	2851703:2851721
WP_000113674.1|2757789_2758920_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	51.4	3.4e-103
WP_000113189.1|2758897_2759146_-	excisionase	NA	NA	NA	NA	NA
WP_000048478.1|2759210_2761682_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.2	1.1e-58
WP_000199480.1|2761777_2761966_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449172.1|2761962_2762151_-	cell division inhibitor	NA	NA	NA	NA	NA
2762169:2762187	attL	TGAATTTTGTGATGCGGTG	NA	NA	NA	NA
WP_000920491.1|2762711_2762945_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394552.1|2762922_2763330_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
WP_001171903.1|2763352_2763571_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240336.1|2763643_2763943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000787428.1|2764207_2764615_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_000912298.1|2764691_2764919_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705622.1|2764902_2765454_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000020556.1|2765425_2766466_+	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	7.9e-91
WP_157825328.1|2766377_2766920_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.7	1.5e-85
WP_001505071.1|2767683_2767848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001449026.1|2768546_2769305_+	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_000961821.1|2769583_2769796_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	72.9	1.3e-16
WP_001217394.1|2770016_2770274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010917803.1|2770343_2770622_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_001448332.1|2770623_2771679_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.6	7.5e-89
WP_000140002.1|2771679_2772045_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	1.6e-38
WP_001059384.1|2772041_2772731_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
WP_000023141.1|2774255_2776109_+	SASA family carbohydrate esterase	NA	H6WZJ9	Escherichia_phage	96.6	0.0e+00
WP_000284522.1|2776258_2776474_+|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	97.2	1.3e-32
WP_000731221.1|2776478_2776823_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	95.6	1.8e-55
WP_000992088.1|2776873_2777407_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	98.3	5.6e-101
WP_001056803.1|2777677_2778244_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	99.5	2.9e-103
WP_000539792.1|2778243_2778390_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001208682.1|2778617_2778824_+	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_000735655.1|2778888_2779113_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000347013.1|2779469_2779610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085948186.1|2779774_2780930_+|transposase	IS3-like element IS600 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_001428130.1|2781006_2781192_-	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	92.3	1.3e-20
WP_000829190.1|2781233_2781599_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	97.5	1.1e-63
WP_000958380.1|2781892_2782456_+|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	100.0	1.1e-89
WP_032323913.1|2782452_2784114_+|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.5	0.0e+00
WP_044165271.1|2784177_2786115_+|capsid	phage major capsid protein	capsid	A0A0P0ZCT9	Stx2-converting_phage	99.7	0.0e+00
WP_001063025.1|2786159_2786381_+	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
WP_000125984.1|2788907_2789234_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001007905.1|2789244_2789595_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573391.1|2789591_2790038_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133388.1|2790034_2790379_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_069358382.1|2790444_2791161_+|tail	phage tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	98.7	3.6e-127
WP_001030063.1|2791166_2791541_+|tail	phage tail assembly chaperone	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001513217.1|2791636_2791846_+	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	100.0	1.5e-33
WP_069358383.1|2791893_2794011_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	56.9	5.1e-270
WP_000807940.1|2794003_2794345_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	97.3	4.7e-61
WP_053904734.1|2794344_2795043_+|tail	phage minor tail protein L	tail	S5M7Q4	Escherichia_phage	97.0	5.8e-130
WP_069358375.1|2795053_2795797_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.8	2.9e-148
WP_096844540.1|2795742_2796375_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.8	3.5e-102
WP_069358384.1|2796620_2800094_+	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	98.1	0.0e+00
WP_001230428.1|2800160_2800760_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	99.5	1.4e-111
WP_032325383.1|2800824_2802138_+|tail	phage tail protein	tail	H6WZM9	Escherichia_phage	98.2	2.2e-77
WP_001339397.1|2802193_2802871_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|2802870_2803218_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381383.1|2803237_2804809_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.5	2.9e-169
WP_001023483.1|2804846_2805116_+|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	96.6	1.2e-43
WP_000938124.1|2805570_2806932_-	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	40.2	1.5e-49
WP_001299351.1|2807743_2808763_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.3e-85
WP_000273151.1|2808740_2808983_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_069358385.1|2809050_2811501_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.6	1.1e-58
WP_000199473.1|2811596_2811785_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449175.1|2811781_2811970_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_001331716.1|2812370_2812535_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171921.1|2812538_2812757_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012817750.1|2812828_2813128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000692026.1|2813463_2813766_+	type II toxin-antitoxin system HigB family toxin	NA	A0A0P0ZE17	Stx2-converting_phage	43.3	3.7e-17
WP_001022415.1|2813768_2814128_+	helix-turn-helix domain-containing protein	NA	A0A222YXG1	Escherichia_phage	93.3	3.6e-59
WP_000578360.1|2814174_2814567_-	helix-turn-helix domain-containing protein	NA	H6WRX4	Salmonella_phage	39.6	1.7e-14
WP_001172789.1|2814693_2814954_+	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	64.8	4.8e-21
WP_000693932.1|2814950_2815388_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	55.0	1.6e-29
WP_000729535.1|2815474_2816485_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	88.8	4.9e-170
WP_072096947.1|2816396_2816939_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	89.5	1.8e-78
WP_000450641.1|2816972_2817698_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	63.4	1.2e-77
WP_001040234.1|2817713_2818106_+	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	62.6	1.0e-38
WP_001266133.1|2818102_2818399_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	94.7	5.8e-47
WP_001209480.1|2818395_2818857_+	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	92.9	3.4e-38
WP_000403783.1|2818834_2819191_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	100.0	4.6e-59
WP_000935422.1|2819241_2819454_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	100.0	6.6e-37
WP_001224662.1|2819487_2819670_+	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	100.0	1.4e-27
WP_000753069.1|2819662_2819839_+	hypothetical protein	NA	A0A2R2X2A8	Escherichia_phage	100.0	4.6e-28
WP_001289353.1|2819835_2820471_+	ead/Ea22-like family protein	NA	A0A2R2Z315	Escherichia_phage	100.0	1.3e-115
WP_000209152.1|2820558_2820777_+	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	100.0	6.6e-32
WP_001229296.1|2820778_2821144_+	HNH endonuclease	NA	A0A2R2Z2X9	Escherichia_phage	100.0	5.1e-69
WP_000350274.1|2821251_2821485_+	hypothetical protein	NA	A0A2R2Z2X8	Escherichia_phage	100.0	2.8e-36
WP_000220601.1|2821689_2821989_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2R2Z2Y1	Escherichia_phage	100.0	1.8e-51
WP_001260977.1|2821994_2822252_-	type II toxin-antitoxin system ParD family antitoxin	NA	A0A0N7C055	Escherichia_phage	86.7	1.5e-30
WP_001342259.1|2822387_2822660_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	47.5	5.2e-10
WP_001265113.1|2822661_2823708_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.5	1.4e-108
WP_000904103.1|2823720_2824080_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.0	1.8e-34
WP_000640048.1|2824088_2824619_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
WP_000917770.1|2824860_2825058_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	8.9e-28
WP_000301785.1|2825192_2825906_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000466957.1|2826355_2826787_+	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	97.2	3.3e-67
WP_032212763.1|2827265_2829203_+	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	96.7	0.0e+00
WP_000143463.1|2829337_2829517_+	DUF1378 family protein	NA	Q5MBW3	Stx1-converting_phage	100.0	4.4e-26
WP_001290230.1|2829557_2829803_+	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_001072901.1|2829880_2830096_+|holin	class II holin family protein	holin	A0A2R2Z340	Escherichia_phage	100.0	1.2e-33
WP_000087714.1|2830100_2830634_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	99.4	3.0e-102
WP_001056883.1|2830908_2831478_+	hypothetical protein	NA	A0A2R2Z339	Escherichia_phage	99.5	1.5e-104
WP_000455402.1|2831477_2831627_+	hypothetical protein	NA	A0A0P0ZFU6	Escherichia_phage	98.0	9.1e-17
WP_001208680.1|2831854_2832040_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001302717.1|2832565_2832880_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001448509.1|2832961_2833186_-	YlcI/YnfO family protein	NA	A0A0P0ZE23	Stx2-converting_phage	76.1	2.9e-19
WP_000279796.1|2833227_2833593_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	100.0	3.1e-66
WP_000958380.1|2833885_2834449_+|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	100.0	1.1e-89
WP_032323913.1|2834445_2836107_+|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.5	0.0e+00
WP_044165271.1|2836170_2838108_+|capsid	phage major capsid protein	capsid	A0A0P0ZCT9	Stx2-converting_phage	99.7	0.0e+00
WP_001063025.1|2838152_2838374_+	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
WP_085948186.1|2839285_2840442_-|transposase	IS3-like element IS600 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_001118085.1|2841172_2841754_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	54.8	2.7e-48
WP_085948186.1|2842040_2843197_-|transposase	IS3-like element IS600 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_072129433.1|2843301_2843724_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	94.8	1.2e-69
WP_001299273.1|2843851_2844910_-	T3SS effector EspW	NA	NA	NA	NA	NA
WP_001144080.1|2844984_2845635_-	T3SS effector NleG family protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
WP_001132151.1|2845818_2846409_+	T3SS effector guanine nucleotide exchange factor EspM2	NA	NA	NA	NA	NA
WP_001435497.1|2846625_2846790_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	87.5	2.2e-16
WP_000074983.1|2847198_2848317_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z04	Phage_21	44.2	7.7e-84
WP_000003742.1|2848285_2848555_-	excisionase	NA	NA	NA	NA	NA
WP_069358386.1|2848616_2851088_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	59.3	1.0e-59
WP_000199475.1|2851182_2851371_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449175.1|2851367_2851556_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_000394528.1|2852088_2852463_-	hypothetical protein	NA	NA	NA	NA	NA
2851703:2851721	attR	CACCGCATCACAAAATTCA	NA	NA	NA	NA
WP_001171923.1|2852485_2852704_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001448352.1|2852863_2853019_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	1.2e-06
WP_000103687.1|2853291_2854008_-	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	42.0	1.7e-52
WP_000471549.1|2854057_2854273_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000693943.1|2854269_2854695_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000095675.1|2854717_2855680_+	helix-turn-helix domain-containing protein	NA	S5FM81	Shigella_phage	56.4	1.4e-70
WP_001151209.1|2855720_2856143_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	90.6	1.3e-63
WP_000004322.1|2856139_2856394_+	hypothetical protein	NA	A0A0U2RK51	Escherichia_phage	94.0	4.8e-42
WP_001002672.1|2856386_2856698_+	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	97.1	1.1e-59
WP_001204666.1|2857003_2857582_+	sce7726 family protein	NA	A0A0U2RXY7	Escherichia_phage	100.0	2.6e-104
WP_000156210.1|2857541_2858639_-	beta family protein	NA	A0A0U2S621	Escherichia_phage	99.5	1.4e-210
WP_000589012.1|2859272_2860613_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_001317460.1|2861049_2861382_-	FlxA-like family protein	NA	NA	NA	NA	NA
WP_001326990.1|2861584_2861890_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000534858.1|2861914_2862154_+	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_000323025.1|2862153_2862441_+	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000813254.1|2862512_2862668_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000980994.1|2862884_2863136_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012304870.1|2863202_2863481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001265198.1|2863482_2864532_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.3	1.3e-112
WP_001047133.1|2864545_2865298_+	antitermination protein	NA	Q8SBE4	Shigella_phage	94.8	1.3e-130
WP_120795389.1|2865575_2865665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000087756.1|2865719_2865932_-	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_000066483.1|2866232_2866448_+	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	4.5e-25
WP_000839590.1|2867201_2867417_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000189915.1|2867421_2867733_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_001092971.1|2867729_2868263_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_001071769.1|2868259_2868757_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
WP_000066495.1|2869119_2869332_+	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_071524604.1|2869342_2869531_+	cold-shock protein	NA	NA	NA	NA	NA
WP_122134696.1|2869533_2869599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001309517.1|2869678_2869834_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001019606.1|2870005_2870179_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000035577.1|2870330_2870741_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	89.7	1.2e-63
WP_001031435.1|2871041_2871248_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	91.2	3.9e-26
WP_000421825.1|2871808_2872348_+	DUF1441 family protein	NA	A5LH26	Enterobacteria_phage	100.0	1.8e-94
WP_000507036.1|2872356_2874456_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	96.6	0.0e+00
WP_001072975.1|2874452_2874665_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000985929.1|2874664_2876173_+|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.6	4.5e-289
WP_001136588.1|2876117_2878145_+|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.7	0.0e+00
WP_001097041.1|2878231_2878555_+	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	98.1	5.5e-51
WP_001283148.1|2878547_2878823_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	98.9	1.1e-44
WP_000677126.1|2878834_2879413_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	97.9	2.0e-99
WP_001079398.1|2879409_2879811_+|tail	tail protein	tail	A0A291AWY2	Escherichia_phage	100.0	8.3e-73
WP_000211132.1|2879821_2880565_+|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	97.2	8.1e-130
WP_001341514.1|2880625_2881012_+|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	97.7	5.2e-64
WP_001161009.1|2881020_2881350_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_000372024.1|2881321_2884387_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.9	0.0e+00
WP_000447251.1|2884386_2884716_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	99.1	3.0e-60
WP_001152371.1|2884725_2885424_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	98.7	1.9e-133
WP_000140707.1|2885428_2886172_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	95.9	1.8e-145
WP_000741589.1|2886069_2886717_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	97.2	1.9e-111
WP_044162558.1|2886777_2890191_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	96.9	0.0e+00
WP_001233114.1|2890261_2890861_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	93.5	2.5e-105
WP_001448491.1|2890925_2893886_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0K2FIZ6	Escherichia_phage	54.1	4.0e-55
WP_000885616.1|2893885_2894461_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
WP_000086514.1|2894558_2895149_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	7.3e-25
WP_000836768.1|2895465_2895699_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_120795384.1|2895767_2895881_-	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000527750.1|2897855_2899316_+	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	30.3	5.6e-42
>prophage 12
NZ_CP012693	Escherichia coli strain FORC_028 chromosome, complete genome	5704396	3181454	3264234	5704396	lysis,holin,transposase,integrase,capsid,terminase,tail,head,portal,protease	Stx2-converting_phage(33.33%)	91	3219904:3219919	3273492:3273507
WP_000422045.1|3181454_3182504_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559281.1|3182723_3183482_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	24.5	4.4e-06
WP_001278906.1|3183478_3184069_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_001291216.1|3184108_3184981_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001342101.1|3185081_3185702_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001285661.1|3185698_3186580_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001700591.1|3186717_3186762_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001194584.1|3186853_3188416_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_000763511.1|3188415_3190011_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_000983926.1|3190011_3191373_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	39.8	1.9e-36
WP_000209520.1|3191384_3192578_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000443067.1|3192577_3193384_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000807651.1|3193764_3193944_+	general stress protein	NA	NA	NA	NA	NA
WP_001056491.1|3194029_3194530_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079509.1|3194575_3195082_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001345079.1|3196407_3197058_-	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	32.4	6.6e-27
WP_001144877.1|3198564_3199155_-	T3SS effector guanine nucleotide exchange factor EspM1	NA	NA	NA	NA	NA
WP_001303944.1|3199338_3199986_+	T3SS effector E3 ubiquitin-protein ligase NleG	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
WP_001414184.1|3200122_3200269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303943.1|3200696_3200975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000938103.1|3202142_3202712_-	T3SS effector caspase inhibitor NleF	NA	NA	NA	NA	NA
WP_000950979.1|3202777_3203689_-	type III secretion system effector kinase NleH1-2	NA	A5LH48	Enterobacteria_phage	82.2	3.0e-134
WP_106409364.1|3203795_3203918_-|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	91.3	3.8e-05
WP_001023357.1|3207864_3208134_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A2R2Z347	Escherichia_phage	100.0	3.8e-45
WP_001339397.1|3208194_3208872_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|3208871_3209219_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381395.1|3209238_3210810_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000216552.1|3210842_3212156_-|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.4	6.9e-76
WP_001228278.1|3212307_3212907_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	95.5	5.9e-107
WP_000902073.1|3212974_3214024_-	DUF1983 domain-containing protein	NA	Q9EYE7	Enterobacteria_phage	100.0	4.5e-195
WP_000099160.1|3214046_3215585_-|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.8	3.9e-296
WP_000612626.1|3215633_3215981_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000839170.1|3215977_3216382_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	99.3	2.5e-69
WP_050439450.1|3219252_3219885_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.1	3.9e-101
WP_000194723.1|3219830_3220574_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.0	5.0e-148
3219904:3219919	attL	CGCCAGACAGAATGCG	NA	NA	NA	NA
WP_001335877.1|3220584_3221283_-|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	96.6	1.7e-129
WP_000807940.1|3221282_3221624_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	97.3	4.7e-61
WP_000212980.1|3221616_3224859_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	92.0	0.0e+00
WP_001513217.1|3224906_3225116_-	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	100.0	1.5e-33
WP_000710949.1|3225211_3225586_-|tail	phage tail assembly chaperone	tail	A0A0P0ZE84	Stx2-converting_phage	99.2	1.7e-64
WP_001275441.1|3225600_3226317_-	immunoglobulin domain-containing protein	NA	A0A0P0ZDV1	Stx2-converting_phage	99.6	3.6e-127
WP_000133388.1|3226383_3226728_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573391.1|3226724_3227171_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007905.1|3227167_3227518_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125990.1|3227527_3227854_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZBH1	Stx2-converting_phage	100.0	9.2e-54
WP_000267296.1|3227856_3230436_-|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	99.9	0.0e+00
WP_001063099.1|3230381_3230603_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_062854036.1|3230647_3232426_-|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	91.8	0.0e+00
WP_033800465.1|3232489_3234151_-|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	99.3	0.0e+00
WP_044162959.1|3234147_3234711_-|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	98.4	6.8e-89
WP_000279801.1|3235002_3235368_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	95.9	2.3e-61
WP_000095732.1|3235409_3235610_+	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	95.5	3.7e-29
WP_000828072.1|3235741_3236068_-	TonB family protein	NA	H6WZK5	Escherichia_phage	98.1	3.4e-56
WP_012816791.1|3236468_3236654_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_032140280.1|3236875_3236962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000992033.1|3237516_3238050_-	lysozyme	NA	Q6H9V6	Enterobacteria_phage	96.0	8.1e-100
WP_021569237.1|3238100_3238445_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	98.2	4.2e-57
WP_000284518.1|3238449_3238665_-|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
WP_069358388.1|3238814_3240668_-	SASA family carbohydrate esterase	NA	H6WZJ9	Escherichia_phage	97.6	0.0e+00
WP_000871291.1|3240927_3241263_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	5.2e-44
WP_001340026.1|3241543_3241675_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	96.4	7.0e-05
WP_000611215.1|3242473_3243523_-	site-specific DNA-methyltransferase	NA	Q8W637	Enterobacteria_phage	91.7	3.4e-190
WP_000917767.1|3243673_3243871_-	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	100.0	2.1e-29
WP_000640017.1|3244102_3244645_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.9	1.9e-72
WP_000140024.1|3244653_3245019_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.3	1.6e-38
WP_001369253.1|3245019_3246075_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.8	2.4e-87
WP_012817871.1|3246076_3246349_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	49.2	9.4e-12
WP_000813254.1|3246516_3246672_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000323025.1|3246744_3247032_-	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000534858.1|3247031_3247271_-	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_001326990.1|3247295_3247601_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001317460.1|3247803_3248136_+	FlxA-like family protein	NA	NA	NA	NA	NA
WP_000589012.1|3248572_3249913_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_001151195.1|3249946_3250366_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	93.4	1.3e-55
WP_000054507.1|3250406_3251372_-	hypothetical protein	NA	U5P0A0	Shigella_phage	61.3	6.5e-55
WP_000705349.1|3251352_3251874_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000476993.1|3251857_3252085_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001003381.1|3252162_3252570_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	46.2	2.5e-24
WP_000379589.1|3252762_3252918_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_000347171.1|3252919_3253495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000854559.1|3253981_3254170_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001083280.1|3254166_3254358_+|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_000048369.1|3254451_3256923_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.7	8.5e-59
WP_000381395.1|3257118_3258690_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|3258709_3259057_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|3259056_3259734_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000877011.1|3259988_3261269_+|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	61.8	4.3e-155
WP_001360138.1|3261288_3261399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000836079.1|3261456_3262476_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	25.9	9.7e-17
WP_001295394.1|3262487_3263702_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000598292.1|3263907_3264234_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
3273492:3273507	attR	CGCCAGACAGAATGCG	NA	NA	NA	NA
>prophage 13
NZ_CP012693	Escherichia coli strain FORC_028 chromosome, complete genome	5704396	3280519	3297488	5704396	integrase,capsid,terminase,head,tail,portal,protease	uncultured_Caudovirales_phage(90.91%)	24	3282684:3282706	3297514:3297536
WP_001260840.1|3280519_3281341_+|protease	serine protease	protease	NA	NA	NA	NA
WP_000046661.1|3281379_3281709_-	multidrug/spermidine efflux SMR transporter subunit MdtI	NA	NA	NA	NA	NA
WP_000276149.1|3281695_3282061_-	multidrug/spermidine efflux SMR transporter subunit MdtJ	NA	NA	NA	NA	NA
3282684:3282706	attL	TGACTACACCAGTGACTACACCG	NA	NA	NA	NA
WP_000133423.1|3283374_3283656_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000127880.1|3283669_3285331_-|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	81.7	6.8e-278
WP_000113645.1|3285314_3285671_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	81.4	9.4e-52
WP_024166058.1|3285794_3285977_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001145909.1|3285960_3286401_-	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	67.1	2.9e-55
WP_000134111.1|3286400_3286697_-|head,tail	phage head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	65.3	4.0e-32
WP_016241300.1|3286693_3287032_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	51.8	2.5e-30
WP_024196038.1|3287028_3288240_-|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	79.5	3.3e-189
WP_016241302.1|3288241_3288799_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	62.4	4.6e-61
WP_016241303.1|3288854_3290012_-|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	64.6	1.4e-136
WP_016241304.1|3290304_3290529_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016241305.1|3290654_3290927_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_016241306.1|3290937_3291348_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_001294165.1|3291357_3291663_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001475690.1|3291659_3291905_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016241307.1|3292192_3294010_-	hypothetical protein	NA	Q7M2A8	Enterobacteria_phage	50.4	1.7e-128
WP_001261503.1|3294006_3294306_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_016241308.1|3294312_3294633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071961445.1|3294625_3295648_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_001443601.1|3295705_3295894_-	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	67.9	9.1e-14
WP_000085272.1|3296258_3297488_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	55.6	3.2e-131
3297514:3297536	attR	TGACTACACCAGTGACTACACCG	NA	NA	NA	NA
>prophage 14
NZ_CP012693	Escherichia coli strain FORC_028 chromosome, complete genome	5704396	3495122	3591039	5704396	holin,transposase,integrase,capsid,tRNA,terminase,tail,head,portal,protease	Escherichia_phage(31.15%)	111	3574983:3574998	3596757:3596772
WP_071961446.1|3495122_3496331_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	92.5	1.1e-205
WP_000604932.1|3496338_3496770_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	58.4	4.8e-42
WP_000513743.1|3496785_3496974_-	DUF1869 domain-containing protein	NA	NA	NA	NA	NA
WP_000939317.1|3496977_3497337_-	DUF1971 domain-containing protein	NA	NA	NA	NA	NA
WP_000457202.1|3497509_3498148_-	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_001061578.1|3498274_3499198_-	DNA-binding transcriptional regulator DmlR	NA	NA	NA	NA	NA
WP_000978499.1|3499300_3500386_+	multifunctional D-malate/3-isopropylmalate/tartarate dehydrogenase	NA	NA	NA	NA	NA
WP_000987525.1|3500636_3502247_+	BCCT family transporter YeaV	NA	NA	NA	NA	NA
WP_000067805.1|3502278_3503403_+	carnitine monooxygenase subunit YeaW	NA	NA	NA	NA	NA
WP_001287005.1|3503458_3504424_+	carnitine monooxygenase subunit YeaX	NA	NA	NA	NA	NA
WP_001342154.1|3504477_3505593_-	ribonuclease D	NA	NA	NA	NA	NA
WP_000758422.1|3505674_3507360_-	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	1.5e-35
WP_000290576.1|3507564_3508146_-	Slp family lipoprotein YeaY	NA	NA	NA	NA	NA
WP_001221003.1|3508185_3508881_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_000128847.1|3508938_3510849_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	31.9	4.5e-92
WP_001295493.1|3510980_3511325_+	RidA family protein	NA	NA	NA	NA	NA
WP_001307845.1|3511687_3512047_+	DUF1889 family protein	NA	NA	NA	NA	NA
WP_000457334.1|3512166_3512346_-	YoaH family protein	NA	NA	NA	NA	NA
WP_000854972.1|3512419_3513781_+	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	33.4	3.4e-41
WP_000456725.1|3513784_3514363_+	CoA pyrophosphatase	NA	NA	NA	NA	NA
WP_000624298.1|3514546_3515911_+	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_001295494.1|3516041_3517640_+	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
WP_000394983.1|3517643_3519200_-	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	45.4	1.7e-41
WP_000150551.1|3519662_3520634_+	PTS mannose transporter subunit IIAB	NA	NA	NA	NA	NA
WP_000406926.1|3520696_3521497_+	PTS mannose transporter subunit IIC	NA	NA	NA	NA	NA
WP_000228655.1|3521509_3522361_+	PTS mannose transporter subunit IID	NA	NA	NA	NA	NA
WP_000156255.1|3522415_3522874_+	DUF986 domain-containing protein	NA	NA	NA	NA	NA
WP_001296134.1|3523302_3523869_+	manganese efflux pump MntP	NA	NA	NA	NA	NA
WP_000010107.1|3523865_3524675_-	23S rRNA (guanine(745)-N(1))-methyltransferase	NA	NA	NA	NA	NA
WP_001062678.1|3524840_3525050_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
WP_001295496.1|3525062_3525206_-	YobF family protein	NA	NA	NA	NA	NA
WP_001006866.1|3525874_3526162_-	YebO family protein	NA	NA	NA	NA	NA
WP_000714550.1|3526236_3526380_-	PhoP/PhoQ regulator MgrB	NA	NA	NA	NA	NA
WP_001211011.1|3526538_3526778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001262174.1|3526920_3527712_-	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
WP_001127210.1|3527888_3529262_+	MFS transporter	NA	NA	NA	NA	NA
WP_000984517.1|3529307_3530189_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_001427396.1|3530380_3532429_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	6.8e-86
WP_000431370.1|3532448_3533147_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_001043882.1|3533243_3533741_-	L-methionine (R)-S-oxide reductase	NA	NA	NA	NA	NA
WP_001207284.1|3533870_3535154_+	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_001299674.1|3535122_3537756_+	lipid-binding membrane homeostasis protein YebT	NA	NA	NA	NA	NA
WP_000057024.1|3537835_3539275_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_001295499.1|3539392_3539629_+	DUF1480 family protein	NA	NA	NA	NA	NA
WP_001296140.1|3539733_3539925_+	YebW family protein	NA	NA	NA	NA	NA
WP_000812724.1|3539925_3540582_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.2	3.1e-56
WP_001121225.1|3541536_3542187_+	type III secretion system effector NleG7	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_000491545.1|3542411_3543287_-	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	99.7	7.2e-162
WP_001023379.1|3543427_3543697_-|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	95.5	8.7e-42
WP_000268926.1|3543698_3545012_-|tail	phage tail protein	tail	Q9EYE8	Enterobacteria_phage	99.3	2.8e-77
WP_001230428.1|3545076_3545676_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	99.5	1.4e-111
WP_069358391.1|3545743_3549136_-	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	84.9	0.0e+00
WP_096844540.1|3549381_3550014_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.8	3.5e-102
WP_001375575.1|3549959_3550703_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.6	2.5e-147
WP_001299882.1|3550708_3551407_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	99.1	2.1e-132
WP_000847298.1|3551406_3551736_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_032324121.1|3551732_3554312_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	83.1	0.0e+00
WP_000533431.1|3554292_3554706_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	82.8	3.0e-41
WP_069358392.1|3554732_3555164_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	67.8	2.1e-42
WP_032325228.1|3555177_3555930_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	95.6	1.3e-130
WP_000683137.1|3555937_3556333_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	92.4	3.7e-65
WP_000975096.1|3556329_3556908_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	5.9e-80
WP_000752994.1|3556919_3557273_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	100.0	9.0e-63
WP_000158897.1|3557284_3557680_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	93.9	2.4e-56
WP_000063258.1|3557721_3558747_-|capsid	major capsid protein	capsid	A0A2I6TCE5	Escherichia_phage	98.8	5.1e-191
WP_001365129.1|3558802_3559135_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	5.5e-54
WP_000123251.1|3559144_3560464_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.9	7.6e-232
WP_001415980.1|3560444_3562046_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.5	2.3e-307
WP_000198153.1|3562042_3562249_-	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001027379.1|3562245_3564171_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.1	0.0e+00
WP_000453587.1|3564145_3564691_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_001300236.1|3565087_3565312_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	88.7	2.9e-19
WP_001303878.1|3565393_3565708_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_012816791.1|3566235_3566421_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000675931.1|3566642_3566756_-	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_001003111.1|3566976_3567510_-	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.9	1.4e-99
WP_000138558.1|3567669_3567942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024182511.1|3568197_3568413_-|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	97.2	1.7e-32
WP_000874348.1|3568852_3570703_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.3	0.0e+00
WP_000261909.1|3571470_3572184_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000917737.1|3572321_3572519_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	2.6e-27
WP_000265267.1|3572805_3573624_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000090265.1|3573775_3574147_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	84.0	1.0e-53
WP_001217436.1|3574136_3574508_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_001265133.1|3574520_3575570_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	3.4e-110
3574983:3574998	attL	GCGGATTTTTTCCGCC	NA	NA	NA	NA
WP_001341388.1|3575571_3575850_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000018421.1|3576017_3576230_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	92.9	8.1e-27
WP_001278454.1|3576419_3576524_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000208016.1|3576639_3577509_-	DUF551 domain-containing protein	NA	A0A1U9AJ59	Stx1_converting_phage	79.2	8.5e-123
WP_000224233.1|3577519_3577783_-	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	8.8e-31
WP_000209148.1|3577784_3578003_-	DUF4014 family protein	NA	A0A1I9LJM2	Stx_converting_phage	91.7	5.2e-29
WP_000935423.1|3578035_3578248_-	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	97.1	5.6e-36
WP_001151235.1|3578353_3578776_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	90.6	2.6e-64
WP_032324560.1|3578791_3579562_-	DUF1627 domain-containing protein	NA	A0A088CE47	Shigella_phage	68.5	2.5e-86
WP_021498074.1|3579587_3580328_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	90.2	4.6e-125
WP_001205820.1|3580334_3581450_-	hypothetical protein	NA	V5URT9	Shigella_phage	68.4	2.2e-131
WP_000273724.1|3581528_3581984_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000693855.1|3582190_3582616_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000887453.1|3582599_3582872_-	helix-turn-helix domain-containing protein	NA	A0A0U2S629	Escherichia_phage	45.8	1.1e-12
WP_000986592.1|3582980_3583382_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	54.5	7.4e-13
WP_000536233.1|3583409_3583601_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303876.1|3583600_3583888_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000379552.1|3584164_3584317_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	6.0e-08
WP_000394543.1|3584328_3584967_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	3.3e-07
WP_001133037.1|3584967_3585177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000413705.1|3585744_3585933_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001098307.1|3585929_3586121_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_009448824.1|3586214_3588665_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.6	1.1e-58
WP_000273151.1|3588732_3588975_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_001299351.1|3588952_3589972_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.3e-85
WP_000375138.1|3590379_3591039_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	54.9	5.2e-48
3596757:3596772	attR	GGCGGAAAAAATCCGC	NA	NA	NA	NA
>prophage 15
NZ_CP012693	Escherichia coli strain FORC_028 chromosome, complete genome	5704396	3787062	3867806	5704396	lysis,holin,transposase,integrase,terminase,tail,head,portal,protease	Enterobacteria_phage(47.76%)	98	3788188:3788222	3869240:3869274
WP_000399648.1|3787062_3788043_+|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
3788188:3788222	attL	GTAGGCCGGATAAGGCGTTTACGCCGCATCCGGCA	NA	NA	NA	NA
WP_001145128.1|3788302_3788785_-	N-glycosidase YbiA	NA	A0A0H3TLU0	Faustovirus	52.7	1.5e-36
WP_001218655.1|3788904_3791055_+	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	25.8	4.8e-42
WP_000386551.1|3791082_3792045_+	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_000443534.1|3792185_3793271_+	hydroxycarboxylate dehydrogenase HcXB	NA	NA	NA	NA	NA
WP_000007094.1|3793501_3794866_-	ATP-dependent RNA helicase RhlE	NA	A0A1V0SBR7	Catovirus	31.8	1.5e-52
WP_001296991.1|3795094_3795766_+	DNA-binding transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_001296990.1|3795768_3796764_+	secretion protein HlyD	NA	NA	NA	NA	NA
WP_000996091.1|3796756_3798493_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.3	1.3e-18
WP_000070131.1|3798485_3799619_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000469031.1|3799629_3800736_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000871982.1|3800697_3801108_-	YbhQ family protein	NA	NA	NA	NA	NA
WP_001113363.1|3801240_3802002_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000650337.1|3801998_3803240_+	cardiolipin synthase ClsB	NA	NA	NA	NA	NA
WP_000045454.1|3803239_3804196_+	UPF0104 family protein	NA	NA	NA	NA	NA
WP_000446932.1|3804231_3804945_-	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_000373624.1|3805149_3805854_-	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_000852287.1|3805990_3806443_-	molybdopterin synthase catalytic subunit MoaE	NA	NA	NA	NA	NA
WP_000598619.1|3806444_3806690_-	molybdopterin synthase sulfur carrier subunit	NA	NA	NA	NA	NA
WP_000080885.1|3806682_3807168_-	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_000084632.1|3807170_3807683_-	molybdenum cofactor biosynthesis protein B	NA	NA	NA	NA	NA
WP_001295301.1|3807704_3808694_-	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
WP_001295302.1|3809090_3809999_+	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	31.1	1.4e-27
WP_000042533.1|3810190_3812212_-	excinuclease ABC subunit B	NA	NA	NA	NA	NA
WP_000044868.1|3812790_3813468_-	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_000246805.1|3813460_3814216_-	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_000118840.1|3814202_3815357_-	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
WP_000951213.1|3815353_3816394_-	biotin synthase BioB	NA	NA	NA	NA	NA
WP_001307065.1|3816480_3817770_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.0	1.0e-18
WP_000767389.1|3817828_3818305_+	kinase inhibitor	NA	NA	NA	NA	NA
WP_001121571.1|3818808_3819462_+	type III secretion system effector ADP-ribosyltransferase EspJ	NA	NA	NA	NA	NA
WP_000354291.1|3819474_3819696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001002868.1|3819779_3820160_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001448642.1|3820360_3820936_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	77.5	1.6e-77
WP_001339397.1|3820996_3821674_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|3821673_3822021_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381395.1|3822040_3823612_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_021351651.1|3824086_3824458_+	hypothetical protein	NA	K7PH54	Enterobacteria_phage	95.1	1.1e-58
WP_000652081.1|3824581_3825409_-	type III secretion system effector Cif	NA	A5LH49	Enterobacteria_phage	98.2	3.1e-154
WP_000950982.1|3825632_3826514_-	hypothetical protein	NA	A5LH48	Enterobacteria_phage	90.4	3.9e-147
WP_001023459.1|3826619_3826889_-|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	96.6	4.6e-43
WP_000268998.1|3826890_3828105_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	B6DZB7	Enterobacteria_phage	95.8	6.6e-81
WP_001230449.1|3828169_3828769_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	98.5	2.6e-110
WP_069358393.1|3828836_3832313_-	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.9	0.0e+00
WP_149026306.1|3832549_3833182_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	92.3	4.2e-103
WP_069358375.1|3833127_3833871_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.8	2.9e-148
WP_044703882.1|3833881_3834580_-|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	98.7	4.7e-132
WP_000847304.1|3834579_3834909_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
WP_000082320.1|3834905_3837485_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	82.3	0.0e+00
WP_000533431.1|3837465_3837879_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	82.8	3.0e-41
WP_000479086.1|3837905_3838337_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	4.8e-42
WP_069358395.1|3838350_3839103_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	93.6	4.9e-127
WP_032284507.1|3839110_3839479_-	hypothetical protein	NA	A0A0K2FIF4	Enterobacteria_phage	88.0	2.4e-50
WP_000099160.1|3839475_3841014_-|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.8	3.9e-296
WP_000612626.1|3841062_3841410_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000839170.1|3841406_3841811_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	99.3	2.5e-69
WP_001432013.1|3842054_3843647_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.1	3.2e-184
WP_000259002.1|3843643_3843850_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_009442816.1|3843833_3845762_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.4	2.7e-262
WP_000235451.1|3845733_3846243_-|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	33.3	1.2e-12
WP_001307652.1|3846638_3846833_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.8	9.7e-27
WP_000881326.1|3847020_3847638_-	Rha family transcriptional regulator	NA	A0A1R3Y613	Salmonella_virus	85.9	6.5e-93
WP_000092325.1|3847787_3848225_-|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	98.6	1.7e-71
WP_000075132.1|3848221_3848719_-	lysozyme RrrD	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_024164617.1|3848718_3848934_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	7.7e-33
WP_000499454.1|3851535_3851694_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001302581.1|3851779_3852523_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097238.1|3852707_3853397_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_032160865.1|3853411_3853534_-	YlcG family protein	NA	NA	NA	NA	NA
WP_000750155.1|3853872_3854832_+	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_000994516.1|3855043_3855232_-	protein ninH	NA	A5VW84	Enterobacteria_phage	100.0	5.5e-27
WP_001008193.1|3855228_3855591_-	RusA family crossover junction endodeoxyribonuclease	NA	A5VW85	Enterobacteria_phage	99.2	2.7e-62
WP_000002261.1|3855587_3855878_-	DUF1364 domain-containing protein	NA	A0A192Y6R9	Salmonella_phage	97.9	2.9e-51
WP_001003989.1|3855877_3856600_-	phage antirepressor KilAC domain-containing protein	NA	K7P6K2	Enterobacteria_phage	99.6	5.4e-131
WP_001341811.1|3856592_3856802_-	protein ninF	NA	G9L691	Escherichia_phage	97.1	2.6e-30
WP_000924601.1|3856761_3857163_-	hypothetical protein	NA	Q9EYC4	Enterobacteria_phage	100.0	1.4e-72
WP_001254255.1|3857165_3857342_-	NinE family protein	NA	A5VW90	Enterobacteria_phage	100.0	4.6e-28
WP_000814611.1|3857338_3857749_-	recombination protein NinB	NA	A0A0P0ZCW6	Stx2-converting_phage	99.3	2.1e-71
WP_000344573.1|3857720_3858077_-	hypothetical protein	NA	K7PHN9	Enterobacterial_phage	97.3	2.1e-59
WP_000145926.1|3858373_3858664_-	protein ren	NA	O48423	Enterobacteria_phage	100.0	9.6e-47
WP_001202479.1|3858660_3858873_-	hypothetical protein	NA	O48422	Enterobacteria_phage	100.0	3.5e-30
WP_085948186.1|3858959_3860115_+|transposase	IS3-like element IS600 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_001341800.1|3860626_3861487_+	hypothetical protein	NA	K7P7J7	Enterobacteria_phage	99.3	2.4e-37
WP_000638547.1|3861511_3861643_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A5VWA4	Enterobacteria_phage	100.0	1.4e-16
WP_001243354.1|3861627_3861780_+	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	98.0	1.5e-19
WP_000031370.1|3862036_3862642_+	ERF family protein	NA	Q9MCQ9	Enterobacteria_phage	100.0	4.1e-108
WP_000951334.1|3862641_3863025_+	hypothetical protein	NA	K7P6P8	Enterobacteria_phage	98.4	2.5e-66
WP_001111278.1|3863048_3863342_+	DUF2856 family protein	NA	G8C7L1	Escherichia_phage	99.0	2.5e-50
WP_001214436.1|3863352_3863517_+	DUF2737 family protein	NA	K7P7R0	Enterobacteria_phage	98.1	4.2e-23
WP_000812206.1|3863513_3864071_+	hypothetical protein	NA	E7C9P6	Salmonella_phage	64.3	3.2e-62
WP_000034232.1|3864067_3864625_+	ead/Ea22-like family protein	NA	A5VWB3	Enterobacteria_phage	83.6	4.6e-45
WP_000104414.1|3864626_3865244_+	hypothetical protein	NA	Q716F4	Shigella_phage	64.2	5.6e-36
WP_012817743.1|3865240_3865543_+	restriction alleviation protein, Lar family	NA	Q716F5	Shigella_phage	97.0	9.4e-53
WP_000002107.1|3865535_3865820_+	ASCH domain-containing protein	NA	A0A2D1GLL3	Escherichia_phage	100.0	1.8e-50
WP_000545733.1|3865892_3866060_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	100.0	1.3e-27
WP_001281774.1|3866088_3866433_+	hypothetical protein	NA	K7PJY7	Enterobacterial_phage	98.2	4.5e-59
WP_001303849.1|3866539_3866758_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000533654.1|3866735_3867806_+|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	99.4	5.6e-201
3869240:3869274	attR	TGCCGGATGCGGCGTAAACGCCTTATCCGGCCTAC	NA	NA	NA	NA
>prophage 16
NZ_CP012693	Escherichia coli strain FORC_028 chromosome, complete genome	5704396	4087328	4145834	5704396	lysis,transposase,integrase,capsid,terminase,tail,head,portal,protease	Enterobacteria_phage(56.6%)	66	4095809:4095855	4145848:4145894
WP_000420938.1|4087328_4088465_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_000383941.1|4088733_4090971_+	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_001375368.1|4090957_4093930_+	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_001224569.1|4093930_4094821_+	DUF4434 family protein	NA	NA	NA	NA	NA
WP_001177453.1|4095003_4095765_+	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
4095809:4095855	attL	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
WP_001201825.1|4096277_4097231_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001226384.1|4097417_4098902_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000239881.1|4099447_4100116_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000885569.1|4100170_4100755_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.3	2.5e-102
WP_000279150.1|4100754_4103715_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A2D1UII2	Escherichia_phage	98.3	3.0e-58
WP_001230523.1|4103779_4104379_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	97.5	1.8e-108
WP_000090884.1|4107776_4108409_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.0	8.5e-96
WP_001152557.1|4109094_4109793_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	96.6	3.4e-130
WP_000847347.1|4109792_4110122_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	99.1	3.6e-58
WP_000840236.1|4110118_4112680_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	92.1	0.0e+00
WP_000459457.1|4112672_4113107_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479169.1|4113088_4113511_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	3.1e-70
WP_001342267.1|4113526_4114267_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	98.0	1.0e-129
WP_000683110.1|4114274_4114670_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	99.2	2.9e-70
WP_000985132.1|4114666_4115245_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
WP_000752961.1|4115235_4115610_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	99.1	8.0e-62
WP_000158868.1|4115621_4116017_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	95.5	5.7e-58
WP_000063244.1|4116058_4117084_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.7	1.8e-188
WP_001345004.1|4117139_4117472_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	5.0e-55
WP_001339397.1|4118400_4119078_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|4119077_4119425_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381395.1|4119444_4121016_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_001444138.1|4121488_4123090_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.1	8.5e-310
WP_000198149.1|4123086_4123293_-	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001027295.1|4123289_4125215_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.7	0.0e+00
WP_000453558.1|4125189_4125735_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	4.0e-94
WP_001427981.1|4126123_4126318_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	95.3	7.4e-27
WP_162829202.1|4126435_4127648_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000738423.1|4127989_4128283_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_001228695.1|4128373_4128556_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_001135274.1|4128772_4129270_-	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	97.0	3.2e-90
WP_000839596.1|4129269_4129485_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000737278.1|4130073_4131156_+	porin OmpD	NA	Q1MVN1	Enterobacteria_phage	80.6	7.8e-166
WP_001204791.1|4131344_4131728_-	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_000971074.1|4131813_4131954_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	6.5e-09
WP_001099712.1|4131950_4132313_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000774477.1|4132309_4132600_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	96.9	6.0e-49
WP_000224914.1|4132592_4132763_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_001053023.1|4132762_4133218_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	67.5	3.1e-60
WP_072097617.1|4133214_4133316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000520500.1|4133439_4133841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001038620.1|4133819_4134236_-	HEPN domain-containing protein	NA	NA	NA	NA	NA
WP_001415151.1|4134535_4135144_-	hypothetical protein	NA	Q9T1Q5	Acyrthosiphon_pisum_secondary_endosymbiont_phage	67.3	1.5e-33
WP_000152742.1|4135896_4136244_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000788789.1|4136448_4137150_-	Replication protein P	NA	M1FJ72	Enterobacteria_phage	98.7	3.8e-129
WP_000147885.1|4137146_4138166_-	replication protein	NA	M1FN81	Enterobacteria_phage	67.0	4.8e-109
WP_001182773.1|4138162_4138702_-	toxin YdaT domain-containing protein	NA	M9NZI6	Enterobacteria_phage	66.1	2.6e-61
WP_001067458.1|4138771_4139002_-	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
WP_000858975.1|4139106_4139796_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	2.8e-92
WP_000066829.1|4139877_4140141_+	hypothetical protein	NA	A0A2H4FNC7	Salmonella_phage	95.4	4.2e-41
WP_001444023.1|4140276_4140597_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000206913.1|4141063_4141354_+	hypothetical protein	NA	K7P6H3	Enterobacteria_phage	82.4	2.5e-26
WP_000995439.1|4141429_4141726_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000100847.1|4141731_4142517_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000611716.1|4142513_4143194_+	YqaJ viral recombinase family protein	NA	B6DZ61	Enterobacteria_phage	98.2	3.0e-131
WP_000149544.1|4143190_4143373_+	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	96.7	6.9e-27
WP_000548537.1|4143345_4143537_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.1e-26
WP_001443983.1|4143547_4143829_+	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	7.2e-47
WP_000763390.1|4143927_4144146_+	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	98.6	4.9e-35
WP_000488407.1|4144193_4144472_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
WP_000051902.1|4144670_4145834_+|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	3.0e-200
4145848:4145894	attR	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
>prophage 17
NZ_CP012693	Escherichia coli strain FORC_028 chromosome, complete genome	5704396	4154668	4227148	5704396	transposase,tRNA,tail,head,plate,protease	Shigella_phage(55.0%)	78	NA	NA
WP_000912342.1|4154668_4156054_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.0e-45
WP_000256002.1|4156227_4156722_+	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_000212252.1|4156724_4157447_+	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_001295318.1|4157564_4158074_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_000815553.1|4158070_4159138_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_000855357.1|4159274_4160168_-	carbamate kinase	NA	NA	NA	NA	NA
WP_000152513.1|4160164_4160980_-	DUF2877 domain-containing protein	NA	NA	NA	NA	NA
WP_000495365.1|4160990_4162250_-	DUF1116 domain-containing protein	NA	NA	NA	NA	NA
WP_000580836.1|4162259_4163927_-	acyl-CoA synthetase FdrA	NA	NA	NA	NA	NA
WP_000703909.1|4164242_4165292_+	ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_001301144.1|4165313_4166549_+	allantoate deiminase	NA	NA	NA	NA	NA
WP_000540946.1|4166559_4167345_+	(S)-ureidoglycine aminohydrolase	NA	NA	NA	NA	NA
WP_001315307.1|4167473_4168619_-	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	41.9	1.1e-48
WP_000006887.1|4169996_4171358_-	allantoinase AllB	NA	NA	NA	NA	NA
WP_000401100.1|4171417_4172872_-	putative allantoin permease	NA	NA	NA	NA	NA
WP_000765839.1|4173040_4173919_-	2-hydroxy-3-oxopropionate reductase	NA	NA	NA	NA	NA
WP_000943558.1|4174018_4174795_-	hydroxypyruvate isomerase	NA	NA	NA	NA	NA
WP_001342079.1|4174807_4176589_-	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.0	7.8e-38
WP_000141275.1|4176678_4177494_-	HTH-type transcriptional repressor AllR	NA	NA	NA	NA	NA
WP_000776388.1|4177571_4178054_-	ureidoglycolate lyase	NA	NA	NA	NA	NA
WP_000460145.1|4178283_4179210_+	HTH-type transcriptional activator AllS	NA	NA	NA	NA	NA
WP_001158001.1|4179278_4180373_+|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
WP_000561851.1|4186489_4188904_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000528256.1|4189529_4190267_-	hypothetical protein	NA	A0A0C4UQZ7	Shigella_phage	78.6	2.9e-103
WP_001443803.1|4190220_4190421_-	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001114107.1|4191036_4191282_-	DUF826 domain-containing protein	NA	NA	NA	NA	NA
WP_000221106.1|4191317_4191497_-	DUF1378 family protein	NA	Q5MBW3	Stx1-converting_phage	55.3	6.0e-07
WP_052067829.1|4191554_4193612_-	9-O-acetyl-N-acetylneuraminic acid deacetylase	NA	H6WZJ9	Escherichia_phage	62.0	7.5e-202
WP_000904930.1|4193702_4194263_-	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	75.7	4.3e-75
WP_010917875.1|4194485_4194689_+|tail	tail fiber protein	tail	NA	NA	NA	NA
WP_000420351.1|4194768_4195290_+|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	52.6	2.1e-47
WP_024017776.1|4195324_4196236_-	hypothetical protein	NA	C9DGQ8	Escherichia_phage	43.1	1.1e-30
WP_000301579.1|4196235_4196796_-	YmfQ family protein	NA	C9DGQ7	Escherichia_phage	49.1	3.0e-44
WP_001146835.1|4196786_4197869_-|plate	baseplate J/gp47 family protein	plate	A0A0C4UQU9	Shigella_phage	53.2	1.1e-98
WP_000763330.1|4197868_4198306_-	phage GP46 family protein	NA	A0A0C4UR04	Shigella_phage	53.5	1.9e-38
WP_000980532.1|4198298_4198913_-|plate	phage baseplate assembly protein V	plate	A0A0C4UQZ3	Shigella_phage	51.0	4.7e-51
WP_000098808.1|4198902_4200027_-	hypothetical protein	NA	C9DGQ3	Escherichia_phage	48.5	7.7e-92
WP_000146118.1|4200010_4201360_-	DNA circularization protein	NA	C9DGQ2	Escherichia_phage	33.1	5.9e-54
WP_000113523.1|4201346_4203422_-	tape measure protein	NA	A0A0C4UQU8	Shigella_phage	37.7	3.7e-71
WP_000213225.1|4203548_4204025_-|tail	phage tail assembly protein	tail	A0A0C4UR03	Shigella_phage	50.8	1.0e-21
WP_000015473.1|4204039_4204405_-|tail	phage tail tube protein	tail	C9DGP8	Escherichia_phage	51.7	2.0e-25
WP_000606748.1|4204413_4205916_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	C9DGP7	Escherichia_phage	51.5	1.5e-138
WP_000848437.1|4205912_4206158_-	DUF2635 domain-containing protein	NA	C9DGP6	Escherichia_phage	54.5	2.8e-07
WP_044723556.1|4206158_4206719_-	DUF1834 family protein	NA	A0A0C4UQU7	Shigella_phage	47.7	3.6e-42
WP_001104959.1|4206715_4207135_-	gp436 family protein	NA	A0A0C4UR02	Shigella_phage	53.6	1.8e-33
WP_069358397.1|4207131_4207575_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001142982.1|4207618_4208566_-|head	Mu-like prophage major head subunit gpT family protein	head	A0A0C4UQR9	Shigella_phage	67.2	1.2e-122
WP_000850816.1|4208565_4209690_-|protease	protease	protease	A0A0C4UQU6	Shigella_phage	47.6	2.9e-78
WP_000094813.1|4209866_4210340_-	phage virion morphogenesis protein	NA	A0A0C4UR01	Shigella_phage	53.9	6.0e-38
WP_033805801.1|4210461_4211793_-|head	phage head morphogenesis protein	head	A0A0C4UQY9	Shigella_phage	58.6	2.3e-151
WP_044805865.1|4211776_4213366_-	DUF935 domain-containing protein	NA	A0A0C4UQR8	Shigella_phage	57.7	4.2e-168
WP_069358398.1|4213365_4215030_-	hypothetical protein	NA	A0A0C4UR29	Shigella_phage	73.2	2.4e-230
WP_000360581.1|4215029_4215611_-	DUF3486 family protein	NA	A0A0C4UQU5	Shigella_phage	57.0	1.9e-49
WP_001279079.1|4215613_4215904_-	hypothetical protein	NA	A0A0C4UR00	Shigella_phage	63.2	2.1e-25
WP_000270159.1|4215900_4216209_-	DUF2730 family protein	NA	NA	NA	NA	NA
WP_000342749.1|4216189_4216417_-	TraR/DksA family transcriptional regulator	NA	NA	NA	NA	NA
WP_001122255.1|4216427_4216646_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115801859.1|4216629_4217058_-	endopeptidase	NA	NA	NA	NA	NA
WP_001125304.1|4217092_4217593_-	lysozyme	NA	B6SD29	Bacteriophage	42.6	3.0e-27
WP_000852377.1|4217664_4218090_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001214359.1|4218159_4218669_-	gp16 family protein	NA	A0A0C4UQU3	Shigella_phage	41.9	2.0e-26
WP_000370523.1|4218665_4218962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001086882.1|4218951_4219149_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000021231.1|4219141_4219474_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000595948.1|4219512_4219698_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000973021.1|4219694_4220246_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_000465562.1|4220249_4220765_-	hypothetical protein	NA	C9DGM0	Escherichia_phage	55.4	1.2e-47
WP_000564281.1|4220764_4221298_-	hypothetical protein	NA	A0A0C4UQU2	Shigella_phage	67.2	6.9e-67
WP_000323221.1|4221301_4221844_-	hypothetical protein	NA	A0A0C4UQZ6	Shigella_phage	40.0	2.9e-28
WP_069358399.1|4221941_4222472_-	host-nuclease inhibitor Gam family protein	NA	C9DGL8	Escherichia_phage	57.1	2.5e-48
WP_021499918.1|4222483_4222777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000049432.1|4222781_4223054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000739863.1|4223050_4223332_-	hypothetical protein	NA	I6WB15	Burkholderia_virus	47.4	2.8e-11
WP_001057199.1|4223333_4223588_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000257932.1|4223600_4223822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001536813.1|4223824_4224757_-	AAA family ATPase	NA	A0A0C4UQR3	Shigella_phage	48.0	2.6e-69
WP_069358400.1|4224827_4226915_-|transposase	Mu transposase C-terminal domain-containing protein	transposase	A0A2D1GNK9	Pseudomonas_phage	44.9	7.5e-165
WP_001575658.1|4226917_4227148_-	helix-turn-helix domain-containing protein	NA	A0A0C4UQU0	Shigella_phage	40.8	1.8e-08
>prophage 18
NZ_CP012693	Escherichia coli strain FORC_028 chromosome, complete genome	5704396	4324158	4375369	5704396	tRNA,tail,head,plate,protease	Shigella_phage(41.38%)	55	NA	NA
WP_000667301.1|4324158_4325286_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	45.8	1.4e-88
WP_001266503.1|4325341_4326412_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_001009884.1|4326504_4327086_+	ACP phosphodiesterase	NA	NA	NA	NA	NA
WP_001443910.1|4327090_4328908_-	maltodextrin glucosidase	NA	NA	NA	NA	NA
WP_001295329.1|4329063_4330437_-	proline-specific permease ProY	NA	NA	NA	NA	NA
WP_000149639.1|4330512_4331832_-	branched-chain amino acid transporter carrier protein BrnQ	NA	NA	NA	NA	NA
WP_000893609.1|4332238_4333534_-	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	30.8	2.9e-26
WP_000198399.1|4333591_4334281_-	phosphate response regulator transcription factor PhoB	NA	W8CYM9	Bacillus_phage	38.0	4.4e-37
WP_001221319.1|4334470_4335673_+	exonuclease subunit SbcD	NA	R4JGS2	Bacillus_phage	32.4	2.4e-06
WP_000698929.1|4335669_4338813_+	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	26.9	5.8e-12
WP_001342329.1|4338938_4340123_+	MFS transporter AraJ	NA	NA	NA	NA	NA
WP_001219321.1|4340265_4341174_-	fructokinase	NA	NA	NA	NA	NA
WP_001298537.1|4341298_4342210_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.6	2.7e-103
WP_122367828.1|4342287_4342371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000941942.1|4342856_4343141_-	pyrimidine/purine nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_001276422.1|4343212_4343890_-	AroM family protein	NA	NA	NA	NA	NA
WP_001142439.1|4344147_4344339_-	protein YaiA	NA	NA	NA	NA	NA
WP_000193393.1|4344388_4344913_-	shikimate kinase AroL	NA	NA	NA	NA	NA
WP_000158159.1|4345095_4345554_-	YaiI/YqxD family protein	NA	NA	NA	NA	NA
WP_001295331.1|4345673_4346483_+	pyrroline-5-carboxylate reductase	NA	NA	NA	NA	NA
WP_000484055.1|4346499_4347615_-	diguanylate cyclase AdrA	NA	A0A127AWB9	Bacillus_phage	34.5	1.5e-18
WP_001295332.1|4347716_4348037_-	phosphate starvation-inducible protein PsiF	NA	NA	NA	NA	NA
WP_001342331.1|4348155_4349571_-	alkaline phosphatase	NA	NA	NA	NA	NA
WP_000792970.1|4349671_4349932_-	anti-adapter protein IraP	NA	NA	NA	NA	NA
WP_001300163.1|4350113_4350317_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000413677.1|4350394_4351489_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_001295334.1|4351512_4351725_-	DUF2754 domain-containing protein	NA	NA	NA	NA	NA
WP_000763151.1|4351984_4352293_+	YaiY family protein	NA	NA	NA	NA	NA
WP_000092043.1|4352351_4353446_-	surface-exposed outer membrane lipoprotein YaiW	NA	NA	NA	NA	NA
WP_000528256.1|4354558_4355296_-	hypothetical protein	NA	A0A0C4UQZ7	Shigella_phage	78.6	2.9e-103
WP_001443803.1|4355249_4355450_-	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001114107.1|4356065_4356311_-	DUF826 domain-containing protein	NA	NA	NA	NA	NA
WP_000221106.1|4356346_4356526_-	DUF1378 family protein	NA	Q5MBW3	Stx1-converting_phage	55.3	6.0e-07
WP_052067829.1|4356583_4358641_-	9-O-acetyl-N-acetylneuraminic acid deacetylase	NA	H6WZJ9	Escherichia_phage	62.0	7.5e-202
WP_000904930.1|4358731_4359292_-	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	75.7	4.3e-75
WP_010917875.1|4359514_4359718_+|tail	tail fiber protein	tail	NA	NA	NA	NA
WP_000420351.1|4359797_4360319_+|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	52.6	2.1e-47
WP_024017776.1|4360353_4361265_-	hypothetical protein	NA	C9DGQ8	Escherichia_phage	43.1	1.1e-30
WP_000301579.1|4361264_4361825_-	YmfQ family protein	NA	C9DGQ7	Escherichia_phage	49.1	3.0e-44
WP_001146835.1|4361815_4362898_-|plate	baseplate J/gp47 family protein	plate	A0A0C4UQU9	Shigella_phage	53.2	1.1e-98
WP_000763330.1|4362897_4363335_-	phage GP46 family protein	NA	A0A0C4UR04	Shigella_phage	53.5	1.9e-38
WP_000980532.1|4363327_4363942_-|plate	phage baseplate assembly protein V	plate	A0A0C4UQZ3	Shigella_phage	51.0	4.7e-51
WP_000098808.1|4363931_4365056_-	hypothetical protein	NA	C9DGQ3	Escherichia_phage	48.5	7.7e-92
WP_000146118.1|4365039_4366389_-	DNA circularization protein	NA	C9DGQ2	Escherichia_phage	33.1	5.9e-54
WP_000113523.1|4366375_4368451_-	tape measure protein	NA	A0A0C4UQU8	Shigella_phage	37.7	3.7e-71
WP_000213225.1|4368577_4369054_-|tail	phage tail assembly protein	tail	A0A0C4UR03	Shigella_phage	50.8	1.0e-21
WP_000015473.1|4369068_4369434_-|tail	phage tail tube protein	tail	C9DGP8	Escherichia_phage	51.7	2.0e-25
WP_000606748.1|4369442_4370945_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	C9DGP7	Escherichia_phage	51.5	1.5e-138
WP_000848437.1|4370941_4371187_-	DUF2635 domain-containing protein	NA	C9DGP6	Escherichia_phage	54.5	2.8e-07
WP_044723556.1|4371187_4371748_-	DUF1834 family protein	NA	A0A0C4UQU7	Shigella_phage	47.7	3.6e-42
WP_001104959.1|4371744_4372164_-	gp436 family protein	NA	A0A0C4UR02	Shigella_phage	53.6	1.8e-33
WP_069358397.1|4372160_4372604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001142982.1|4372647_4373595_-|head	Mu-like prophage major head subunit gpT family protein	head	A0A0C4UQR9	Shigella_phage	67.2	1.2e-122
WP_000850816.1|4373594_4374719_-|protease	protease	protease	A0A0C4UQU6	Shigella_phage	47.6	2.9e-78
WP_000094813.1|4374895_4375369_-	phage virion morphogenesis protein	NA	A0A0C4UR01	Shigella_phage	53.9	6.0e-38
>prophage 19
NZ_CP012693	Escherichia coli strain FORC_028 chromosome, complete genome	5704396	4378393	4394929	5704396	transposase	Shigella_phage(46.67%)	29	NA	NA
WP_069358398.1|4378393_4380058_-	hypothetical protein	NA	A0A0C4UR29	Shigella_phage	73.2	2.4e-230
WP_000360581.1|4380057_4380639_-	DUF3486 family protein	NA	A0A0C4UQU5	Shigella_phage	57.0	1.9e-49
WP_001279079.1|4380641_4380932_-	hypothetical protein	NA	A0A0C4UR00	Shigella_phage	63.2	2.1e-25
WP_000270159.1|4380928_4381237_-	DUF2730 family protein	NA	NA	NA	NA	NA
WP_000342749.1|4381217_4381445_-	TraR/DksA family transcriptional regulator	NA	NA	NA	NA	NA
WP_001122255.1|4381455_4381674_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115801859.1|4381657_4382086_-	endopeptidase	NA	NA	NA	NA	NA
WP_001125304.1|4382120_4382621_-	lysozyme	NA	B6SD29	Bacteriophage	42.6	3.0e-27
WP_000852377.1|4382692_4383118_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001214359.1|4383187_4383697_-	gp16 family protein	NA	A0A0C4UQU3	Shigella_phage	41.9	2.0e-26
WP_000370523.1|4383693_4383990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001086882.1|4383979_4384177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000021231.1|4384169_4384502_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000595948.1|4384540_4384726_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000973021.1|4384722_4385274_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_069358403.1|4385277_4385793_-	hypothetical protein	NA	C9DGM0	Escherichia_phage	55.4	7.0e-48
WP_000564281.1|4385792_4386326_-	hypothetical protein	NA	A0A0C4UQU2	Shigella_phage	67.2	6.9e-67
WP_000323221.1|4386329_4386872_-	hypothetical protein	NA	A0A0C4UQZ6	Shigella_phage	40.0	2.9e-28
WP_069358399.1|4386969_4387500_-	host-nuclease inhibitor Gam family protein	NA	C9DGL8	Escherichia_phage	57.1	2.5e-48
WP_021499918.1|4387511_4387805_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000049432.1|4387809_4388082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000739863.1|4388078_4388360_-	hypothetical protein	NA	I6WB15	Burkholderia_virus	47.4	2.8e-11
WP_001057199.1|4388361_4388616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000268104.1|4388628_4388850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000129790.1|4388852_4389785_-	AAA family ATPase	NA	A0A0C4UQR3	Shigella_phage	48.3	1.2e-69
WP_069358404.1|4389855_4391946_-|transposase	Mu transposase C-terminal domain-containing protein	transposase	A0A2D1GNK9	Pseudomonas_phage	45.2	1.2e-165
WP_001310454.1|4391947_4392196_-	helix-turn-helix domain-containing protein	NA	A0A2D1GNH1	Pseudomonas_phage	73.2	1.3e-28
WP_000077537.1|4392386_4392917_+	hypothetical protein	NA	A0A2D1GNR8	Pseudomonas_phage	62.4	3.7e-36
WP_000830745.1|4393771_4394929_+	D-alanyl-D-alanine- carboxypeptidase/endopeptidase AmpH	NA	A0A2H4JAN9	uncultured_Caudovirales_phage	22.1	5.1e-06
>prophage 20
NZ_CP012693	Escherichia coli strain FORC_028 chromosome, complete genome	5704396	4968256	5031768	5704396	transposase,integrase,tRNA	Stx2-converting_phage(46.15%)	59	4990816:4990831	5022950:5022965
WP_000099160.1|4968256_4969795_-|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.8	3.9e-296
WP_000612626.1|4969843_4970191_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000839170.1|4970187_4970592_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	99.3	2.5e-69
WP_000235215.1|4971041_4971248_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_069358409.1|4972197_4972875_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|4972874_4973222_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381395.1|4973241_4974813_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_001185332.1|4975122_4975395_-	ogr/Delta-like zinc finger family protein	NA	A0A2I8TV89	Erwinia_phage	46.9	8.3e-08
WP_000991130.1|4975396_4975951_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000214377.1|4975947_4976700_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001084853.1|4977614_4977875_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	67.5	4.6e-24
WP_000761643.1|4977871_4978420_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	64.8	5.9e-29
WP_001014979.1|4978419_4978644_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000842358.1|4978640_4978964_+	DUF5375 family protein	NA	NA	NA	NA	NA
WP_000016235.1|4978978_4981312_+	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	72.8	0.0e+00
WP_000594911.1|4982217_4983042_+	hypothetical protein	NA	L7TR00	Rhizobium_phage	35.5	3.0e-16
WP_000227281.1|4983090_4983663_-	hypothetical protein	NA	Q858R9	Enterobacteria_phage	69.0	2.2e-71
WP_000177060.1|4985016_4985274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000175457.1|4985831_4986599_-	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
WP_000684856.1|4986599_4987556_-	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
WP_000125183.1|4987552_4988551_-	iron-dicitrate ABC transporter permease FecC	NA	NA	NA	NA	NA
WP_000879164.1|4988547_4989450_-	Fe(3+) dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
WP_000188267.1|4989494_4991819_-	Fe(3+) dicitrate transport protein FecA	NA	NA	NA	NA	NA
4990816:4990831	attL	TGCAGCAGGCTGTTGA	NA	NA	NA	NA
WP_001068910.1|4991905_4992859_-	fec operon regulator FecR	NA	NA	NA	NA	NA
WP_001283626.1|4992855_4993377_-	RNA polymerase sigma factor FecI	NA	NA	NA	NA	NA
WP_000555341.1|4995127_4995385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000823243.1|4996117_4997476_+	esterase-like activity of phytase family protein	NA	NA	NA	NA	NA
WP_000998019.1|4997714_4999100_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	89.3	3.4e-259
WP_000612591.1|4999149_4999497_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171523.1|4999493_4999874_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_001221615.1|5000228_5000663_-	zinc-ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_000271003.1|5000650_5001052_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000221529.1|5001217_5001787_-	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_000381395.1|5002526_5004098_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|5004117_5004465_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_069358410.1|5004464_5005142_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000091133.1|5005431_5007018_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032362510.1|5007156_5007990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000772685.1|5008233_5009496_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	40.3	2.8e-74
WP_000061768.1|5009939_5010959_+	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.4	1.9e-44
WP_001332879.1|5011088_5012591_+	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.8	2.1e-84
WP_001295681.1|5012709_5013792_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_000584109.1|5013791_5014892_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_000397144.1|5015158_5016670_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
WP_000786398.1|5017023_5017467_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000416407.1|5017466_5020322_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.3e-140
WP_001059398.1|5021764_5022268_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000002953.1|5022313_5022730_-	ribonuclease E inhibitor RraB	NA	NA	NA	NA	NA
WP_000012897.1|5022891_5023905_+	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
5022950:5022965	attR	TCAACAGCCTGCTGCA	NA	NA	NA	NA
WP_001074121.1|5024089_5025601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000583470.1|5025723_5026176_-	toxin-antitoxin biofilm protein TabA	NA	NA	NA	NA	NA
WP_000256681.1|5026320_5026914_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000500687.1|5026984_5027698_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000230273.1|5027828_5028224_+	RidA family protein	NA	NA	NA	NA	NA
WP_001296693.1|5028504_5028639_+	pyr operon leader peptide	NA	NA	NA	NA	NA
WP_000013046.1|5028642_5029578_+	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	2.9e-52
WP_000148581.1|5029590_5030052_+	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000047539.1|5030124_5030511_+	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_000399648.1|5030787_5031768_+|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
>prophage 21
NZ_CP012693	Escherichia coli strain FORC_028 chromosome, complete genome	5704396	5091083	5149378	5704396	tRNA,integrase,transposase,protease	Vibrio_phage(15.38%)	57	5116586:5116600	5148647:5148661
WP_000811566.1|5091083_5091359_+|protease	protease activator YjfN	protease	NA	NA	NA	NA
WP_001299838.1|5091475_5093101_-	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000943991.1|5093184_5094348_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.8	4.9e-81
WP_000101670.1|5094350_5094989_-	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_000547760.1|5094998_5095397_-	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_000012553.1|5095414_5096074_-	YjfK family protein	NA	NA	NA	NA	NA
WP_000511955.1|5096124_5096823_-	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_000220137.1|5096841_5097243_-	DUF2170 family protein	NA	NA	NA	NA	NA
WP_001293282.1|5097369_5098101_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000076316.1|5098280_5100722_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	6.4e-67
WP_001177639.1|5100760_5101186_-	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000527955.1|5101390_5102689_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001089295.1|5102792_5102990_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_001232412.1|5103071_5104076_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_000312488.1|5104078_5105338_-|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_000460361.1|5105423_5106704_-	GTPase HflX	NA	NA	NA	NA	NA
WP_001051883.1|5106780_5107089_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_001280349.1|5107174_5108125_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001122520.1|5108117_5109965_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	5.8e-60
WP_000990321.1|5109974_5111312_-	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
WP_000981977.1|5111330_5111792_-|tRNA	tRNA (N6-adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase TsaE	tRNA	NA	NA	NA	NA
WP_001307537.1|5111763_5113311_-	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_001294203.1|5113309_5114449_+|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_100699686.1|5114431_5114485_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295188.1|5115348_5115894_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
WP_000041970.1|5115988_5117041_+	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
5116586:5116600	attL	CCGCTGGAAGAGGCG	NA	NA	NA	NA
WP_000934920.1|5117137_5118106_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_001236850.1|5118127_5121451_+	miniconductance mechanosensitive channel MscM	NA	NA	NA	NA	NA
WP_001276180.1|5121479_5121794_-	YjeO family protein	NA	NA	NA	NA	NA
WP_000342867.1|5121790_5122105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001346081.1|5122156_5123659_-	glutamate/gamma-aminobutyrate family transporter YjeM	NA	NA	NA	NA	NA
WP_000004771.1|5123877_5124855_-	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	6.8e-28
WP_001192991.1|5125179_5126988_+	fumarate reductase (quinol) flavoprotein subunit	NA	NA	NA	NA	NA
WP_000829498.1|5126980_5127715_+	fumarate reductase iron-sulfur protein	NA	NA	NA	NA	NA
WP_000208757.1|5127725_5128121_+	fumarate reductase subunit FrdC	NA	NA	NA	NA	NA
WP_001299198.1|5128131_5128491_+	fumarate reductase subunit FrdD	NA	NA	NA	NA	NA
WP_001299193.1|5128553_5129687_+	BlaEC family class C beta-lactamase	NA	NA	NA	NA	NA
WP_001238378.1|5129775_5130309_+	lipocalin Blc	NA	A0A1W6JNX6	Morganella_phage	55.0	2.7e-47
WP_000118482.1|5130305_5130623_-	quaternary ammonium compound efflux SMR transporter SugE	NA	NA	NA	NA	NA
WP_000239596.1|5130804_5130951_-	lipoprotein toxin entericidin B	NA	NA	NA	NA	NA
WP_000977757.1|5131061_5131187_-	lipoprotein antitoxin entericidin A	NA	NA	NA	NA	NA
WP_000257278.1|5131238_5131805_-	elongation factor P	NA	NA	NA	NA	NA
WP_000940530.1|5131846_5132875_+	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_001008073.1|5133264_5134134_+	YjeJ family protein	NA	NA	NA	NA	NA
WP_000399685.1|5134382_5135363_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000558209.1|5135615_5135969_-	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
WP_000729117.1|5136106_5137753_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
WP_001026276.1|5137796_5138090_-	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
WP_000015837.1|5138365_5139622_+	L-methionine/branched-chain amino acid transporter	NA	NA	NA	NA	NA
WP_001267448.1|5139637_5140114_-	membrane protein FxsA	NA	NA	NA	NA	NA
WP_000069437.1|5140450_5141887_+	aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_000961959.1|5142004_5143306_+	anaerobic C4-dicarboxylate transporter DcuA	NA	NA	NA	NA	NA
WP_000883338.1|5143421_5143760_+	divalent cation tolerance protein CutA	NA	NA	NA	NA	NA
WP_000068905.1|5143735_5145433_+	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_001188520.1|5145469_5146045_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_001218841.1|5146424_5147690_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.3	2.7e-77
WP_032325301.1|5147806_5149378_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	98.4	2.2e-294
5148647:5148661	attR	CGCCTCTTCCAGCGG	NA	NA	NA	NA
