The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP015250	Bacillus thuringiensis Bt18247, complete genome	5610045	235078	301107	5610045	tRNA,transposase,protease	Bacillus_phage(17.65%)	41	NA	NA
WP_064531738.1|235078_235651_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_000583418.1|235744_236104_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_002094231.1|236260_237211_+	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
WP_069354767.1|237328_238498_+	alanine racemase	NA	NA	NA	NA	NA
WP_000004570.1|238806_239094_+	antitoxin EndoAI	NA	NA	NA	NA	NA
WP_000635965.1|239098_239449_+	type II toxin-antitoxin system endoribonuclease NdoA	NA	A0A2P0ZKX3	Lactobacillus_phage	37.7	1.7e-13
WP_000426207.1|239517_241686_+	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_001143640.1|241743_241860_-	cortex morphogenetic protein CmpA	NA	NA	NA	NA	NA
WP_069354768.1|242055_242514_+	SprT family protein	NA	NA	NA	NA	NA
WP_069354769.1|249010_249484_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_069354770.1|249464_250157_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_000367207.1|250171_250615_+	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_065229655.1|250614_251631_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	43.1	5.4e-68
WP_069354771.1|252112_254101_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	30.3	5.1e-54
WP_069354772.1|254233_254863_+	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_001246204.1|254892_255084_-	YdiK family protein	NA	NA	NA	NA	NA
WP_053565405.1|255080_255830_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000917311.1|256221_256506_+	co-chaperone GroES	NA	A0A221S3C8	uncultured_virus	54.8	1.2e-20
WP_001029992.1|256544_258179_+	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	57.8	1.3e-156
WP_069354773.1|258740_259970_+	WXG100 family type VII secretion target	NA	A0A2H4J389	uncultured_Caudovirales_phage	58.9	2.6e-64
WP_000481695.1|259990_260449_+	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_000743908.1|261115_262654_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	31.7	8.8e-22
WP_000833094.1|263039_264365_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	29.5	7.1e-44
WP_000929891.1|264510_265212_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.9	7.3e-40
WP_016513331.1|265195_266701_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	30.8	5.4e-32
WP_000821101.1|272012_272972_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_069354774.1|273171_273903_+	DsbA family oxidoreductase	NA	NA	NA	NA	NA
WP_069354776.1|280380_281133_-	AAA family ATPase	NA	A0A059NT77	Lactococcus_phage	46.9	7.8e-56
WP_069354777.1|281122_282418_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	27.1	1.9e-09
WP_069354779.1|282989_284363_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_069356602.1|284480_285440_+	proline dehydrogenase	NA	NA	NA	NA	NA
WP_069354780.1|291464_292541_-	glycosyl transferase	NA	NA	NA	NA	NA
WP_000551407.1|292774_293647_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000405127.1|293674_294397_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_053565457.1|294612_295407_-	RNA methyltransferase	NA	A0A288WG17	Bacillus_phage	51.2	8.8e-66
WP_069354781.1|295700_296606_+	NAD-dependent epimerase/dehydratase family protein	NA	L7RCI0	Acanthamoeba_polyphaga_moumouvirus	31.0	4.5e-26
WP_069354782.1|296692_297988_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	27.5	3.5e-11
WP_069354783.1|297977_298730_+	AAA family ATPase	NA	A0A059NT77	Lactococcus_phage	46.5	3.5e-56
WP_053565455.1|298874_299651_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_069354784.1|299983_300253_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_157452918.1|300207_301107_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	37.3	7.2e-24
>prophage 2
NZ_CP015250	Bacillus thuringiensis Bt18247, complete genome	5610045	349999	485929	5610045	holin,tRNA,terminase,transposase,plate,coat,capsid,protease,tail,head,portal,integrase	Bacillus_phage(77.42%)	151	347355:347373	471242:471260
347355:347373	attL	AAAAATAATAAAGGAATGA	NA	NA	NA	NA
WP_000086999.1|349999_350290_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_000051441.1|350305_351763_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_001047685.1|351777_353205_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_000977679.1|353709_354615_+	diacylglycerol kinase	NA	A0A1V0SBJ0	Catovirus	30.8	4.1e-27
WP_064532115.1|354755_355499_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_047792105.1|355578_357018_+	4-aminobutyrate--2-oxoglutarate transaminase	NA	NA	NA	NA	NA
WP_053565389.1|357133_358501_+	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_069354794.1|358493_359945_+	NADP-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000263262.1|359992_360316_+	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_064532119.1|360448_360940_+	DUF4352 domain-containing protein	NA	NA	NA	NA	NA
WP_000007372.1|360985_362215_-	aminopeptidase	NA	NA	NA	NA	NA
WP_064532121.1|362331_363414_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_069354795.1|364101_365169_-|integrase	site-specific integrase	integrase	H0UST3	Bacillus_phage	76.9	5.0e-157
WP_069354796.1|365957_367220_+	transcriptional regulator	NA	W8CYT9	Bacillus_phage	79.9	6.5e-188
WP_030022621.1|367578_367926_-	helix-turn-helix transcriptional regulator	NA	I7J6V3	Bacillus_phage	92.0	7.0e-52
WP_065484921.1|368072_368309_+	helix-turn-helix transcriptional regulator	NA	W8CYU0	Bacillus_phage	92.2	1.3e-33
WP_023523419.1|368341_368530_+	helix-turn-helix transcriptional regulator	NA	W8CYN7	Bacillus_phage	90.3	5.7e-24
WP_069354797.1|369036_369339_+	hypothetical protein	NA	A0A0S2GLB6	Bacillus_phage	60.8	1.1e-24
WP_069354798.1|369637_370456_+	replication protein	NA	A0A1P8VVR3	Streptococcus_phage	45.7	6.8e-21
WP_069354799.1|370406_371270_+	ATP-binding protein	NA	A0A1B0T6C3	Bacillus_phage	63.3	5.6e-90
WP_069354800.1|371283_371571_+	hypothetical protein	NA	A0A1B1P7W1	Bacillus_phage	47.4	3.0e-16
WP_069354801.1|371567_371834_+	hypothetical protein	NA	A0A0S2GLK4	Bacillus_phage	61.4	3.1e-23
WP_069354802.1|371872_372040_+	DUF3954 domain-containing protein	NA	A0A0S2GLF5	Bacillus_phage	64.8	2.8e-14
WP_069354803.1|372073_372883_+	phage antirepressor KilAC domain-containing protein	NA	A0A2H4JAT4	uncultured_Caudovirales_phage	50.8	2.6e-73
WP_069354804.1|373012_373216_-	hypothetical protein	NA	A0A2H4J3A3	uncultured_Caudovirales_phage	67.3	6.4e-13
WP_127064183.1|373431_373545_+	DUF3983 domain-containing protein	NA	A0A1B0T6D3	Bacillus_phage	86.5	9.9e-08
WP_069354805.1|373847_374333_+	ArpU family transcriptional regulator	NA	H0USV3	Bacillus_phage	93.2	5.9e-81
WP_065485748.1|374329_374872_+|integrase	site-specific integrase	integrase	A0A1B0T6D2	Bacillus_phage	93.9	3.5e-90
WP_069354806.1|375078_375303_+	hypothetical protein	NA	W8CYG8	Bacillus_phage	73.6	5.2e-24
WP_069354807.1|375584_376340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069354808.1|376893_377835_+	hypothetical protein	NA	A0A2I7SCF1	Paenibacillus_phage	57.6	7.7e-69
WP_069354809.1|377844_378216_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069354810.1|378366_378681_+	hypothetical protein	NA	A0A1B0T6C6	Bacillus_phage	78.8	5.6e-40
WP_069354811.1|378677_379070_+	HNH endonuclease	NA	A0A1B1P7N1	Bacillus_phage	96.2	6.2e-73
WP_069354812.1|379152_379578_+|terminase	P27 family phage terminase small subunit	terminase	A0A1B0T688	Bacillus_phage	88.6	1.2e-64
WP_069354813.1|379574_381299_+|terminase	terminase large subunit	terminase	A0A1B0T685	Bacillus_phage	90.4	2.2e-308
WP_069354814.1|381314_382499_+|portal	phage portal protein	portal	A0A1B0T684	Bacillus_phage	96.4	3.1e-216
WP_069354815.1|382488_383070_+|head,protease	HK97 family phage prohead protease	head,protease	A0A1B0T687	Bacillus_phage	94.2	7.3e-94
WP_069354816.1|383071_384370_+|capsid	phage major capsid protein	capsid	A0A1B0T682	Bacillus_phage	97.6	1.4e-182
WP_069354817.1|384438_384756_+	collagen-like protein	NA	NA	NA	NA	NA
WP_069354818.1|384770_385031_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1C8E967	Bacillus_phage	88.4	1.4e-36
WP_069354819.1|385008_385341_+	hypothetical protein	NA	A0A1C8E986	Bacillus_phage	93.5	5.7e-51
WP_069354820.1|385330_385660_+	hypothetical protein	NA	A0A1B1P7P2	Bacillus_phage	96.3	2.2e-55
WP_069354821.1|385659_386037_+	HK97 gp10 family phage protein	NA	A0A1C8E995	Bacillus_phage	96.0	6.2e-62
WP_069354822.1|386048_386705_+|tail	phage tail protein	tail	A0A1B1P7Q4	Bacillus_phage	88.2	1.8e-104
WP_069354823.1|386716_387103_+	hypothetical protein	NA	A0A1C8E984	Bacillus_phage	96.1	1.5e-63
WP_015406517.1|387141_387330_+	hypothetical protein	NA	A0A1C8E979	Bacillus_phage	96.8	4.1e-30
WP_069354824.1|390871_391555_+|tail	phage tail protein	tail	A0A1B0T6A0	Bacillus_phage	96.0	1.4e-125
WP_069354825.1|391551_393894_+	endopeptidase	NA	A0A1B0T695	Bacillus_phage	94.5	0.0e+00
WP_069354826.1|395137_395419_+	hypothetical protein	NA	D2XR31	Bacillus_phage	75.3	1.3e-32
WP_069354827.1|395421_395625_+	hypothetical protein	NA	D2XR32	Bacillus_phage	62.1	1.7e-18
WP_069354828.1|395684_396725_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B1P878	Bacillus_phage	78.8	1.2e-160
WP_069354829.1|396706_396958_-	hypothetical protein	NA	A0A1B0T6A3	Bacillus_phage	92.3	4.2e-22
WP_069354830.1|398262_398493_-	helix-turn-helix domain-containing protein	NA	S5MBY6	Brevibacillus_phage	38.9	4.1e-08
WP_139362471.1|398735_398867_+	hypothetical protein	NA	W8CYT8	Bacillus_phage	90.7	3.2e-18
WP_069354831.1|398884_399205_+	hypothetical protein	NA	A0A0S2GLK1	Bacillus_phage	67.0	3.4e-37
WP_069354832.1|399216_400383_+	DNA translocase FtsK	NA	A0A0S2GLG9	Bacillus_phage	83.2	6.4e-190
WP_069354833.1|400372_400981_+	hypothetical protein	NA	A0A0S2GLL8	Bacillus_phage	87.1	1.3e-98
WP_069354834.1|400977_401859_-	cytosolic protein	NA	I7ILW0	Bacillus_phage	75.8	1.3e-110
WP_065486040.1|402227_402824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016083714.1|402870_404067_-	NupC family nucleoside transporter	NA	NA	NA	NA	NA
WP_069354835.1|404492_405872_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	46.3	4.2e-116
WP_069354836.1|405930_407055_-|integrase	site-specific integrase	integrase	A0A1B0T6A8	Bacillus_phage	98.7	4.0e-213
WP_069354837.1|407911_408475_-	DUF4352 domain-containing protein	NA	A0A0S2MVG4	Bacillus_phage	49.0	5.1e-36
WP_069354838.1|408609_408954_-	DUF4064 domain-containing protein	NA	A0A0S2MVJ2	Bacillus_phage	82.5	2.6e-43
WP_069354839.1|408973_409501_-	DUF4352 domain-containing protein	NA	A0A0S2MVG4	Bacillus_phage	95.4	1.6e-87
WP_069354840.1|409686_410040_-	helix-turn-helix transcriptional regulator	NA	A0A1B1P888	Bacillus_phage	46.4	2.6e-22
WP_084746330.1|410556_411684_+	hypothetical protein	NA	H0UST6	Bacillus_phage	52.1	2.4e-109
WP_069356603.1|411975_412158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001020466.1|412168_412516_-	helix-turn-helix transcriptional regulator	NA	S5MUA5	Brevibacillus_phage	39.4	1.3e-10
WP_069354842.1|412681_412954_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_069354843.1|412916_413642_+	Rha family transcriptional regulator	NA	A0A1B1P7T7	Bacillus_phage	80.2	6.9e-110
WP_069354844.1|413685_414036_+	helix-turn-helix domain-containing protein	NA	A0A1B0T6C2	Bacillus_phage	87.1	2.4e-52
WP_157452919.1|414032_414200_+	hypothetical protein	NA	A0A0U3B230	Bacillus_phage	79.6	6.0e-17
WP_069354845.1|414410_415280_+	chromosomal replication initiator DnaA	NA	A0A0U3TZZ4	Bacillus_phage	68.0	1.9e-98
WP_042595748.1|415294_416209_+	AAA family ATPase	NA	A0A0U3U1U1	Bacillus_phage	98.0	2.4e-168
WP_069354846.1|416221_416416_+	hypothetical protein	NA	A0A1B1P7U7	Bacillus_phage	92.2	8.7e-28
WP_069354847.1|416432_416711_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	59.3	2.5e-12
WP_069354848.1|416703_417063_+	cell division protein SepF	NA	A0A1B1P7A1	Bacillus_phage	52.5	3.2e-31
WP_000717826.1|417082_417250_+	DUF3954 domain-containing protein	NA	A0A1B0T6B8	Bacillus_phage	62.3	1.4e-13
WP_000109490.1|417275_417527_+	hypothetical protein	NA	A0A0K2CNP4	Brevibacillus_phage	42.2	4.9e-07
WP_069354849.1|417546_418002_+	nucleoside triphosphate pyrophosphohydrolase family protein	NA	A0A0U4IBD0	Bacillus_phage	49.5	1.9e-20
WP_069354850.1|418041_418230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069354851.1|418267_418600_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069354852.1|418811_419009_+	hypothetical protein	NA	A0A1B1P864	Bacillus_phage	81.5	5.9e-24
WP_016136473.1|419045_419243_+	hypothetical protein	NA	I7IDJ9	Bacillus_phage	96.9	3.6e-29
WP_016090449.1|419429_419612_+	hypothetical protein	NA	A0A0S2MVH2	Bacillus_phage	100.0	4.3e-29
WP_000130745.1|419641_419764_+	DUF3983 domain-containing protein	NA	NA	NA	NA	NA
WP_001013578.1|419784_419973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069354853.1|420210_421356_-|transposase	IS110 family transposase	transposase	Q9JMN8	Wolbachia_phage	28.5	1.7e-41
WP_069354855.1|421837_422320_+	ArpU family transcriptional regulator	NA	H0USV3	Bacillus_phage	82.5	1.2e-70
WP_069354856.1|422319_422862_+|integrase	site-specific integrase	integrase	W8CYP1	Bacillus_phage	91.1	8.6e-89
WP_069354857.1|423512_423731_+	cell division protein FtsK	NA	A0A1B1P7C1	Bacillus_phage	41.5	5.1e-08
WP_069354858.1|423771_424035_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069354859.1|424040_424370_+	HNH endonuclease	NA	A0A1B1P757	Bacillus_phage	51.0	4.6e-21
WP_069354860.1|424372_424681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069354861.1|424990_425491_+	RNA polymerase subunit sigma-70	NA	A0A1B1P762	Bacillus_phage	35.6	3.3e-10
WP_069354862.1|425474_427142_+|terminase	terminase large subunit	terminase	A0A1B1P766	Bacillus_phage	57.8	1.0e-180
WP_069354863.1|427160_428399_+|portal	phage portal protein	portal	A0A1B1P754	Bacillus_phage	39.8	1.8e-78
WP_069354864.1|428340_429048_+|protease	Clp protease ClpP	protease	D2XR17	Bacillus_phage	50.8	1.4e-43
WP_069354865.1|429064_430195_+|capsid	phage major capsid protein	capsid	A0A1B1P752	Bacillus_phage	51.0	1.3e-99
WP_069354866.1|430211_430535_+	hypothetical protein	NA	A0A1B1P751	Bacillus_phage	39.8	7.8e-13
WP_069354867.1|430524_430890_+|head,tail	phage head-tail adapter protein	head,tail	NA	NA	NA	NA
WP_069354868.1|430867_431248_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069354869.1|431237_431648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069354870.1|431649_432213_+|tail	phage tail protein	tail	Q8W5Z9	Listeria_phage	44.5	1.3e-39
WP_069354871.1|432287_432656_+	hypothetical protein	NA	A0A1S7FZ84	Listeria_phage	33.7	1.7e-08
WP_069354872.1|432838_436621_+|tail	phage tail tape measure protein	tail	A0A1C8E982	Bacillus_phage	58.6	9.9e-75
WP_069354873.1|436613_437300_+|tail	phage tail protein	tail	A0A2H4J851	uncultured_Caudovirales_phage	63.7	1.7e-81
WP_069354874.1|439536_439803_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_069354853.1|440002_441148_-|transposase	IS110 family transposase	transposase	Q9JMN8	Wolbachia_phage	28.5	1.7e-41
WP_069354875.1|441433_442993_+|plate	BppU family phage baseplate upper protein	plate	B5LPS6	Bacillus_virus	51.1	9.6e-125
WP_069354876.1|443005_443509_+	hypothetical protein	NA	A0A1B1P805	Bacillus_phage	67.1	1.1e-58
WP_069354853.1|443827_444973_-|transposase	IS110 family transposase	transposase	Q9JMN8	Wolbachia_phage	28.5	1.7e-41
WP_069354877.1|445319_446279_+|integrase	site-specific integrase	integrase	A0A0S2GLC8	Bacillus_phage	95.3	9.6e-176
WP_069354878.1|446294_446720_+|holin	phage holin family protein	holin	A0A1B1P787	Bacillus_phage	97.9	3.7e-71
WP_069354879.1|446719_447505_+	N-acetylmuramoyl-L-alanine amidase	NA	S5M842	Bacillus_phage	58.8	1.9e-76
WP_000566708.1|448069_449059_+|tRNA	tRNA-dihydrouridine synthase	tRNA	NA	NA	NA	NA
WP_064532123.1|449654_450683_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064532125.1|450737_451292_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_064532127.1|451641_452160_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	36.5	1.6e-20
WP_064532129.1|452255_452963_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_064532131.1|453163_453859_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064532133.1|453873_454983_-	dipeptide epimerase	NA	Q6A202	Oenococcus_phage	25.3	1.5e-18
WP_064532135.1|455076_456348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064532137.1|456336_457758_-	Na+/H+ antiporter NhaC	NA	NA	NA	NA	NA
WP_069354880.1|458054_459206_+	amidohydrolase	NA	NA	NA	NA	NA
WP_001005627.1|459364_459970_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_069354881.1|460006_461533_-	alkyl hydroperoxide reductase subunit F	NA	A0A1W6JNB4	Lactococcus_phage	30.8	4.1e-19
WP_000924420.1|461547_462111_-	peroxiredoxin	NA	NA	NA	NA	NA
WP_053565378.1|462702_463932_+	S-methyl-5-thioribose kinase	NA	NA	NA	NA	NA
WP_064532143.1|463941_464988_+	S-methyl-5-thioribose-1-phosphate isomerase	NA	NA	NA	NA	NA
WP_053565376.1|465041_465683_+	L-fuculose-phosphate aldolase	NA	NA	NA	NA	NA
WP_053565375.1|466111_467119_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_053565374.1|467115_468156_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_053565373.1|468204_469122_-	iron-hydroxamate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_064532145.1|469455_470505_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000235474.1|470701_471070_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000276022.1|471265_471496_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
471242:471260	attR	AAAAATAATAAAGGAATGA	NA	NA	NA	NA
WP_053565371.1|471731_472247_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053565370.1|472267_472717_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_053565369.1|472879_473548_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000434728.1|473786_475052_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069354786.1|476273_477386_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_000424116.1|478223_478604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053565367.1|478632_479265_-	cyclase family protein	NA	NA	NA	NA	NA
WP_069354883.1|479612_480722_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069354884.1|480833_481616_+	nucleotidyltransferase domain-containing protein	NA	Q8SCS5	Pseudomonas_phage	43.5	8.4e-45
WP_069354885.1|481629_482931_-	aromatic acid/H+ symport family MFS transporter	NA	NA	NA	NA	NA
WP_069354886.1|483074_484601_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_069354786.1|484816_485929_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP015250	Bacillus thuringiensis Bt18247, complete genome	5610045	786436	862861	5610045	holin,terminase,transposase,capsid,protease,tail,head,portal,integrase	Bacillus_phage(78.43%)	76	794997:795016	840758:840777
WP_069354786.1|786436_787549_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_000665754.1|789259_789601_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000964465.1|789622_789952_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000873271.1|789968_791123_-	MFS transporter	NA	NA	NA	NA	NA
WP_000645827.1|791348_792401_+	(R,R)-butanediol dehydrogenase	NA	E3SJ82	Synechococcus_phage	27.6	3.9e-21
WP_000948241.1|792519_792864_+	two pore domain potassium channel family protein	NA	NA	NA	NA	NA
WP_000730997.1|793117_793969_+	phospholipase C	NA	NA	NA	NA	NA
WP_069354969.1|794045_795020_+	sphingomyelin phosphodiesterase	NA	A0A1P8L6H7	Staphylococcus_phage	59.5	4.5e-88
794997:795016	attL	AATGATTACTCTGATCATTA	NA	NA	NA	NA
WP_069354970.1|795030_796131_-|integrase	site-specific integrase	integrase	A0A0S2GLI2	Bacillus_phage	97.0	2.2e-200
WP_069354971.1|796940_798161_+	hypothetical protein	NA	A0A0U3TNF6	Bacillus_phage	50.9	2.3e-113
WP_069354972.1|798563_798908_-	helix-turn-helix transcriptional regulator	NA	H0UST7	Bacillus_phage	41.5	4.7e-16
WP_000819158.1|799077_799284_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_069354973.1|799349_799538_+	helix-turn-helix transcriptional regulator	NA	W8CYN7	Bacillus_phage	91.9	3.3e-24
WP_069354974.1|799750_800545_+	antirepressor	NA	A0A0S2GLP8	Bacillus_phage	94.7	2.0e-134
WP_069354975.1|800707_801022_+	hypothetical protein	NA	A0A0S2GLB6	Bacillus_phage	96.2	2.7e-50
WP_069354777.1|801316_802612_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	27.1	1.9e-09
WP_069354776.1|802601_803354_+	AAA family ATPase	NA	A0A059NT77	Lactococcus_phage	46.9	7.8e-56
WP_060851838.1|803544_804192_+	sigma-70 family RNA polymerase sigma factor	NA	A0A0S2GLJ1	Bacillus_phage	96.7	3.5e-113
WP_069354976.1|804435_805440_+	DNA replication protein DnaD	NA	A0A0S2GLI6	Bacillus_phage	96.7	2.6e-184
WP_069354977.1|805402_806215_+	DNA replication protein	NA	A0A0S2GLK2	Bacillus_phage	98.9	7.4e-153
WP_000436951.1|806256_806523_+	hypothetical protein	NA	A0A0S2GLK4	Bacillus_phage	100.0	7.7e-43
WP_069354978.1|806594_806759_+	DUF3954 domain-containing protein	NA	A0A0S2GLF5	Bacillus_phage	94.4	7.1e-23
WP_069354979.1|807147_807390_+	hypothetical protein	NA	A0A0S2MV78	Bacillus_phage	71.2	3.8e-28
WP_069354980.1|807433_807769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069354981.1|808091_808694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069354983.1|809093_809492_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_069354984.1|810372_810654_+	hypothetical protein	NA	A0A0S2GLD3	Bacillus_phage	97.8	9.7e-44
WP_069354985.1|811017_811503_+	ArpU family transcriptional regulator	NA	H0USV3	Bacillus_phage	80.7	2.5e-71
WP_069354986.1|811499_812042_+|integrase	site-specific integrase	integrase	W8CYP1	Bacillus_phage	91.7	3.8e-89
WP_069354987.1|812244_812490_+	hypothetical protein	NA	W8CYG8	Bacillus_phage	96.3	5.8e-37
WP_030022649.1|814324_814537_+	hypothetical protein	NA	A0A0S2GM40	Bacillus_phage	94.3	3.3e-28
WP_084746338.1|814771_814981_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069354989.1|814970_815345_+	HNH endonuclease	NA	A0A2H4J3B4	uncultured_Caudovirales_phage	82.3	3.0e-56
WP_069354990.1|815663_816167_+|terminase	phage terminase small subunit P27 family	terminase	A0A0S2GLF2	Bacillus_phage	98.2	3.3e-87
WP_069354991.1|816168_817863_+|terminase	terminase large subunit	terminase	H0USW3	Bacillus_phage	98.2	0.0e+00
WP_069354992.1|818051_819305_+|portal	phage portal protein	portal	A0A0S2GLJ4	Bacillus_phage	98.8	3.2e-240
WP_069354993.1|819291_820002_+|protease	Clp protease ClpP	protease	H0USW5	Bacillus_phage	97.9	6.7e-126
WP_069354994.1|820039_821212_+|capsid	phage major capsid protein	capsid	H0USW6	Bacillus_phage	96.1	9.8e-207
WP_069354995.1|821232_821520_+|head,tail	phage gp6-like head-tail connector protein	head,tail	H0USW7	Bacillus_phage	86.2	5.6e-39
WP_069354996.1|821506_821830_+|head	phage head closure protein	head	W8CYF9	Bacillus_phage	96.3	1.4e-54
WP_000763224.1|821822_822260_+	HK97 gp10 family phage protein	NA	A0A0S2GLH3	Bacillus_phage	99.3	1.8e-76
WP_069354997.1|822256_822616_+	DUF3168 domain-containing protein	NA	W8CYY6	Bacillus_phage	98.3	2.9e-61
WP_000896770.1|822616_823225_+|tail	tail protein	tail	W8CYT6	Bacillus_phage	100.0	5.8e-102
WP_069354998.1|823274_823592_+	hypothetical protein	NA	A0A0S2GLH2	Bacillus_phage	93.3	2.1e-50
WP_069354786.1|827407_828520_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_069354999.1|828888_829239_+	hypothetical protein	NA	A0A288WG88	Bacillus_phage	78.4	1.9e-44
WP_084745960.1|829253_830735_+|tail	phage tail protein	tail	W8CYY9	Bacillus_phage	92.7	1.0e-277
WP_069355000.1|830731_834757_+	hypothetical protein	NA	H0USX5	Bacillus_phage	94.2	0.0e+00
WP_030026929.1|834882_835107_+	hypothetical protein	NA	A0A1B1P780	Bacillus_phage	95.9	7.0e-29
WP_069355001.1|835181_835607_+|holin	phage holin family protein	holin	A0A1B1P787	Bacillus_phage	98.6	3.7e-71
WP_000542505.1|835606_836425_+	N-acetylmuramoyl-L-alanine amidase	NA	D2XR33	Bacillus_phage	88.6	4.7e-147
WP_069355002.1|836483_836714_-	helix-turn-helix domain-containing protein	NA	S5MBY6	Brevibacillus_phage	40.3	1.1e-08
WP_069355003.1|837006_837420_+	hypothetical protein	NA	A0A1B1P7T3	Bacillus_phage	72.9	3.7e-52
WP_069355004.1|837432_837756_+	hypothetical protein	NA	A0A1B1P7T1	Bacillus_phage	75.0	2.6e-40
WP_069355005.1|837767_838934_+	DNA translocase FtsK	NA	W8CYG2	Bacillus_phage	90.7	2.5e-202
WP_069355006.1|838923_839532_+	hypothetical protein	NA	A0A0S2GLL8	Bacillus_phage	95.5	1.9e-108
WP_069355007.1|839536_840418_-	HTH domain-containing protein	NA	I7ILW0	Bacillus_phage	98.3	3.2e-157
WP_000373756.1|840915_842088_+	amino acid deaminase/aldolase	NA	NA	NA	NA	NA
840758:840777	attR	AATGATTACTCTGATCATTA	NA	NA	NA	NA
WP_064532063.1|842075_843392_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_000128025.1|843445_844597_-	VanZ family protein	NA	NA	NA	NA	NA
WP_001268332.1|844768_844972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053565233.1|845092_845380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000434794.1|845559_846372_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_000495032.1|846508_847450_-	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	32.4	7.3e-11
WP_053565232.1|847670_848942_+	cell wall-binding protein	NA	A0A0S2SXZ8	Bacillus_phage	64.7	5.4e-33
WP_000154019.1|849054_849273_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_053565231.1|849265_849739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069355008.1|849855_850488_+	class A sortase	NA	NA	NA	NA	NA
WP_069355009.1|851733_853119_-	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	32.7	4.9e-64
WP_069355010.1|853372_854674_+	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
WP_069355011.1|854815_856537_+	DUF2339 domain-containing protein	NA	NA	NA	NA	NA
WP_069355012.1|856572_858120_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_001164892.1|858300_859692_-	amino acid permease	NA	NA	NA	NA	NA
WP_069355013.1|859972_861265_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	31.4	4.5e-43
WP_000816201.1|861443_861707_+	MerR family transcriptional regulator	NA	Q331V0	Clostridium_botulinum_C_phage	32.0	3.8e-18
WP_063535666.1|861703_862861_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q331V1	Clostridium_botulinum_C_phage	60.9	3.2e-125
>prophage 4
NZ_CP015250	Bacillus thuringiensis Bt18247, complete genome	5610045	1154778	1253962	5610045	holin,terminase,transposase,capsid,protease,tail,head,portal,integrase	Bacillus_phage(55.56%)	103	1150965:1150986	1225278:1225299
1150965:1150986	attL	CTGATTAAAGTTTCACTTTATT	NA	NA	NA	NA
WP_157452921.1|1154778_1155678_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	37.3	1.5e-24
WP_069354784.1|1155632_1155902_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_000991356.1|1155979_1156231_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065228404.1|1156644_1157175_+	general stress protein	NA	NA	NA	NA	NA
WP_000635853.1|1157314_1157518_+	DUF4028 domain-containing protein	NA	NA	NA	NA	NA
WP_000637511.1|1157660_1157972_+	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_069355110.1|1158566_1158872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080497259.1|1158989_1159985_-	zinc-dependent alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_069355112.1|1160157_1161144_+	choloylglycine hydrolase family protein	NA	M1HS66	Paramecium_bursaria_Chlorella_virus	28.9	3.5e-32
WP_000273536.1|1161265_1161406_-	YflJ family protein	NA	G3MBD1	Bacillus_virus	63.4	6.1e-07
WP_069355113.1|1161560_1161923_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000539552.1|1161949_1162135_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069355114.1|1162343_1163585_+	DNA repair exonuclease	NA	NA	NA	NA	NA
WP_069355115.1|1163581_1166506_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_069355116.1|1166547_1167504_+	3'-5' exoribonuclease YhaM	NA	NA	NA	NA	NA
WP_069355117.1|1167523_1168681_-|integrase	site-specific integrase	integrase	A0A0M5M609	Bacillus_phage	88.8	9.4e-202
WP_069355118.1|1168739_1169165_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A1C8E988	Bacillus_phage	97.9	5.0e-76
WP_000102963.1|1169180_1169603_-	helix-turn-helix transcriptional regulator	NA	A0A0M4QX29	Bacillus_phage	75.0	2.2e-52
WP_069355119.1|1169872_1170055_+	helix-turn-helix transcriptional regulator	NA	A0A1C8E998	Bacillus_phage	85.0	2.0e-21
WP_000127561.1|1170057_1170330_+	DUF771 domain-containing protein	NA	A0A1C8E9B3	Bacillus_phage	98.9	2.0e-46
WP_069355120.1|1170514_1171267_+	antirepressor	NA	A0A2H4JBC7	uncultured_Caudovirales_phage	81.0	4.8e-106
WP_001186272.1|1171278_1171467_+	hypothetical protein	NA	A0A2H4J4V8	uncultured_Caudovirales_phage	96.8	6.1e-26
WP_069355121.1|1171493_1171928_+	replication terminator protein	NA	A0A0S2MVA8	Bacillus_phage	99.3	1.4e-73
WP_000178946.1|1171945_1172659_+	hypothetical protein	NA	A0A0S2MV99	Bacillus_phage	99.6	1.9e-128
WP_038413184.1|1172658_1172874_+	hypothetical protein	NA	A0A1C8E9A6	Bacillus_phage	94.4	3.6e-30
WP_069355122.1|1172806_1173145_+	hypothetical protein	NA	A0A0S2MVH7	Bacillus_phage	96.4	6.4e-50
WP_069355123.1|1173238_1174174_+	DnaD domain protein	NA	A0A0S2MVA0	Bacillus_phage	84.9	9.4e-144
WP_069355124.1|1174185_1174665_+	hypothetical protein	NA	A0A0S2MV74	Bacillus_phage	93.1	1.7e-80
WP_065485659.1|1174657_1174888_+	hypothetical protein	NA	A0A1C8E9C2	Bacillus_phage	98.7	1.3e-33
WP_069355125.1|1175503_1175938_+	hypothetical protein	NA	A0A2H4JBD8	uncultured_Caudovirales_phage	94.4	1.5e-75
WP_065485656.1|1176062_1176599_+	dUTPase	NA	A0A2H4J4W9	uncultured_Caudovirales_phage	91.0	4.5e-90
WP_069355126.1|1176778_1177249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065485654.1|1178576_1178789_+	hypothetical protein	NA	D2XR53	Bacillus_phage	57.5	2.4e-15
WP_113732895.1|1179093_1179207_+	DUF3983 domain-containing protein	NA	A0A1B0T6D3	Bacillus_phage	77.8	4.2e-06
WP_069355127.1|1179497_1179974_+	ArpU family transcriptional regulator	NA	H0USV3	Bacillus_phage	91.2	9.2e-71
WP_069354777.1|1180028_1181324_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	27.1	1.9e-09
WP_069354776.1|1181313_1182066_+	AAA family ATPase	NA	A0A059NT77	Lactococcus_phage	46.9	7.8e-56
WP_069355128.1|1182173_1182455_+|integrase	tyrosine-type recombinase/integrase	integrase	W8CYP1	Bacillus_phage	87.0	3.9e-37
WP_065485648.1|1182914_1183133_+	hypothetical protein	NA	H0USV5	Bacillus_phage	66.2	5.2e-21
WP_069356614.1|1183525_1184023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000377847.1|1185483_1185759_+	hypothetical protein	NA	H0USV6	Bacillus_phage	53.8	4.0e-18
WP_069355129.1|1186558_1186867_+	hypothetical protein	NA	A0A288WFY9	Bacillus_phage	45.5	7.2e-16
WP_065485642.1|1186882_1187218_+	alpha/beta hydrolase	NA	D2XR61	Bacillus_phage	89.2	6.8e-52
WP_069355130.1|1187339_1187651_+|terminase	terminase	terminase	D2XR14	Bacillus_phage	86.3	4.7e-39
WP_069355131.1|1187647_1189315_+|terminase	terminase large subunit	terminase	D2XR15	Bacillus_phage	92.4	3.7e-308
WP_069355132.1|1189326_1190487_+|portal	phage portal protein	portal	D2XR16	Bacillus_phage	82.5	1.1e-173
WP_069355133.1|1190470_1191253_+|protease	Clp protease ClpP	protease	A0A0A7RWX3	Clostridium_phage	58.6	5.1e-58
WP_069355134.1|1191256_1192411_+|capsid	phage major capsid protein	capsid	A0A2H4JHU0	uncultured_Caudovirales_phage	92.2	2.7e-201
WP_069355135.1|1192416_1192710_+	hypothetical protein	NA	D2XR19	Bacillus_phage	90.7	1.0e-43
WP_069355136.1|1192711_1193065_+|head	phage head closure protein	head	A0A2H4JGG7	uncultured_Caudovirales_phage	93.1	1.3e-56
WP_069355137.1|1193066_1193411_+	HK97 gp10 family phage protein	NA	D2XR21	Bacillus_phage	94.6	2.8e-53
WP_069355138.1|1193407_1193737_+	hypothetical protein	NA	D2XR22	Bacillus_phage	90.8	1.1e-51
WP_069355139.1|1193737_1194331_+|tail	phage tail protein	tail	A0A2H4JDV4	uncultured_Caudovirales_phage	91.3	2.2e-101
WP_000415935.1|1194337_1194694_+	hypothetical protein	NA	A0A2H4JAG8	uncultured_Caudovirales_phage	70.8	5.7e-41
WP_069355140.1|1194924_1196157_+	hypothetical protein	NA	A0A2H4JAI2	uncultured_Caudovirales_phage	85.6	5.9e-186
WP_069356615.1|1196434_1198828_+	hypothetical protein	NA	A0A2H4JC82	uncultured_Caudovirales_phage	40.5	1.3e-35
WP_069355141.1|1198864_1200337_+|tail	phage tail protein	tail	D2XPZ5	Bacillus_virus	71.5	7.7e-217
WP_069355142.1|1200333_1206036_+	peptidase S74	NA	D2XR28	Bacillus_phage	44.7	0.0e+00
WP_069355143.1|1206075_1206501_+|holin	phage holin family protein	holin	A0A0S2MVC4	Bacillus_phage	96.5	7.0e-70
WP_069355144.1|1206500_1207436_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A0S2MVR5	Bacillus_phage	80.1	8.8e-150
WP_069355145.1|1207573_1208296_-	geobacillin-26 family protein	NA	NA	NA	NA	NA
WP_084746347.1|1210343_1212023_-	S8 family serine peptidase	NA	A0A1B0T6A2	Bacillus_phage	33.9	9.3e-49
WP_069356616.1|1212114_1212948_-	cytosolic protein	NA	A0A2H4J6G7	uncultured_Caudovirales_phage	82.3	2.6e-121
WP_069355149.1|1213608_1213941_+	DUF1904 family protein	NA	NA	NA	NA	NA
WP_069354786.1|1214810_1215923_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_069355150.1|1216026_1216605_-	LysE family translocator	NA	NA	NA	NA	NA
WP_069355151.1|1217444_1218389_+	ring-cleaving dioxygenase	NA	NA	NA	NA	NA
WP_001072581.1|1218433_1219411_+	ring-cleaving dioxygenase	NA	NA	NA	NA	NA
WP_069355152.1|1219687_1220785_+	histidine kinase	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	49.2	2.9e-91
WP_000723609.1|1220785_1220989_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069355153.1|1221230_1222103_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000449223.1|1222181_1222382_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000554479.1|1222596_1223448_+	DUF2935 domain-containing protein	NA	G5CQX5	Megavirus	26.2	1.5e-07
WP_069355154.1|1223903_1225100_+	oxalate decarboxylase family bicupin	NA	NA	NA	NA	NA
WP_069355155.1|1225483_1225933_+	helix-turn-helix transcriptional regulator	NA	X2CXD8	Lactobacillus_phage	34.9	7.5e-06
1225278:1225299	attR	CTGATTAAAGTTTCACTTTATT	NA	NA	NA	NA
WP_000394286.1|1226030_1226591_+	glycerol uptake operon antiterminator GlpP	NA	NA	NA	NA	NA
WP_001272200.1|1226819_1227641_+	glycerol uptake facilitator protein GlpF	NA	M1H4F4	Acanthocystis_turfacea_Chlorella_virus	36.7	5.2e-29
WP_000760011.1|1227654_1229145_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_029442064.1|1229278_1230961_+	aerobic glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_069355156.1|1231518_1232586_-	hypothetical protein	NA	NA	NA	NA	NA
WP_084746010.1|1233228_1233801_+	DUF4258 domain-containing protein	NA	NA	NA	NA	NA
WP_069355158.1|1233819_1234230_+	DUF2283 domain-containing protein	NA	NA	NA	NA	NA
WP_069355159.1|1234972_1235506_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_069355160.1|1235510_1235918_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_069355161.1|1235925_1237179_+	FtsW/RodA/SpoVE family cell cycle protein	NA	NA	NA	NA	NA
WP_069354786.1|1237364_1238477_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_053565080.1|1238859_1239423_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069355162.1|1239509_1241840_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_069355163.1|1242117_1242363_+	cytoplasmic protein	NA	NA	NA	NA	NA
WP_064532786.1|1242566_1243439_-	peptidylprolyl isomerase PrsA	NA	NA	NA	NA	NA
WP_000172690.1|1243882_1244077_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069355164.1|1244192_1244528_+	DUF1878 family protein	NA	NA	NA	NA	NA
WP_000834924.1|1244533_1245091_-	HTH-type transcriptional regulator Hpr	NA	NA	NA	NA	NA
WP_000030302.1|1245389_1245752_-	general stress protein	NA	NA	NA	NA	NA
WP_001016835.1|1245933_1246368_-	HIT family protein	NA	X4YH05	Lactococcus_phage	30.5	1.6e-05
WP_053565078.1|1246930_1247674_+	ABC transporter ATP-binding protein EcsA	NA	A0A2H4PQG7	Staphylococcus_phage	29.3	8.3e-26
WP_069355165.1|1247666_1248878_+	ABC transporter permease EcsB	NA	NA	NA	NA	NA
WP_069355166.1|1248891_1249599_+	ecs operon protein EcsC	NA	NA	NA	NA	NA
WP_069355167.1|1249710_1250028_-	DUF1433 domain-containing protein	NA	NA	NA	NA	NA
WP_000902681.1|1250138_1250453_-	DUF1433 domain-containing protein	NA	NA	NA	NA	NA
WP_001996881.1|1250991_1251240_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063546722.1|1251380_1252634_+	DUF2974 domain-containing protein	NA	NA	NA	NA	NA
WP_069354786.1|1252849_1253962_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP015250	Bacillus thuringiensis Bt18247, complete genome	5610045	1422059	1540870	5610045	bacteriocin,transposase,coat,protease,integrase	Bacillus_phage(36.0%)	114	1476792:1476851	1539640:1541225
WP_069355219.1|1422059_1422530_-|coat	spore coat protein CotY	coat	NA	NA	NA	NA
WP_053565002.1|1422672_1424739_-	ATP-dependent helicase	NA	A0A068EQC7	Bacillus_phage	31.9	6.2e-79
WP_000543305.1|1424838_1425261_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000765871.1|1425262_1425781_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053565000.1|1425874_1426606_-	esterase family protein	NA	NA	NA	NA	NA
WP_069355220.1|1426810_1427722_+	DMT family transporter	NA	NA	NA	NA	NA
WP_069355221.1|1428214_1428613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053564997.1|1428768_1430247_-	sodium/proline symporter PutP	NA	NA	NA	NA	NA
WP_069355222.1|1431277_1432696_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_065482727.1|1432692_1433280_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	47.9	1.8e-47
WP_053564994.1|1433276_1434302_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	34.5	1.3e-50
WP_069355223.1|1434303_1435065_+	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	40.6	2.4e-36
WP_069355224.1|1435061_1435676_+	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_069355225.1|1435672_1436866_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_069355226.1|1436869_1437646_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000946150.1|1437719_1438079_+	DUF4029 domain-containing protein	NA	NA	NA	NA	NA
WP_064532940.1|1438193_1439693_+	lactate permease	NA	NA	NA	NA	NA
WP_064532942.1|1439783_1440467_+	YukJ family protein	NA	NA	NA	NA	NA
WP_000424522.1|1440481_1441315_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069355227.1|1441511_1442297_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_069355228.1|1442316_1443552_+	YARHG domain-containing protein	NA	NA	NA	NA	NA
WP_065482744.1|1443590_1444019_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001110229.1|1444219_1445554_+	CoA-disulfide reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.0	4.4e-17
WP_064532952.1|1445654_1446143_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000996808.1|1446439_1446850_+	DUF3908 domain-containing protein	NA	NA	NA	NA	NA
WP_064532956.1|1447561_1449103_-	SagB/ThcOx family dehydrogenase	NA	NA	NA	NA	NA
WP_064532958.1|1449118_1451068_-	TOMM precursor leader peptide-binding protein	NA	NA	NA	NA	NA
WP_064532960.1|1451064_1452984_-|bacteriocin	putative thiazole-containing bacteriocin maturation protein	bacteriocin	NA	NA	NA	NA
WP_000569893.1|1453107_1454367_-	2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase	NA	NA	NA	NA	NA
WP_069355229.1|1454500_1457368_-	2-oxoglutarate dehydrogenase E1 component	NA	NA	NA	NA	NA
WP_069355230.1|1458191_1458401_+	helix-turn-helix transcriptional regulator	NA	S5M643	Brevibacillus_phage	39.3	2.3e-05
WP_048564894.1|1458403_1458781_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001178303.1|1458809_1458992_+	DUF3976 domain-containing protein	NA	NA	NA	NA	NA
WP_069355231.1|1459125_1459488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001169495.1|1459912_1460509_+	DUF4878 domain-containing protein	NA	NA	NA	NA	NA
WP_000834471.1|1461194_1461356_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000054715.1|1461388_1462288_+	ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	26.5	1.8e-14
WP_069355233.1|1462280_1463522_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_069355234.1|1464238_1464505_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_069355235.1|1464523_1465144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069355236.1|1465144_1465450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069355237.1|1465485_1465704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069355238.1|1465720_1466110_+	adenylate kinase	NA	NA	NA	NA	NA
WP_083594897.1|1466641_1467193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069355240.1|1467982_1468816_+	hypothetical protein	NA	NA	NA	NA	NA
WP_084746025.1|1468794_1469211_+	DUF4263 domain-containing protein	NA	NA	NA	NA	NA
WP_083594900.1|1469382_1471269_+	AAA family ATPase	NA	E5E3R2	Burkholderia_phage	22.7	3.0e-11
WP_069354784.1|1471555_1471825_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_157452921.1|1471779_1472679_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	37.3	1.5e-24
WP_071720110.1|1473078_1473327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069355243.1|1473420_1473777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069355244.1|1473954_1474224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157452921.1|1475167_1476067_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	37.3	1.5e-24
WP_069354784.1|1476021_1476291_-|transposase	transposase	transposase	NA	NA	NA	NA
1476792:1476851	attL	AAAGAGATAATATGAAGTGCCCCCCTAGATTATCAAGTCAGGGATTTTAACCCATAATAA	NA	NA	NA	NA
WP_069354786.1|1476909_1478022_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_069355247.1|1478876_1479107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069355248.1|1479361_1479595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069355249.1|1479913_1481179_-	DEAD/DEAH box helicase family protein	NA	A0A1P8CWT6	Bacillus_phage	42.4	3.2e-78
WP_069354782.1|1482115_1483411_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	27.5	3.5e-11
WP_069354783.1|1483400_1484153_+	AAA family ATPase	NA	A0A059NT77	Lactococcus_phage	46.5	3.5e-56
WP_084746028.1|1484149_1485079_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A142F1N9	Bacillus_phage	25.3	5.7e-24
WP_069355251.1|1485542_1486010_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053564957.1|1486617_1486839_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069355252.1|1487006_1487762_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000251856.1|1488283_1488511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069355253.1|1488663_1489950_+	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_000767792.1|1490141_1490711_+	signal peptidase I	NA	NA	NA	NA	NA
WP_000172852.1|1490773_1491361_+	cell division protein FtsN	NA	NA	NA	NA	NA
WP_069355254.1|1491495_1492338_+	DUF4047 domain-containing protein	NA	NA	NA	NA	NA
WP_069355255.1|1492724_1493318_+	camelysin	NA	NA	NA	NA	NA
WP_000578885.1|1493357_1493681_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000276219.1|1493760_1493895_-	DNA-binding anti-repressor SinI	NA	NA	NA	NA	NA
WP_069355256.1|1494237_1496625_+|protease	M6 family metalloprotease domain-containing protein	protease	NA	NA	NA	NA
WP_069355257.1|1496796_1498164_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000720333.1|1498403_1499387_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	37.1	2.7e-24
WP_069355258.1|1499383_1500232_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	23.3	8.6e-11
WP_000714190.1|1500238_1501039_+	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
WP_069355259.1|1501077_1502127_+	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
WP_016513124.1|1502186_1502834_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_069355260.1|1502945_1505138_+	MMPL family transporter	NA	NA	NA	NA	NA
WP_000490302.1|1505240_1505657_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069355261.1|1505757_1506681_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_000599010.1|1506772_1507378_+	DUF1648 domain-containing protein	NA	NA	NA	NA	NA
WP_016513122.1|1507418_1508246_-	hypothetical protein	NA	U5Q0C0	Bacillus_phage	67.7	3.7e-43
WP_157452921.1|1509260_1510160_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	37.3	1.5e-24
WP_069354784.1|1510114_1510384_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_084746362.1|1511265_1512681_-	glycolate oxidase subunit GlcD	NA	NA	NA	NA	NA
WP_069355262.1|1512791_1513907_-	carbohydrate diacid regulator	NA	NA	NA	NA	NA
WP_069355263.1|1514043_1515018_+	YVTN family beta-propeller repeat-containing protein	NA	NA	NA	NA	NA
WP_001046397.1|1515010_1515682_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	44.8	1.6e-52
WP_053564942.1|1515685_1517086_+	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	34.5	5.0e-40
WP_071714541.1|1517438_1518158_+	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000869147.1|1518326_1519046_+	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_000061930.1|1519062_1520484_+	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_000147182.1|1520483_1521194_+	lactate utilization protein C	NA	NA	NA	NA	NA
WP_069355264.1|1521306_1522029_+	prepilin peptidase	NA	NA	NA	NA	NA
WP_069355265.1|1522043_1522355_+	hypothetical protein	NA	A0A109QIR8	Bacillus_phage	33.0	4.3e-08
WP_000893034.1|1522382_1523234_-	formate/nitrite transporter family protein	NA	NA	NA	NA	NA
WP_069355266.1|1523436_1524237_-	TerC family protein	NA	A0A068EP98	Bacillus_phage	39.5	1.6e-27
WP_069355267.1|1524531_1525851_-	potassium transporter TrkH	NA	NA	NA	NA	NA
WP_000241212.1|1525965_1526151_-	alpha/beta-type small acid-soluble spore protein	NA	A0A1P8CX76	Bacillus_phage	70.7	2.4e-14
WP_001067916.1|1526299_1526743_-	MaoC family dehydratase	NA	NA	NA	NA	NA
WP_000448592.1|1526844_1527369_-	polyhydroxyalkanoic acid inclusion protein PhaP	NA	NA	NA	NA	NA
WP_000939954.1|1527411_1527864_-	poly-beta-hydroxybutyrate-responsive repressor	NA	NA	NA	NA	NA
WP_000566941.1|1528062_1528545_+	polyhydroxyalkanoic acid synthase subunit PhaR	NA	NA	NA	NA	NA
WP_000250407.1|1528695_1529439_+	acetoacetyl-CoA reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.0	3.2e-17
WP_000206336.1|1529522_1530608_+	class III poly(R)-hydroxyalkanoic acid synthase subunit PhaC	NA	NA	NA	NA	NA
WP_000772526.1|1530702_1531896_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_001204706.1|1531919_1533269_+	TrkH family potassium uptake protein	NA	NA	NA	NA	NA
WP_069355268.1|1533307_1533643_-	DUF3905 domain-containing protein	NA	NA	NA	NA	NA
WP_000750893.1|1534172_1535249_+	putative 2-aminoethylphosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000006196.1|1535268_1536270_+	putative 2-aminoethylphosphonate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.3	2.6e-30
WP_069355269.1|1538049_1538844_+	phosphonoacetaldehyde hydrolase	NA	NA	NA	NA	NA
WP_069354786.1|1539757_1540870_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
1539640:1541225	attR	AAAGAGATAATATGAAGTGCCCCCCTAGATTATCAAGTCAGGGATTTTAACCCATAATAATATGAGTGAAAACAAACATTATAAATGGGTGTATACCCTATGACAATAGGAGGCCACTATGGAAAATATAATCTATATTGGGATAGATGTCCACAAGGAAAGCTTTAGTTTATGTGCATTGCACGGAACAACTGGGGAAATTGTAGGAGAAGCACGATGTGCTTCAAATGTATCTCTCGTAAAAAAATTCGTTGAGAAACTGAAAACAAAATATGGTGAAGATATAAAAATTAAAGCTGGATATGAAGCGGGTTGTTTAGGATATTCACTCCATAATCTTTTGGAGCAAAACGGGATTGATTGTGATATTTTAGCACCAACAACCATGTACAGTTCATCTAAAAATAAAATGGTGAAAAACGACAGATTCGATGCTAAAATGATTGCTCTTAATTTAGCGAATGGTACTTATAAAGAAGTATATGTTCCAGAAGAAGAGGATGTTGCTGTAAAAGAGTATATCCGCATGTTAGGTGATTTTAAAACATCATTGAAAAAAATAAAACAACAGATAAAAGCATTCCTTTTAAGACATGGCTATATTTACGAAGGAAAATCAAGCTGGACAATCGCTTATATGAAATGGTTAAAGAATCTTGATTTACAAGGATTATTCAAAGAAACGTTAGATGAATATCTATTACAGTATGATGTTTTAGTGGATAAAATTGAGCGGTTCAGTCTGAGAGTAGAAGAATTATCTCATAGTGAAAGATATGAAGAACCAGTCGGAAAATTAAGATGTTTAAAAGGTATAGACACAACATCGGCAATGACTGTGCATGTGGAAATTGCAGACTTCACTCGGTTCCCAACGGCTAAAGCATTTATGGCTTATGTAGGGTTGACGCCAAGCGAAAGCTCAAGTGGGGAGAAAATCAGTCGAAGTTCGATTACAAAGCAAGGTAATTCGACCGTTAGGTCTACTCTTGTAGAATGTGCAAATTCCTTGGTAAAAGGAACGATTGGATTAAAATCAAAACGAGTGAAAGCAAGACAAAAAGACCAACGAAGCGACGTAATTTCCTATGCGGATCGGGCAGTAGAACGGTTACAACGAAAATATCATCGAATGATGTATCAAGGGAAGCCCAGAAATGTTGCTATTACAGCGATTGCAAGAGAACTGGGATGTTTTATCTGGGGATTAGAAACAGGTAAAATTCACTAGAAATAAAGAGAGAGGGATATGAAGTTGATTCATTCATAGTTAGAGACCAAAGGTATCAATTGATGGCATAGATGAGCTTCAGAGATAGTGAATTACAGGTCTGGCTATCTATGACACACCCTCTGCTGGCACAGCTGAAATTCTGATAAACCAGCTATTTATTAGAATGTGAAAAGATGTGATCCACGTAAAGAGATTATAAGAGCCTAACGACGGACCATTAACCTGAGGTAACCAATCCACGAATAACAGAGTGGTTAACTGTCGATAGATCTTATTTCTGAAGCTTTTGTATGCCATCAAGAAAAAATATTATGGGGGAAAAACTATTGACAAAGGTCACTTCATAACAGGG	NA	NA	NA	NA
>prophage 6
NZ_CP015250	Bacillus thuringiensis Bt18247, complete genome	5610045	2047763	2106065	5610045	transposase	Bacillus_phage(25.0%)	52	NA	NA
WP_069355414.1|2047763_2048909_-|transposase	IS110 family transposase	transposase	Q9JMN8	Wolbachia_phage	28.5	8.3e-41
WP_069355415.1|2049170_2050136_-	arsenic resistance protein	NA	NA	NA	NA	NA
WP_000522528.1|2050429_2051122_+	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_001284784.1|2051360_2052716_+	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
WP_000750850.1|2052801_2053221_+	VOC family protein	NA	NA	NA	NA	NA
WP_069355416.1|2053550_2055200_+	copper resistance protein	NA	NA	NA	NA	NA
WP_065228652.1|2055234_2055855_+	DUF1775 domain-containing protein	NA	NA	NA	NA	NA
WP_023521703.1|2055897_2056803_-	DMT family transporter	NA	NA	NA	NA	NA
WP_069355417.1|2056900_2057770_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000704073.1|2057891_2058323_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_000216673.1|2058393_2059044_+	DsbA family oxidoreductase	NA	NA	NA	NA	NA
WP_001277021.1|2059101_2059704_+	nitroreductase family protein	NA	NA	NA	NA	NA
WP_069355419.1|2060839_2061928_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q332I1	Clostridium_botulinum_C_phage	68.7	2.5e-140
WP_001006602.1|2062605_2063619_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_000715322.1|2063707_2064652_-	L-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_069355421.1|2064852_2066289_+	flavin monoamine oxidase family protein	NA	NA	NA	NA	NA
WP_001044939.1|2066395_2067319_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_000062000.1|2067581_2068799_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000149338.1|2068888_2069662_+	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	27.2	4.4e-14
WP_001196696.1|2069639_2070341_+	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	31.3	1.5e-13
WP_000382788.1|2070362_2071223_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_002083259.1|2071272_2072226_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_069355414.1|2072447_2073593_-|transposase	IS110 family transposase	transposase	Q9JMN8	Wolbachia_phage	28.5	8.3e-41
WP_000404994.1|2073887_2074676_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_053564740.1|2074796_2075345_+	DUF4865 family protein	NA	NA	NA	NA	NA
WP_053564739.1|2075388_2075808_+	tautomerase family protein	NA	NA	NA	NA	NA
WP_069355422.1|2075797_2076070_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_001205523.1|2076274_2076718_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_069355423.1|2076838_2077894_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_069355424.1|2078486_2079890_+	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_069355425.1|2079876_2080893_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_069355426.1|2080892_2082614_+	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	24.3	3.3e-25
WP_069355427.1|2082610_2084335_+	thiol reductant ABC exporter subunit CydC	NA	A0A2H4UU96	Bodo_saltans_virus	25.1	1.1e-20
WP_069355428.1|2084467_2085616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069355429.1|2085723_2088285_+	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	31.1	5.8e-10
WP_069355430.1|2088304_2089435_+	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	NA	NA	NA	NA
WP_053564731.1|2089427_2089994_+	acyltransferase	NA	NA	NA	NA	NA
WP_000459099.1|2090178_2090400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000695203.1|2090490_2090937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069355431.1|2091265_2092267_-	LD-carboxypeptidase	NA	NA	NA	NA	NA
WP_053564729.1|2092473_2093427_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	29.2	4.2e-22
WP_001029924.1|2093676_2094276_+	nitroreductase family protein	NA	NA	NA	NA	NA
WP_001244281.1|2094322_2094493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069355432.1|2095179_2096466_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	30.6	3.8e-10
WP_084746073.1|2097008_2098304_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	27.5	3.5e-11
WP_069355433.1|2098293_2098626_+	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	40.8	1.2e-11
WP_069354784.1|2098677_2098947_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_157452921.1|2098901_2099801_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	37.3	1.5e-24
WP_069355434.1|2100988_2102749_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	98.0	4.1e-273
WP_069356626.1|2102789_2103467_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	98.7	5.6e-122
WP_053564723.1|2104561_2105149_-	DUF3139 domain-containing protein	NA	NA	NA	NA	NA
WP_000818985.1|2105345_2106065_+	3-ketoacyl-ACP reductase	NA	W8CYX9	Bacillus_phage	100.0	5.9e-61
>prophage 7
NZ_CP015250	Bacillus thuringiensis Bt18247, complete genome	5610045	2510480	2554860	5610045	transposase,protease	Bacillus_phage(28.57%)	41	NA	NA
WP_069355583.1|2510480_2511377_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_142238912.1|2511376_2512036_+	chloramphenicol acetyltransferase	NA	NA	NA	NA	NA
WP_053564524.1|2512292_2512898_+	CTP synthase	NA	NA	NA	NA	NA
WP_069355584.1|2512968_2513835_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000591705.1|2513964_2515008_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000093107.1|2515086_2515518_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069355585.1|2515804_2516929_+	choloylglycine hydrolase	NA	NA	NA	NA	NA
WP_142238913.1|2516980_2517244_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069355586.1|2517340_2518243_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_069354786.1|2518454_2519567_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_001262982.1|2519977_2520667_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_069355587.1|2520925_2521813_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_053564519.1|2521846_2522443_+	DUF1349 domain-containing protein	NA	NA	NA	NA	NA
WP_053564518.1|2522664_2524419_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.7	6.9e-47
WP_069355588.1|2524411_2526208_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.3	3.2e-55
WP_001257871.1|2526876_2527380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001123247.1|2527765_2528050_-	DUF4183 domain-containing protein	NA	NA	NA	NA	NA
WP_000774115.1|2528292_2528565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069354783.1|2528907_2529660_-	AAA family ATPase	NA	A0A059NT77	Lactococcus_phage	46.5	3.5e-56
WP_069354782.1|2529649_2530945_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	27.5	3.5e-11
WP_053564517.1|2531140_2531923_-	glycosyltransferase family 2 protein	NA	A0A1V0SJD8	Klosneuvirus	32.1	1.2e-22
WP_069355589.1|2532102_2532687_-	LysE family transporter	NA	NA	NA	NA	NA
WP_130813712.1|2532742_2533357_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_069355590.1|2533723_2534293_-	collagen-like protein	NA	NA	NA	NA	NA
WP_157452945.1|2534545_2535313_+	DUF4183 domain-containing protein	NA	NA	NA	NA	NA
WP_069355592.1|2535873_2537172_+	collagen-like repeat preface domain-containing protein	NA	NA	NA	NA	NA
WP_000126322.1|2537737_2538370_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000010317.1|2538599_2538905_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069355593.1|2538998_2540309_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_069355594.1|2540286_2541156_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_069356634.1|2541651_2542245_+	methyltransferase domain-containing protein	NA	A0A2P1JQT7	Mycobacterium_phage	33.9	1.0e-10
WP_000137396.1|2542558_2543671_+	toxic anion resistance protein	NA	NA	NA	NA	NA
WP_069355595.1|2543695_2544529_+	DUF3974 domain-containing protein	NA	NA	NA	NA	NA
WP_069355596.1|2544586_2546146_-	family 10 glycosylhydrolase	NA	NA	NA	NA	NA
WP_069355597.1|2546373_2546679_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_001032277.1|2546690_2547974_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_001021962.1|2548052_2548319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069354786.1|2549017_2550130_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_069355598.1|2551284_2552412_+	alpha-helical pore-forming toxin family protein	NA	NA	NA	NA	NA
WP_157452921.1|2553736_2554636_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	37.3	1.5e-24
WP_069354784.1|2554590_2554860_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP015250	Bacillus thuringiensis Bt18247, complete genome	5610045	2643122	2755386	5610045	bacteriocin,tRNA,transposase,terminase,capsid,protease,tail,head,portal,integrase	Bacillus_phage(61.9%)	105	2676558:2676574	2749959:2749975
WP_053564423.1|2643122_2643779_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_053564422.1|2644097_2644301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071730552.1|2644328_2644571_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053564420.1|2644681_2645608_+	alcohol dehydrogenase catalytic domain-containing protein	NA	NA	NA	NA	NA
WP_053564419.1|2645689_2646547_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_053564418.1|2646602_2647100_+	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_069355627.1|2647358_2647988_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_053564416.1|2648240_2648942_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_053564415.1|2648938_2649841_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_053564414.1|2649982_2650153_+	DUF2197 domain-containing protein	NA	NA	NA	NA	NA
WP_053564413.1|2650560_2652114_+|tRNA	lysine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_001128402.1|2652173_2652602_-	cell wall hydrolase	NA	NA	NA	NA	NA
WP_017656684.1|2652752_2653667_+	acetamidase/formamidase family protein	NA	NA	NA	NA	NA
WP_069355628.1|2653794_2654502_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_053564412.1|2654498_2655482_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_000376270.1|2655801_2656428_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069356636.1|2656985_2658614_+	ABC-F type ribosomal protection protein	NA	A0A1B0RXA0	Streptococcus_phage	33.4	6.0e-53
WP_053564411.1|2658634_2659228_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_053565503.1|2659747_2660242_+	DUF3267 domain-containing protein	NA	NA	NA	NA	NA
WP_053564410.1|2660558_2661329_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.9	2.8e-32
WP_069355630.1|2661303_2663238_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_053564408.1|2663305_2663977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053564407.1|2664085_2664427_-	DUF3914 domain-containing protein	NA	NA	NA	NA	NA
WP_053564406.1|2664706_2665948_+	lipase	NA	NA	NA	NA	NA
WP_053564405.1|2666035_2667061_+	homoserine dehydrogenase	NA	NA	NA	NA	NA
WP_069355631.1|2667150_2668599_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_003270605.1|2668603_2669518_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_053564403.1|2669824_2670514_+	thiaminase II	NA	NA	NA	NA	NA
WP_002082716.1|2670911_2671175_+	DUF3937 domain-containing protein	NA	NA	NA	NA	NA
WP_069355632.1|2671724_2672045_+|bacteriocin	heterocycloanthracin/sonorensin family bacteriocin	bacteriocin	NA	NA	NA	NA
WP_053564402.1|2672539_2673025_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000736205.1|2673336_2674038_+	DUF3962 domain-containing protein	NA	NA	NA	NA	NA
WP_046392720.1|2674076_2675186_-|integrase	site-specific integrase	integrase	A0A0U3U8Y8	Bacillus_phage	78.4	4.1e-146
WP_069355633.1|2675832_2677035_+	hypothetical protein	NA	D2XQ10	Bacillus_virus	46.2	1.2e-82
2676558:2676574	attL	TGATCAAAGTAATTGCT	NA	NA	NA	NA
WP_071740166.1|2677031_2677217_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000425256.1|2677477_2677828_-	helix-turn-helix transcriptional regulator	NA	A0A288WFW4	Bacillus_phage	39.7	7.4e-17
WP_061139252.1|2678011_2678308_+	helix-turn-helix transcriptional regulator	NA	A0A288WG89	Bacillus_phage	46.5	1.1e-08
WP_000522024.1|2678523_2678790_+	helix-turn-helix domain-containing protein	NA	A0A0U3ULL9	Bacillus_phage	90.6	1.6e-35
WP_000190248.1|2679164_2679911_+	DnaD domain protein	NA	A0A1B0T6C0	Bacillus_phage	79.9	4.2e-78
WP_084746103.1|2679849_2680725_+	ATP-binding protein	NA	Q2I8C8	Bacillus_phage	45.5	1.7e-62
WP_069355634.1|2680740_2680935_+	hypothetical protein	NA	A0A1B1P7U7	Bacillus_phage	90.6	4.3e-27
WP_000805171.1|2680960_2681134_+	DUF3954 domain-containing protein	NA	A0A1B1P7U5	Bacillus_phage	98.2	1.8e-24
WP_069355635.1|2681148_2681403_+	hypothetical protein	NA	A0A0U3SU43	Bacillus_phage	84.5	1.1e-35
WP_053564389.1|2681417_2681630_+	hypothetical protein	NA	A0A1B0T6B5	Bacillus_phage	79.0	4.3e-20
WP_069355636.1|2681778_2682375_-	exosporium leader peptide-containing protein	NA	NA	NA	NA	NA
WP_053564388.1|2682563_2682923_-	cell division protein DivIVC	NA	NA	NA	NA	NA
WP_016124630.1|2684119_2685289_+	hypothetical protein	NA	F2Y2K8	Organic_Lake_phycodnavirus	27.0	8.5e-09
WP_016124632.1|2686162_2686819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000166181.1|2687175_2687658_+	ArpU family transcriptional regulator	NA	H0USV3	Bacillus_phage	83.1	1.1e-71
WP_001012146.1|2687657_2688200_+|integrase	site-specific integrase	integrase	W8CYP1	Bacillus_phage	91.7	2.9e-89
WP_016124636.1|2688496_2688841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069355637.1|2689133_2689778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069355638.1|2690203_2690701_+	hypothetical protein	NA	A0A288WFY4	Bacillus_phage	46.4	7.2e-34
WP_069355639.1|2690837_2691116_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069354853.1|2694437_2695583_-|transposase	IS110 family transposase	transposase	Q9JMN8	Wolbachia_phage	28.5	1.7e-41
WP_069355640.1|2695990_2696224_+	hypothetical protein	NA	A0A0K2CZF4	Paenibacillus_phage	41.3	5.6e-05
WP_069355641.1|2696220_2696601_-	DUF2513 domain-containing protein	NA	A0A1Q1PVT8	Staphylococcus_phage	42.6	2.8e-17
WP_069355643.1|2697057_2697393_+	HNH endonuclease	NA	D2XR61	Bacillus_phage	85.6	8.3e-50
WP_069355644.1|2697516_2697828_+|terminase	terminase	terminase	D2XR14	Bacillus_phage	84.3	2.7e-39
WP_069355645.1|2697824_2699492_+|terminase	terminase large subunit	terminase	D2XR15	Bacillus_phage	91.4	9.4e-304
WP_046946472.1|2699500_2700646_+|portal	phage portal protein	portal	D2XR16	Bacillus_phage	87.0	1.2e-180
WP_069356638.1|2700645_2701389_+|protease	Clp protease ClpP	protease	D2XR17	Bacillus_phage	97.6	3.3e-131
WP_069355646.1|2701392_2702547_+|capsid	phage major capsid protein	capsid	A0A2H4JHU0	uncultured_Caudovirales_phage	92.2	9.4e-202
WP_001098851.1|2702552_2702846_+	hypothetical protein	NA	D2XR19	Bacillus_phage	91.8	2.0e-44
WP_069355647.1|2702847_2703201_+|head	phage head closure protein	head	A0A2H4JGG7	uncultured_Caudovirales_phage	94.8	1.5e-57
WP_069355648.1|2703202_2703544_+	HK97 gp10 family phage protein	NA	D2XR21	Bacillus_phage	92.0	2.6e-51
WP_069355649.1|2703543_2703873_+	hypothetical protein	NA	D2XR22	Bacillus_phage	89.9	4.8e-50
WP_069355650.1|2703873_2704461_+|tail	phage tail protein	tail	A0A2H4JDV4	uncultured_Caudovirales_phage	81.0	9.6e-86
WP_069355651.1|2704465_2704828_+	hypothetical protein	NA	A0A2H4JAG8	uncultured_Caudovirales_phage	84.2	1.1e-52
WP_069355652.1|2705058_2708634_+	DUF2207 domain-containing protein	NA	A0A2H4JAI2	uncultured_Caudovirales_phage	87.6	2.3e-190
WP_069355653.1|2708675_2710151_+|tail	phage tail protein	tail	D2XR27	Bacillus_phage	57.9	3.5e-161
WP_069355654.1|2710147_2715907_+	peptidase S74	NA	D2XR28	Bacillus_phage	45.3	0.0e+00
WP_069355414.1|2716079_2717225_-|transposase	IS110 family transposase	transposase	Q9JMN8	Wolbachia_phage	28.5	8.3e-41
WP_069355655.1|2717720_2721014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053564349.1|2721387_2723070_+	RNAseH domain-containing protein	NA	NA	NA	NA	NA
WP_053564347.1|2724189_2724606_+	DUF3995 domain-containing protein	NA	NA	NA	NA	NA
WP_000878369.1|2724726_2724930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000362069.1|2725258_2725471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069355656.1|2725680_2726685_+	DUF1835 domain-containing protein	NA	NA	NA	NA	NA
WP_000282689.1|2726830_2727235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069355657.1|2727394_2728630_+	cytochrome P450	NA	NA	NA	NA	NA
WP_000106397.1|2728897_2730181_+	MFS transporter	NA	NA	NA	NA	NA
WP_069355658.1|2730170_2730803_+	Vat family streptogramin A O-acetyltransferase	NA	A0A2R8FE91	Brazilian_cedratvirus	43.1	1.6e-25
WP_000046095.1|2730873_2731029_+	DUF1540 domain-containing protein	NA	NA	NA	NA	NA
WP_000289127.1|2731131_2731629_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_069355659.1|2731769_2732984_+	cytochrome P450	NA	NA	NA	NA	NA
WP_023522059.1|2733093_2733672_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000766393.1|2733847_2734699_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_053564341.1|2735121_2736909_+	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_069355660.1|2737143_2739270_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_069355661.1|2739346_2739877_+	signal peptidase I	NA	NA	NA	NA	NA
WP_069355662.1|2740135_2741323_+	UDP-glucosyltransferase	NA	A0A2H4ZK81	Cryptophlebia_leucotreta_granulosis_virus	26.2	8.9e-06
WP_069355663.1|2742468_2743017_+	ECF-type riboflavin transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_069355664.1|2743027_2744728_+	energy-coupling factor ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	30.0	1.0e-15
WP_069355665.1|2744720_2745521_+	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_000120182.1|2745657_2745765_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_053564335.1|2745857_2747126_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	29.6	4.1e-25
WP_071714916.1|2747261_2747456_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0T6A8	Bacillus_phage	66.0	6.7e-12
WP_000754941.1|2747761_2747911_+	DUF3954 domain-containing protein	NA	A0A1B0T6B8	Bacillus_phage	63.6	1.8e-09
WP_053564333.1|2750400_2750808_-	DUF4870 domain-containing protein	NA	NA	NA	NA	NA
2749959:2749975	attR	AGCAATTACTTTGATCA	NA	NA	NA	NA
WP_053564332.1|2751109_2751574_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000796393.1|2751881_2752346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069355666.1|2752927_2753122_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069355667.1|2753688_2753988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069354786.1|2754273_2755386_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_CP015250	Bacillus thuringiensis Bt18247, complete genome	5610045	2780293	2824965	5610045	transposase,bacteriocin	Wolbachia_phage(18.18%)	45	NA	NA
WP_069354853.1|2780293_2781439_-|transposase	IS110 family transposase	transposase	Q9JMN8	Wolbachia_phage	28.5	1.7e-41
WP_157452929.1|2781793_2782462_+	serine/threonine protein kinase	NA	NA	NA	NA	NA
WP_000026312.1|2782651_2782831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000587696.1|2782922_2783180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069355682.1|2783315_2784746_+	glucose dehydrogenase	NA	NA	NA	NA	NA
WP_053564289.1|2784938_2785511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000185959.1|2785543_2786107_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001048947.1|2786184_2786565_+	nucleotide excision repair endonuclease	NA	NA	NA	NA	NA
WP_069355683.1|2786622_2786829_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069355684.1|2786961_2787741_+	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_069355685.1|2789060_2789588_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000999062.1|2789604_2790126_+	bacillithiol transferase BstA	NA	NA	NA	NA	NA
WP_069355686.1|2790713_2791826_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_000522472.1|2792299_2792677_-	PH domain-containing protein	NA	A6N235	Microbacterium_phage	36.4	5.5e-10
WP_053564294.1|2793267_2793639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157452930.1|2793799_2793970_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001987779.1|2794532_2794940_+	DUF1992 domain-containing protein	NA	NA	NA	NA	NA
WP_069355687.1|2795018_2795834_+	DUF1963 domain-containing protein	NA	NA	NA	NA	NA
WP_069355688.1|2796620_2797391_-	hypothetical protein	NA	A0A0K2CNR4	Brevibacillus_phage	31.9	8.1e-16
WP_069355689.1|2797687_2798383_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_053564299.1|2798446_2799370_-	hypothetical protein	NA	A0A1B1SHC5	Bacillus_phage	52.0	1.3e-76
WP_053564302.1|2800475_2800901_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_069355414.1|2802578_2803724_-|transposase	IS110 family transposase	transposase	Q9JMN8	Wolbachia_phage	28.5	8.3e-41
WP_069355691.1|2804039_2805056_-	serine hydrolase	NA	NA	NA	NA	NA
WP_001071389.1|2805157_2805424_-|bacteriocin	heterocycloanthracin/sonorensin family bacteriocin	bacteriocin	NA	NA	NA	NA
WP_069355692.1|2805623_2806070_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_069355693.1|2806086_2806434_-	divalent cation tolerance protein CutA	NA	K7YGE2	Megavirus	36.0	1.6e-11
WP_069355694.1|2806464_2806923_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_069355695.1|2806999_2807923_-	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_069355696.1|2809533_2810448_-	EamA family transporter	NA	NA	NA	NA	NA
WP_069355697.1|2810600_2812034_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_069355698.1|2812078_2812609_-	DUF4269 domain-containing protein	NA	NA	NA	NA	NA
WP_053564312.1|2812775_2813237_+	DUF2306 domain-containing protein	NA	NA	NA	NA	NA
WP_053564313.1|2813370_2814216_-	SH3 domain-containing protein	NA	A0A0S2MVR5	Bacillus_phage	69.3	1.6e-65
WP_069355699.1|2814502_2815381_-	glycerophosphodiester phosphodiesterase	NA	A0A076G4Q2	Staphylococcus_phage	37.6	8.3e-33
WP_053564315.1|2815426_2816227_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_053564316.1|2816738_2817443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053564317.1|2817492_2818137_-	DUF1295 domain-containing protein	NA	NA	NA	NA	NA
WP_069355700.1|2818159_2818957_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_069355701.1|2819220_2820516_-	MFS transporter	NA	NA	NA	NA	NA
WP_000703280.1|2820628_2821852_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_069354782.1|2822204_2823500_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	27.5	3.5e-11
WP_069355702.1|2823489_2823840_+	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	40.8	7.1e-12
WP_157452921.1|2823841_2824741_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	37.3	1.5e-24
WP_069354784.1|2824695_2824965_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 10
NZ_CP015250	Bacillus thuringiensis Bt18247, complete genome	5610045	3243053	3292680	5610045	transposase,protease	Bacillus_phage(28.57%)	41	NA	NA
WP_069354784.1|3243053_3243323_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_157452921.1|3243277_3244177_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	37.3	1.5e-24
WP_069355891.1|3244328_3246185_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_001072312.1|3246243_3246810_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_157452933.1|3247221_3248655_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_069355892.1|3248830_3249460_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_069355893.1|3249488_3249653_+	DUF2197 domain-containing protein	NA	NA	NA	NA	NA
WP_000651402.1|3250076_3250886_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000577091.1|3251747_3252194_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069355896.1|3253443_3254208_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.4	1.1e-20
WP_001178563.1|3254377_3254818_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000501367.1|3254986_3256192_-	M20 family metallopeptidase	NA	NA	NA	NA	NA
WP_069355897.1|3256458_3258768_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_001145268.1|3258879_3259272_+	VOC family protein	NA	NA	NA	NA	NA
WP_000656651.1|3259572_3259806_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053564027.1|3260209_3261301_+	low temperature requirement protein A	NA	NA	NA	NA	NA
WP_000833211.1|3262118_3262472_-	YxeA family protein	NA	A0A0K2CYS5	Paenibacillus_phage	38.0	2.2e-13
WP_069355898.1|3264959_3265700_-	YrrS family protein	NA	NA	NA	NA	NA
WP_002094078.1|3265937_3266372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069355899.1|3266925_3268239_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_069355900.1|3268662_3269118_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000956453.1|3269117_3269312_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_069355901.1|3269513_3270920_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_069355902.1|3271293_3273378_-	serine hydrolase	NA	NA	NA	NA	NA
WP_069356645.1|3273469_3274636_-	serine hydrolase	NA	A0A1D8EXR7	Mycobacterium_phage	27.0	7.4e-21
WP_063547880.1|3275801_3277121_+	septum formation initiator	NA	NA	NA	NA	NA
WP_063547882.1|3277526_3278399_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_069355903.1|3278519_3279389_+	DMT family transporter	NA	NA	NA	NA	NA
WP_000323764.1|3279628_3279934_-	monooxygenase	NA	NA	NA	NA	NA
WP_031312939.1|3280130_3280481_-	DoxX family membrane protein	NA	NA	NA	NA	NA
WP_001048563.1|3280812_3281232_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000589730.1|3281707_3282106_-	DUF1259 domain-containing protein	NA	NA	NA	NA	NA
WP_000912131.1|3282844_3283168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069355904.1|3283188_3283659_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001264516.1|3283930_3284605_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	33.9	2.4e-32
WP_069355905.1|3284601_3285975_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	29.0	2.2e-24
WP_001104104.1|3286166_3286382_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001064062.1|3286728_3288174_-	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_069355906.1|3288794_3289673_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_069355907.1|3290032_3291370_+	erythromycin esterase family protein	NA	NA	NA	NA	NA
WP_069355908.1|3291927_3292680_-|transposase	transposase	transposase	A0A059NT77	Lactococcus_phage	46.9	1.7e-55
>prophage 11
NZ_CP015250	Bacillus thuringiensis Bt18247, complete genome	5610045	3549048	3616153	5610045	transposase	Macacine_betaherpesvirus(18.18%)	53	NA	NA
WP_069354784.1|3549048_3549318_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_157452921.1|3549272_3550172_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	37.3	1.5e-24
WP_069356013.1|3551992_3552706_+	exosporium leader peptide-containing protein	NA	NA	NA	NA	NA
WP_069356014.1|3552861_3554403_-	alpha-amylase	NA	NA	NA	NA	NA
WP_069356015.1|3554606_3555398_+	N-hydroxyarylamine O-acetyltransferase	NA	NA	NA	NA	NA
WP_029442916.1|3555515_3557303_+	oligoendopeptidase F	NA	NA	NA	NA	NA
WP_069356016.1|3557350_3558397_-	agmatine deiminase family protein	NA	NA	NA	NA	NA
WP_069356017.1|3558584_3559406_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_069356018.1|3559448_3560426_-	peptidyl-arginine deiminase	NA	NA	NA	NA	NA
WP_069356019.1|3560657_3561590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000916570.1|3561770_3562187_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_016080772.1|3562355_3563513_-	agmatine deiminase family protein	NA	M1HPT6	Paramecium_bursaria_Chlorella_virus	29.9	3.9e-38
WP_000915203.1|3563841_3564969_-	serine hydrolase	NA	G1DB24	Mycobacterium_phage	32.3	1.5e-18
WP_069356020.1|3565328_3565457_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_069356021.1|3565566_3566796_-	MFS transporter	NA	NA	NA	NA	NA
WP_069356022.1|3566882_3567734_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_069356023.1|3567726_3568236_+	DUF3916 domain-containing protein	NA	NA	NA	NA	NA
WP_069356024.1|3568274_3569219_-	glycerophosphodiester phosphodiesterase	NA	A0A076G4Q2	Staphylococcus_phage	33.8	7.0e-38
WP_069356025.1|3569586_3570183_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069356026.1|3570183_3572490_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_069356027.1|3572541_3573126_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_069356028.1|3573577_3573841_-	DUF4176 domain-containing protein	NA	NA	NA	NA	NA
WP_069356029.1|3573837_3574617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069356030.1|3574635_3575619_-	type VII secretion protein	NA	NA	NA	NA	NA
WP_069356031.1|3575615_3576419_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069356032.1|3576662_3578282_-	FAD-dependent monooxygenase	NA	NA	NA	NA	NA
WP_000571870.1|3578792_3579137_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000646436.1|3579155_3580154_+	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_053563873.1|3580337_3581804_+	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	30.4	9.2e-45
WP_069356033.1|3582059_3583154_+	histidine kinase	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	51.6	4.4e-100
WP_000721431.1|3583153_3583363_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069356034.1|3583436_3584036_-	FMN-binding negative transcriptional regulator	NA	NA	NA	NA	NA
WP_053563872.1|3584728_3585076_-	DUF4260 domain-containing protein	NA	NA	NA	NA	NA
WP_082187992.1|3585088_3585235_-	transporter	NA	NA	NA	NA	NA
WP_053563871.1|3585282_3586674_-	FAD-binding protein	NA	NA	NA	NA	NA
WP_000737896.1|3586800_3587199_-	DUF2871 family protein	NA	NA	NA	NA	NA
WP_053563870.1|3587452_3587956_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_053563869.1|3588972_3589542_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053563868.1|3589951_3591367_+	phosphatidylinositol-specific phospholipase C	NA	NA	NA	NA	NA
WP_001049835.1|3591538_3592915_-	chitin-binding protein	NA	A0A0K1Y848	Apis_mellifera_filamentous_virus	36.1	4.6e-22
WP_069354782.1|3593418_3594714_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	27.5	3.5e-11
WP_069354783.1|3594703_3595456_+	AAA family ATPase	NA	A0A059NT77	Lactococcus_phage	46.5	3.5e-56
WP_069356035.1|3596517_3597561_+	cell filamentation protein Fic	NA	NA	NA	NA	NA
WP_000055706.1|3598415_3599909_+	spore germination protein	NA	NA	NA	NA	NA
WP_000527368.1|3599910_3601014_+	endospore germination permease	NA	NA	NA	NA	NA
WP_069356036.1|3601010_3602138_+	Ger(x)C family spore germination protein	NA	NA	NA	NA	NA
WP_069356038.1|3604601_3605150_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069356039.1|3605472_3607839_-	DUF3472 domain-containing protein	NA	NA	NA	NA	NA
WP_069354853.1|3609933_3611079_-|transposase	IS110 family transposase	transposase	Q9JMN8	Wolbachia_phage	28.5	1.7e-41
WP_014482097.1|3612249_3613518_-	cellulase family glycosylhydrolase	NA	NA	NA	NA	NA
WP_069356041.1|3614041_3614260_-	aspartate phosphatase	NA	NA	NA	NA	NA
WP_157452921.1|3615029_3615929_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	37.3	1.5e-24
WP_069354784.1|3615883_3616153_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 12
NZ_CP015250	Bacillus thuringiensis Bt18247, complete genome	5610045	4479588	4586577	5610045	tRNA,transposase,coat,protease,integrase	Klosneuvirus(20.0%)	90	4484709:4484732	4570728:4570751
WP_000903182.1|4479588_4480356_-|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_000840885.1|4480656_4482432_-|tRNA	aspartate--tRNA ligase	tRNA	A0A1V0SIS0	Klosneuvirus	33.1	5.4e-15
WP_069356224.1|4482444_4483716_-|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_069356225.1|4484329_4484662_-	YrdB family protein	NA	NA	NA	NA	NA
4484709:4484732	attL	TAAAGTGAAACTTTAATCAGTGGG	NA	NA	NA	NA
WP_001266965.1|4484929_4485370_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_001262795.1|4485386_4487570_-	GTP diphosphokinase	NA	A0A1B1IUF0	uncultured_Mediterranean_phage	36.5	2.4e-12
WP_000346217.1|4487780_4488293_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	43.8	3.8e-30
WP_069356226.1|4488340_4490680_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	33.0	6.6e-85
WP_069356227.1|4490781_4491675_-	cation transporter	NA	NA	NA	NA	NA
WP_069356228.1|4491831_4494096_-	protein translocase subunit SecDF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	35.7	3.3e-33
WP_000886979.1|4494365_4494650_-	histidine kinase	NA	NA	NA	NA	NA
WP_000198301.1|4494835_4496395_+	stage V sporulation protein B	NA	NA	NA	NA	NA
WP_000454821.1|4496475_4497123_-	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_000349148.1|4497226_4497610_+	TIGR04086 family membrane protein	NA	NA	NA	NA	NA
WP_069356229.1|4497646_4497907_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	44.8	7.4e-06
WP_000125365.1|4497934_4499074_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	42.3	1.1e-82
WP_000354014.1|4499086_4500139_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_000970410.1|4500158_4500359_-	DUF2905 domain-containing protein	NA	NA	NA	NA	NA
WP_000344450.1|4500355_4501357_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	26.3	6.8e-07
WP_000464511.1|4501362_4501980_-	Holliday junction DNA helicase RuvA	NA	NA	NA	NA	NA
WP_000823606.1|4502168_4503113_+	iron-hydroxamate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_069356230.1|4503124_4503655_-	BofC protein	NA	NA	NA	NA	NA
WP_069356231.1|4504085_4504520_+	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016080194.1|4504553_4505201_-	spore cortex protein	NA	NA	NA	NA	NA
WP_069356232.1|4505380_4507315_-|coat	spore coat assembly protein ExsA	coat	NA	NA	NA	NA
WP_069356233.1|4507540_4508647_-	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_069356234.1|4508677_4509511_-	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_069356235.1|4509530_4511060_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_069356236.1|4511212_4512355_+	aminotransferase class V-fold PLP-dependent enzyme	NA	A0A1X7QGF3	Faustovirus	28.6	2.1e-28
WP_053563610.1|4512354_4512897_+	transcription repressor NadR	NA	NA	NA	NA	NA
WP_053563609.1|4512976_4513624_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_000621693.1|4513784_4514636_-	prephenate dehydratase	NA	NA	NA	NA	NA
WP_069356237.1|4514732_4516646_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_069356238.1|4516695_4518618_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000114529.1|4518592_4519369_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.4	1.3e-29
WP_069356239.1|4519462_4520545_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_002082113.1|4520534_4521242_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_000497127.1|4521382_4522669_-	GTPase ObgE	NA	NA	NA	NA	NA
WP_001003587.1|4522668_4523217_-	sporulation protein	NA	NA	NA	NA	NA
WP_000944957.1|4523280_4523571_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_001993153.1|4523574_4523919_-|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_000270907.1|4523930_4524239_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_069356240.1|4524408_4525797_-	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
WP_000599064.1|4525864_4526725_-	stage IV sporulation protein SpoIVFB	NA	NA	NA	NA	NA
WP_000797475.1|4526717_4527464_-	stage IV sporulation protein SpoIVFA	NA	NA	NA	NA	NA
WP_000503309.1|4527597_4528395_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_000391521.1|4528397_4529084_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_000975765.1|4529119_4529665_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_001135487.1|4529679_4530531_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_000466736.1|4530572_4531592_-	rod shape-determining protein MreB	NA	NA	NA	NA	NA
WP_069356241.1|4532025_4533447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069356242.1|4533639_4536447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061688026.1|4536476_4538240_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_069356243.1|4538226_4538979_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080449851.1|4539519_4539951_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_061688029.1|4540260_4540536_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069354782.1|4540988_4542284_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	27.5	3.5e-11
WP_157452921.1|4542566_4543466_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	37.3	1.5e-24
WP_069354784.1|4543420_4543690_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_061688066.1|4545414_4545912_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061688030.1|4546305_4546524_-	hypothetical protein	NA	H0USV5	Bacillus_phage	66.2	6.8e-21
WP_000645584.1|4547998_4548121_-	DUF3983 domain-containing protein	NA	NA	NA	NA	NA
WP_061688031.1|4548375_4548621_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069356244.1|4551913_4552255_-	alkylphosphonate utilization protein	NA	NA	NA	NA	NA
WP_069356245.1|4552392_4552632_-	D-alanine--poly(phosphoribitol) ligase subunit DltC	NA	NA	NA	NA	NA
WP_069356246.1|4553284_4555048_-	sulfate permease	NA	A0A2H4J153	uncultured_Caudovirales_phage	24.2	6.8e-34
WP_069356247.1|4555148_4555580_-	DNA mismatch repair protein	NA	NA	NA	NA	NA
WP_069356248.1|4555581_4555935_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_069356249.1|4556244_4557012_+	C39 family peptidase	NA	NA	NA	NA	NA
WP_069354786.1|4558517_4559630_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_069356251.1|4560228_4563303_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	23.1	3.4e-41
WP_084746238.1|4563623_4564250_-	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_029443367.1|4564296_4564872_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_069356252.1|4565105_4566056_-	stage II sporulation protein B	NA	NA	NA	NA	NA
WP_069356253.1|4566220_4567522_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_000072222.1|4567615_4570261_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	43.1	1.5e-165
WP_069356254.1|4570748_4571774_-|coat	spore coat protein YsxE	coat	NA	NA	NA	NA
4570728:4570751	attR	CCCACTGATTAAAGTTTCACTTTA	NA	NA	NA	NA
WP_157452936.1|4571840_4572851_-	stage VI sporulation protein D	NA	NA	NA	NA	NA
WP_000712942.1|4572931_4574218_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	A0A1V0SKB7	Klosneuvirus	34.1	1.7e-05
WP_069356256.1|4574217_4575207_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_069356257.1|4575227_4575980_-	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_016080168.1|4575982_4576912_-	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_000009005.1|4576927_4577761_-	cytochrome c assembly protein	NA	NA	NA	NA	NA
WP_069356258.1|4577778_4579113_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_000133921.1|4579528_4579981_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000359774.1|4579983_4580400_+	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
WP_000869118.1|4580434_4581031_-	ribosome biogenesis GTP-binding protein YsxC	NA	NA	NA	NA	NA
WP_000097288.1|4581027_4583358_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	43.5	9.5e-177
WP_000119173.1|4583540_4585211_-|protease	ATP-dependent protease LonB	protease	E3T4F6	Cafeteria_roenbergensis_virus	33.5	8.7e-15
WP_000472289.1|4585317_4586577_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	66.3	1.0e-148
>prophage 13
NZ_CP015250	Bacillus thuringiensis Bt18247, complete genome	5610045	4635566	4643251	5610045		Bacillus_phage(33.33%)	9	NA	NA
WP_069356272.1|4635566_4636490_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	44.0	9.0e-46
WP_069356273.1|4636615_4637551_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	25.0	3.1e-22
WP_000018029.1|4637552_4638245_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	38.2	3.7e-36
WP_001014310.1|4638587_4638782_+	YwbE family protein	NA	NA	NA	NA	NA
WP_053563583.1|4638820_4640020_-	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	41.0	3.6e-71
WP_000587818.1|4640314_4640638_+	heme oxygenase	NA	NA	NA	NA	NA
WP_069356274.1|4640710_4641475_-	class B sortase	NA	NA	NA	NA	NA
WP_069356275.1|4641507_4642278_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.1	7.6e-14
WP_001036841.1|4642267_4643251_-	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.9	4.2e-17
>prophage 14
NZ_CP015250	Bacillus thuringiensis Bt18247, complete genome	5610045	5043715	5084286	5610045	transposase,coat,protease	Bacillus_virus(14.29%)	48	NA	NA
WP_000614218.1|5043715_5044717_-|coat	spore coat protein CotS	coat	NA	NA	NA	NA
WP_000665102.1|5044837_5045329_+	phosphatidylglycerophosphatase A	NA	G3MBC5	Bacillus_virus	54.5	4.6e-41
WP_069356408.1|5045352_5045832_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_063548939.1|5045994_5047098_+	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_069356409.1|5047042_5048389_+	adenine/guanine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000241506.1|5048394_5049507_+|protease	cysteine protease StiP family protein	protease	NA	NA	NA	NA
WP_000575380.1|5049503_5050319_+	HAD hydrolase family protein	NA	NA	NA	NA	NA
WP_069356410.1|5050875_5051457_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000276470.1|5051645_5052410_-	TIGR01457 family HAD-type hydrolase	NA	NA	NA	NA	NA
WP_000503347.1|5052517_5053150_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000274010.1|5053230_5053671_-	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_000439090.1|5053818_5054790_+	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_000392613.1|5054806_5055073_+	DUF3055 domain-containing protein	NA	NA	NA	NA	NA
WP_001174588.1|5055446_5055944_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000435946.1|5055989_5056298_-	YutD family protein	NA	NA	NA	NA	NA
WP_000744131.1|5056416_5056995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000178777.1|5057029_5057764_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_069356411.1|5057864_5058680_+|protease	YhfC family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_069356412.1|5058705_5059137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069356413.1|5059270_5059825_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_069356414.1|5059899_5060379_+	YbaK/EbsC family protein	NA	NA	NA	NA	NA
WP_000166367.1|5060399_5061296_-	lipoyl synthase	NA	NA	NA	NA	NA
WP_069356415.1|5061485_5062469_+	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_000021807.1|5062542_5063274_-	sporulation protein YunB	NA	NA	NA	NA	NA
WP_000248467.1|5063328_5063631_-	DUF1805 domain-containing protein	NA	NA	NA	NA	NA
WP_084746263.1|5063696_5065088_-	bifunctional metallophosphatase/5'-nucleotidase	NA	NA	NA	NA	NA
WP_001118824.1|5065638_5067036_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_000009523.1|5067084_5067516_-	iron-sulfur cluster assembly scaffold protein SufU	NA	A0A0K1LS29	Mycobacterium_phage	37.6	1.5e-14
WP_069356417.1|5067505_5068726_-	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	47.8	1.8e-118
WP_000152173.1|5068725_5070018_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_000929163.1|5070033_5070819_-	Fe-S cluster assembly ATPase SufC	NA	A0A2R8FG22	Brazilian_cedratvirus	26.1	7.0e-07
WP_000722397.1|5071057_5071864_-	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_053563423.1|5071937_5072750_-	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000359401.1|5072773_5073439_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000601791.1|5073431_5074457_-	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.1	1.0e-29
WP_069356418.1|5074868_5075213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000568174.1|5075365_5075665_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_000640870.1|5075677_5076022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069354853.1|5076731_5077877_+|transposase	IS110 family transposase	transposase	Q9JMN8	Wolbachia_phage	28.5	1.7e-41
WP_000026896.1|5078079_5078463_-	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_000218968.1|5078504_5078870_-	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	48.6	5.1e-21
WP_000826910.1|5079364_5079892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000713773.1|5080036_5080684_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_000666168.1|5080749_5081763_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_106823632.1|5081785_5082985_-	L-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_001002981.1|5082981_5083230_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_001180555.1|5083243_5083429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069356419.1|5083572_5084286_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 15
NZ_CP015250	Bacillus thuringiensis Bt18247, complete genome	5610045	5184459	5262386	5610045	holin,terminase,transposase,capsid,tail,protease,head,portal,integrase	Bacillus_phage(73.58%)	85	5175948:5175966	5264664:5264682
5175948:5175966	attL	CGAGCCCTGCCATCGCCAT	NA	NA	NA	NA
WP_069356453.1|5184459_5184828_-|holin	CidA/LrgA family holin-like protein	holin	NA	NA	NA	NA
WP_069356454.1|5185177_5186128_+	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_000103951.1|5186179_5187475_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	75.4	1.1e-182
WP_001231158.1|5187505_5189035_-	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_001231038.1|5189031_5189787_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_001036331.1|5189819_5191004_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_000161234.1|5191143_5192148_-	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_001258185.1|5192174_5193203_-	gapA transcriptional regulator CggR	NA	NA	NA	NA	NA
WP_000869726.1|5193338_5193584_-	glutaredoxin family protein	NA	NA	NA	NA	NA
WP_000647953.1|5193593_5194901_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_000216166.1|5195439_5195646_+	DUF1657 domain-containing protein	NA	NA	NA	NA	NA
WP_001228545.1|5195739_5196225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000095399.1|5196254_5196731_+	stage V sporulation protein AC	NA	NA	NA	NA	NA
WP_000938970.1|5196731_5197748_+	stage V sporulation protein AD	NA	NA	NA	NA	NA
WP_000575919.1|5197744_5198095_+	stage V sporulation protein AE	NA	NA	NA	NA	NA
WP_000215916.1|5198106_5198313_+	DUF1657 domain-containing protein	NA	NA	NA	NA	NA
WP_069356455.1|5198333_5199203_+	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_001049162.1|5199443_5200025_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	56.5	1.3e-55
WP_000250307.1|5200426_5200675_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_000006566.1|5200698_5201649_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	38.4	1.3e-52
WP_000712187.1|5201737_5202691_-	YvcK family protein	NA	A1IMD5	Streptococcus_phage	43.1	2.6e-64
WP_000138459.1|5202694_5203576_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.9	4.6e-07
WP_001190080.1|5203596_5204055_-	8-oxo-dGTP diphosphatase	NA	NA	NA	NA	NA
WP_000455196.1|5204284_5205091_-	DUF368 domain-containing protein	NA	NA	NA	NA	NA
WP_069356457.1|5205423_5206299_+	cytosolic protein	NA	I7ILW0	Bacillus_phage	81.9	4.3e-122
WP_069356458.1|5206301_5206910_-	hypothetical protein	NA	A0A0S2GLL8	Bacillus_phage	89.6	5.3e-103
WP_069356459.1|5206899_5208066_-	DNA translocase FtsK	NA	W8CYG2	Bacillus_phage	81.6	4.0e-184
WP_069356460.1|5208076_5208397_-	hypothetical protein	NA	A0A0S2GLK1	Bacillus_phage	71.7	4.5e-37
WP_157452938.1|5208414_5208546_-	hypothetical protein	NA	W8CYT8	Bacillus_phage	90.7	4.2e-18
WP_069356461.1|5208859_5209084_+	helix-turn-helix transcriptional regulator	NA	A0A1B1P883	Bacillus_phage	79.7	2.7e-28
WP_069356462.1|5210181_5210382_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069356463.1|5210747_5211938_+	peptidase S8	NA	A0A1B0T6A2	Bacillus_phage	74.2	3.5e-167
WP_069356464.1|5212509_5212707_+	hypothetical protein	NA	A0A1B0T6A3	Bacillus_phage	93.7	3.3e-22
WP_069356465.1|5212793_5213546_-	N-acetylmuramoyl-L-alanine amidase	NA	S5M842	Bacillus_phage	79.3	1.1e-73
WP_069356667.1|5213545_5213752_-	hypothetical protein	NA	D2XR32	Bacillus_phage	83.3	3.9e-26
WP_069356466.1|5213760_5214042_-	hypothetical protein	NA	D2XR31	Bacillus_phage	75.8	2.9e-32
WP_069356467.1|5215263_5217690_-	endopeptidase	NA	A0A1B1P770	Bacillus_phage	81.6	0.0e+00
WP_069356468.1|5217686_5218370_-|tail	phage tail protein	tail	A0A1C8EA72	Bacillus_phage	82.7	6.5e-110
WP_069356668.1|5218371_5220777_-|tail	phage tail tape measure protein	tail	D2XR26	Bacillus_phage	87.8	2.5e-111
WP_069356469.1|5222407_5222869_-	hypothetical protein	NA	A0A1B1P772	Bacillus_phage	79.7	3.6e-64
WP_069356470.1|5222940_5223525_-|tail	phage tail protein	tail	A0A1B1P778	Bacillus_phage	83.8	2.2e-90
WP_084746273.1|5223525_5223951_-	hypothetical protein	NA	A0A1B1P769	Bacillus_phage	82.9	2.7e-61
WP_069356670.1|5223937_5224315_-	hypothetical protein	NA	A0A1B1P759	Bacillus_phage	92.8	8.4e-59
WP_069356471.1|5224331_5224688_-|head	phage head closure protein	head	A0A1B1P760	Bacillus_phage	78.8	1.1e-47
WP_069356472.1|5224668_5224965_-	hypothetical protein	NA	A0A1B1P751	Bacillus_phage	86.7	6.2e-41
WP_069356473.1|5224969_5225431_-	hypothetical protein	NA	X2KQD1	Enterococcus_phage	37.2	8.5e-13
WP_069356474.1|5225518_5226676_-|capsid	phage major capsid protein	capsid	A0A1B1P752	Bacillus_phage	43.0	1.4e-83
WP_069356475.1|5226716_5227430_-|protease	Clp protease ClpP	protease	A0A2H4JC91	uncultured_Caudovirales_phage	53.7	1.5e-56
WP_069356476.1|5227416_5228583_-|portal	phage portal protein	portal	A0A1B1P754	Bacillus_phage	82.6	7.3e-186
WP_084746419.1|5228594_5230211_-|terminase	terminase large subunit	terminase	A0A1B1P766	Bacillus_phage	71.7	3.3e-237
WP_069356477.1|5230242_5230764_-	RNA polymerase subunit sigma-70	NA	E2ELI1	Clostridium_phage	46.2	3.1e-27
WP_069356672.1|5230952_5231261_-	hypothetical protein	NA	A0A1B1P767	Bacillus_phage	82.7	1.6e-39
WP_069356479.1|5231263_5231611_-	HNH endonuclease	NA	A0A1B1P757	Bacillus_phage	51.3	3.6e-24
WP_157452939.1|5232086_5233100_-	DUF2974 domain-containing protein	NA	NA	NA	NA	NA
WP_069354777.1|5233877_5235173_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	27.1	1.9e-09
WP_069354776.1|5235162_5235915_+	AAA family ATPase	NA	A0A059NT77	Lactococcus_phage	46.9	7.8e-56
WP_069356481.1|5236279_5236822_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B1P746	Bacillus_phage	98.9	2.1e-95
WP_069356482.1|5236818_5237289_-	ArpU family transcriptional regulator	NA	A0A1B1P744	Bacillus_phage	61.2	8.3e-48
WP_157452940.1|5237585_5237717_-	DUF3983 domain-containing protein	NA	A0A1B0T6D3	Bacillus_phage	88.4	6.5e-11
WP_069356484.1|5238341_5239139_-	phage antirepressor KilAC domain-containing protein	NA	A0A1Q1PVZ8	Staphylococcus_phage	52.5	3.3e-73
WP_069356485.1|5239352_5239751_-	hypothetical protein	NA	A0A1B0T6B6	Bacillus_phage	96.2	8.8e-67
WP_069356486.1|5239785_5239953_-	DUF3954 domain-containing protein	NA	A0A0S2GLF5	Bacillus_phage	77.8	6.0e-17
WP_069356487.1|5240025_5240292_-	hypothetical protein	NA	A0A0S2GLK4	Bacillus_phage	89.8	9.8e-38
WP_069356488.1|5240288_5240573_-	hypothetical protein	NA	A0A1B1P7W1	Bacillus_phage	50.5	3.5e-17
WP_069356489.1|5240545_5241451_-	ATP-binding protein	NA	A0A1B0T6C3	Bacillus_phage	62.1	9.9e-90
WP_069356490.1|5241401_5242250_-	replication protein	NA	A0A0H4IPD8	Staphylococcus_phage	58.6	2.4e-21
WP_069356492.1|5242684_5243005_-	hypothetical protein	NA	A0A0S2GLB6	Bacillus_phage	67.3	2.9e-28
WP_023523419.1|5243511_5243700_-	helix-turn-helix transcriptional regulator	NA	W8CYN7	Bacillus_phage	90.3	5.7e-24
WP_023523420.1|5243778_5243982_-	helix-turn-helix transcriptional regulator	NA	A0A0A7AQV9	Bacillus_phage	59.1	4.0e-15
WP_023523421.1|5244142_5244502_+	helix-turn-helix transcriptional regulator	NA	H0UST7	Bacillus_phage	38.5	3.3e-12
WP_157452941.1|5244831_5244978_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069356673.1|5245017_5246178_-	helix-turn-helix transcriptional regulator	NA	A0A0A7AQH4	Bacillus_phage	60.7	1.9e-125
WP_069356493.1|5246845_5247907_+|integrase	site-specific integrase	integrase	A0A0S2GLI2	Bacillus_phage	82.7	3.2e-164
WP_001288078.1|5248144_5249101_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	53.6	1.4e-89
WP_000517723.1|5249186_5250698_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_069356494.1|5250836_5251349_-	acetyltransferase	NA	NA	NA	NA	NA
WP_069356495.1|5251382_5252033_-	pyrophosphatase PpaX	NA	NA	NA	NA	NA
WP_069356496.1|5252100_5252913_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_001127251.1|5252937_5253867_-	HPr(Ser) kinase/phosphatase	NA	NA	NA	NA	NA
WP_001267308.1|5254023_5254404_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_069356497.1|5254592_5257469_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	57.2	0.0e+00
WP_016118880.1|5257474_5259451_-	excinuclease ABC subunit B	NA	NA	NA	NA	NA
WP_069356498.1|5259601_5260033_-	DUF4362 domain-containing protein	NA	NA	NA	NA	NA
WP_053563372.1|5260078_5260699_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069354786.1|5261273_5262386_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
5264664:5264682	attR	CGAGCCCTGCCATCGCCAT	NA	NA	NA	NA
>prophage 16
NZ_CP015250	Bacillus thuringiensis Bt18247, complete genome	5610045	5555104	5608907	5610045	holin,tRNA,transposase,protease,integrase	Streptococcus_phage(11.76%)	48	5604315:5604330	5609024:5609039
WP_000168869.1|5555104_5555797_-|holin	antiholin-like protein LrgB	holin	NA	NA	NA	NA
WP_053563271.1|5555832_5556264_-|holin	antiholin-like murein hydrolase modulator LrgA	holin	NA	NA	NA	NA
WP_000921848.1|5556396_5557137_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_069354786.1|5557728_5558841_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_069356586.1|5560787_5562086_+	MFS transporter	NA	NA	NA	NA	NA
WP_001242450.1|5562138_5563707_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	23.9	1.3e-15
WP_000047620.1|5564067_5565138_-	nitric oxide synthase oxygenase	NA	NA	NA	NA	NA
WP_000094037.1|5565355_5565982_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	53.2	2.6e-57
WP_100910525.1|5566070_5566964_-	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_000540540.1|5567060_5567651_-	acetamide transporter	NA	NA	NA	NA	NA
WP_069356587.1|5568022_5568424_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053563268.1|5568979_5569996_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	51.6	3.6e-96
WP_069356588.1|5570181_5570829_-	hemolysin III family protein	NA	NA	NA	NA	NA
WP_069356589.1|5570993_5571554_+	DUF1836 domain-containing protein	NA	NA	NA	NA	NA
WP_069356590.1|5571702_5572941_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069356591.1|5573184_5574630_-	ATP-dependent RNA helicase DbpA	NA	A0A1V0SBR7	Catovirus	34.4	1.3e-59
WP_069356592.1|5575104_5576088_+	GMP reductase	NA	G3MBI2	Bacillus_virus	84.4	1.7e-159
WP_069356593.1|5576225_5578043_+	oligoendopeptidase F	NA	A0A1X9I5X5	Streptococcus_phage	38.7	2.6e-121
WP_069356594.1|5578080_5578959_-	radical SAM protein	NA	NA	NA	NA	NA
WP_069356595.1|5579180_5581199_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_069356596.1|5581278_5581779_-	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_001052833.1|5581838_5582024_-	CxxH/CxxC protein	NA	NA	NA	NA	NA
WP_000008031.1|5582077_5583253_-|protease	serine protease	protease	W5SAB9	Pithovirus	31.9	1.0e-09
WP_000522837.1|5583316_5584111_-	MBL fold metallo-hydrolase	NA	A0A0C5AJ83	Bacteriophage	35.3	6.1e-43
WP_000383720.1|5584094_5584937_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069356597.1|5584917_5586234_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000755367.1|5586230_5588072_-	cell wall metabolism sensor histidine kinase WalK	NA	W8CYF6	Bacillus_phage	35.0	8.9e-37
WP_000971865.1|5588075_5588783_-	cell wall metabolism DNA-binding response regulator WalR	NA	W8CYM9	Bacillus_phage	42.7	7.6e-45
WP_000100230.1|5589576_5590866_-	adenylosuccinate synthase	NA	L7Y4J5	Megavirus	36.2	9.5e-70
WP_001286147.1|5591081_5592431_-	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	52.3	2.5e-121
WP_000864223.1|5592458_5592905_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_001113779.1|5592901_5594875_-	DHH family phosphoesterase	NA	NA	NA	NA	NA
WP_053563260.1|5594953_5595889_-	YybS family protein	NA	NA	NA	NA	NA
WP_000918873.1|5595969_5596203_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_002094213.1|5596248_5596770_-	single-stranded DNA-binding protein	NA	A0A290GHL8	Caldibacillus_phage	61.8	4.0e-51
WP_001233781.1|5596796_5597087_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_069356598.1|5597278_5598379_-	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_000435486.1|5598494_5598692_-	DUF951 domain-containing protein	NA	NA	NA	NA	NA
WP_000365111.1|5598712_5599594_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_053563259.1|5599853_5600450_+|protease	spore protease YyaC	protease	A0A0A8WIQ6	Clostridium_phage	38.8	1.1e-23
WP_053563258.1|5600470_5601328_-	stage 0 sporulation protein Spo0J	NA	I3NLC2	Bifidobacterium_phage	34.4	2.5e-18
WP_113303242.1|5601314_5602103_-	sporulation initiation inhibitor protein Soj	NA	Q8JL10	Natrialba_phage	29.7	6.3e-24
WP_000799016.1|5602266_5603139_-	nucleoid occlusion protein	NA	S5VTK0	Leptospira_phage	36.4	9.1e-16
WP_001019628.1|5603244_5603964_-	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
WP_069356599.1|5603986_5605876_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
5604315:5604330	attL	TCATATGTCATCTCTG	NA	NA	NA	NA
WP_000393762.1|5605922_5607299_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE	tRNA	NA	NA	NA	NA
WP_000022795.1|5607525_5608143_-	protein jag	NA	NA	NA	NA	NA
WP_000727740.1|5608139_5608907_-|integrase	YidC family membrane integrase SpoIIIJ	integrase	NA	NA	NA	NA
5609024:5609039	attR	TCATATGTCATCTCTG	NA	NA	NA	NA
>prophage 1
NZ_CP015253	Bacillus thuringiensis Bt18247 plasmid p113275, complete sequence	113275	20494	66375	113275	integrase,transposase	Bacillus_phage(50.0%)	41	20378:20437	38629:40214
20378:20437	attL	AAGAGATAATATGAAGTGCCCCCCTAGATTATCAAGTCAGGGATTTTAACCCATAATAAT	NA	NA	NA	NA
WP_069354786.1|20494_21607_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_069356840.1|24091_25390_+	hypothetical protein	NA	NA	NA	NA	NA
WP_084746464.1|25423_26209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069356841.1|26319_26766_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069356842.1|26909_27344_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069356843.1|27792_28491_-	hypothetical protein	NA	A0A1B1P7T2	Bacillus_phage	44.7	7.2e-48
WP_069356844.1|28496_29678_-	DNA translocase FtsK	NA	A0A1B1P7T5	Bacillus_phage	39.4	2.8e-68
WP_069356845.1|29999_30473_+	DUF559 domain-containing protein	NA	NA	NA	NA	NA
WP_069356846.1|30869_31160_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069356847.1|31603_31891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069356848.1|31966_32197_-	DUF2187 domain-containing protein	NA	NA	NA	NA	NA
WP_029437091.1|32246_32474_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157452962.1|32517_32715_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069356850.1|32837_33041_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_069356851.1|33180_33753_-|integrase	tyrosine-type recombinase/integrase	integrase	D2XR58	Bacillus_phage	42.4	7.0e-33
WP_069354783.1|34196_34949_-	AAA family ATPase	NA	A0A059NT77	Lactococcus_phage	46.5	3.5e-56
WP_069354782.1|34938_36234_-|transposase	IS21 family transposase	transposase	A0A059NT83	Lactococcus_phage	31.8	2.2e-42
WP_069356852.1|36659_37070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069354786.1|37458_38571_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_069356853.1|38689_39199_-	DUF4367 domain-containing protein	NA	NA	NA	NA	NA
WP_084746043.1|39472_40726_+|transposase	transposase	transposase	NA	NA	NA	NA
38629:40214	attR	ATTATTATGGGTTAAAATCCCTGACTTGATAATCTAGGGGGGCACTTCATATTATCTCTTTTTATAATTTCTGCATTGATTGAGCTATTGTAATTAATTCTTGTTTAGAAATTCTTGAACTAAATAACTCAATCATTGTTCCATCTTGTACCCACATTAATTGCCCACCTTGTACATCTTTAATTCTTTTTGTTGGTGTTAACGGATGAAACACACCATTCATATTGTTTATTTTCACTCTCTCGCCATGTTCCCCAGGTTGAATATTATTGCCTGTTGCCGCACTTTCAATAACTGCAAATTTTAATTGCGTTCCTGTTCTATTCAAAAAATGTATTTGTACTTTTTCTATATTTTTATGTACTTGCTCTGGATATTTTAATTCTATATTCCAATTCTTAGCTATTTCTTTAGGAATAAAACAATTAAAAGAAGTCTTTCCTTTTAATTTATTCAAAGAAAATCCTTTATTAACTACATTCACATTTTCAGCATAAGCATTGATATTAAACTGACTACCTGTCATGAACAGAAATAATGCAATCATTAACTTGAAAACAATATTTTTCATATGTTATCTCCTACTACAACGGATTTTACTAATAGTATTAGATTCCATTAGAAACTTTATACTAATTTCATGTTACTTTTTGTTTAACTTTATACAATTCACGTTGCTGAAATCTGATAAACAAAAGCCAATTGGATCTTGTTTTTCATTTGATAAGATAAGAAAGTATAAGTTTTTAAGCACGAAGTGCTTCCTTGGAAAGATTGCTGTATAAAGGATTGTGAACAATATTTGGAATTTCCATAATGAGTTAGATTGTGATATTTTTTAGTTATGGAAGCAAATATATTAAAACGTATTTTCTTTGATGAACATAGTCATTGGGAACGATTTAAAGATAGATATGGCGCGAGGATCCGTCCAGTTGTTTTGAAAGAAATTGAAAAATTTAGAGGGTGTGGAGACCCTGAAAATGGATTTAAATTGTTTGTATGTGAAGGCTGTCATCATGTTCGAAAAGTTCCTTATCGTTGTAAGGGCCGATTTTGTACAACTTGTTCTGTAGGGGAAAGTGAAGAATGGAGTAGGCTTCTTTCAGAAGACGTGCTTCAGGTGAATCATCGTCATGTGATTTTTACCGTAGATGAAGGACTTCGAGATATTTTTCTTTTGCACCGTCATTTATTAAAGATTTTTATGGATGAGGCCGCAAGGCTGTTGGTGGATTATTTTCAAAAGAAAATTAAGGTAACGCCCGGTATTATTTTAGGTCTTCACACCTTCGGCGCTAGAATTAATTTTAATCCGCATGTTCATATACTTGTTACAATGGGTGGGATGACAAAGACTGGAGAGTGGAAAGGGTATGATTTTCTTCCGTTTGAGATGCTTCGGAAACAGTGGCAAACCATCGTGTTAAAACTGATTCGAAAAGAGCTCACGGTGGCAGAAAAAAAGCCAATTCAATCGAAACTTCAAAAAGCATTTTCTGATAATGGGAAAGGCTTCTATGTACACGCTCCGAAACAGAAAGGAAATGTAAAAAAACAACTTCAGTATATTGGCCGCTATATTC	NA	NA	NA	NA
WP_157452921.1|41469_42369_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	37.3	1.5e-24
WP_069354784.1|42323_42593_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_069356890.1|42719_43034_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_002187663.1|43087_43276_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_069354786.1|43795_44908_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_069356854.1|45322_45547_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069356855.1|45543_46227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069356856.1|46800_47196_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069356857.1|47211_47595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069356858.1|47773_48343_-	recombinase family protein	NA	A0A219Y9V9	Aeromonas_phage	40.1	4.3e-30
WP_069356754.1|48584_49967_+	MmcB family DNA repair protein	NA	NA	NA	NA	NA
WP_069356771.1|50076_50472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069356755.1|50573_53546_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	25.5	1.6e-75
WP_084746466.1|53693_54212_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_069356760.1|54383_55421_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157452951.1|55702_56471_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_069356763.1|56932_57910_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069356764.1|58451_59639_+	pesticidal crystal protein Cry6Ba	NA	O64021	Bacillus_phage	34.3	1.4e-46
WP_069356676.1|61403_62294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_084746474.1|63381_66375_-|transposase	Tn3 family transposase	transposase	A0A125RQ78	Bacillus_phage	55.4	0.0e+00
>prophage 2
NZ_CP015253	Bacillus thuringiensis Bt18247 plasmid p113275, complete sequence	113275	86348	92837	113275	transposase,integrase	Bacillus_phage(66.67%)	6	84053:84068	95680:95695
84053:84068	attL	TGAAAGAAATTGAAAA	NA	NA	NA	NA
WP_069356860.1|86348_87134_+|integrase	tyrosine-type recombinase/integrase	integrase	S5M9V8	Brevibacillus_phage	31.6	1.0e-26
WP_069356872.1|87185_90203_-|transposase	Tn3 family transposase	transposase	A0A125RQ78	Bacillus_phage	99.1	0.0e+00
WP_069356873.1|90274_91195_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0A7AR08	Bacillus_phage	99.0	9.9e-170
WP_001007679.1|91350_91608_+	hypothetical protein	NA	A0A125RQ77	Bacillus_phage	90.6	9.5e-38
WP_002163075.1|91576_91840_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A125RQ76	Bacillus_phage	96.6	2.2e-42
WP_069356874.1|92213_92837_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	28.8	3.7e-11
95680:95695	attR	TTTTCAATTTCTTTCA	NA	NA	NA	NA
>prophage 1
NZ_CP015252	Bacillus thuringiensis Bt18247 plasmid p130548 sequence	130548	168	85796	130548	transposase	Macacine_betaherpesvirus(16.0%)	71	NA	NA
WP_069356772.1|168_363_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_069356684.1|492_1098_-	recombinase family protein	NA	I1ZBD6	Salisaeta_icosahedral_phage	32.0	2.4e-15
WP_157452921.1|1490_2390_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	37.3	1.5e-24
WP_069354784.1|2344_2614_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_157452953.1|3272_3554_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069354782.1|4025_5321_+|transposase	IS21 family transposase	transposase	A0A059NT83	Lactococcus_phage	31.8	2.2e-42
WP_069354783.1|5310_6063_+	AAA family ATPase	NA	A0A059NT77	Lactococcus_phage	46.5	3.5e-56
WP_069356777.1|7346_7730_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069356778.1|7877_9635_-	2-succinyl-5-enolpyruvyl-6-hydroxy-3- cyclohexene-1-carboxylic-acid synthase	NA	NA	NA	NA	NA
WP_069356779.1|9631_11026_-	isochorismate synthase	NA	NA	NA	NA	NA
WP_069356780.1|11190_11877_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	59.4	7.1e-72
WP_069356823.1|12679_12967_+	adhesin	NA	NA	NA	NA	NA
WP_084746135.1|13490_14363_-	recombinase family protein	NA	A0A219Y9V9	Aeromonas_phage	48.6	2.5e-37
WP_084746451.1|14521_17515_+|transposase	Tn3 family transposase	transposase	A0A125RQ78	Bacillus_phage	55.5	0.0e+00
WP_069356678.1|18859_19435_-	recombinase family protein	NA	A0A1V0E035	Clostridioides_phage	35.6	1.6e-24
WP_069356783.1|19786_20935_+	HBL/NHE enterotoxin family protein	NA	NA	NA	NA	NA
WP_069356784.1|20979_22170_+	HBL/NHE enterotoxin family protein	NA	NA	NA	NA	NA
WP_069356785.1|22252_23155_+	HBL/NHE enterotoxin family protein	NA	NA	NA	NA	NA
WP_069356786.1|23239_24088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069356788.1|26343_27285_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_069356789.1|27649_28006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001032326.1|28154_28382_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069356824.1|28812_29616_+	ADP ribosyltransferase	NA	Q331X8	Clostridium_botulinum_C_phage	28.7	2.4e-15
WP_069356791.1|31010_32201_-	C1 family peptidase	NA	A0A2K9L9R4	Tupanvirus	26.7	9.6e-16
WP_157452954.1|32571_33888_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069356780.1|33902_34589_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	59.4	7.1e-72
WP_069356793.1|35140_36058_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_069356794.1|36384_36966_+	recombinase family protein	NA	A0A219Y9V9	Aeromonas_phage	39.7	2.8e-29
WP_069356795.1|36986_37421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069356796.1|38348_39164_+	5'-nucleotidase, lipoprotein e(P4) family	NA	NA	NA	NA	NA
WP_030029980.1|40334_40520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069356797.1|41140_42925_+	acetyltransferase	NA	B5WZU0	Pseudomonas_phage	31.1	2.4e-39
WP_069356798.1|43058_43739_+	autotransporter	NA	NA	NA	NA	NA
WP_069356799.1|43759_44032_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069356800.1|44367_44844_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069356801.1|48060_48291_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069356803.1|48815_49928_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_157452955.1|51503_51677_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157452921.1|51709_52609_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	37.3	1.5e-24
WP_069354784.1|52563_52833_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_069356804.1|57754_60169_-	conjugal transfer protein TraE	NA	G3MBM1	Bacillus_virus	23.2	3.0e-08
WP_069356805.1|60505_60850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069356806.1|60850_61681_-	hypothetical protein	NA	NA	NA	NA	NA
WP_084746453.1|61746_62232_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069356808.1|62702_63173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016110563.1|63403_63619_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_069356809.1|63819_64317_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_069356810.1|64650_65595_+	Replicase RepFR55	NA	NA	NA	NA	NA
WP_016110568.1|67020_68211_+	ParM/StbA family protein	NA	NA	NA	NA	NA
WP_069356811.1|68217_68601_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157452956.1|68917_69055_-	Phr family secreted Rap phosphatase inhibitor	NA	NA	NA	NA	NA
WP_069356812.1|69056_70151_-	tetratricopeptide repeat protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	46.9	4.9e-83
WP_157452921.1|70694_71594_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	37.3	1.5e-24
WP_069354784.1|71548_71818_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_069356813.1|72305_73502_-	DUF3801 domain-containing protein	NA	NA	NA	NA	NA
WP_061685793.1|73765_74476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069356814.1|74492_75812_+	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_069356815.1|75898_76099_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157452957.1|76236_76395_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069354782.1|76477_77773_+|transposase	IS21 family transposase	transposase	A0A059NT83	Lactococcus_phage	31.8	2.2e-42
WP_069354783.1|77762_78515_+	AAA family ATPase	NA	A0A059NT77	Lactococcus_phage	46.5	3.5e-56
WP_000156990.1|78724_78910_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069356816.1|79011_80193_+	cell division protein FtsK	NA	H0USY1	Bacillus_phage	55.3	7.8e-127
WP_069356817.1|80131_80749_+	hypothetical protein	NA	Q2LIA9	Bacillus_phage	45.1	6.9e-34
WP_069356818.1|80758_80989_-	helix-turn-helix transcriptional regulator	NA	A0A0S2MVM0	Bacillus_phage	54.5	1.7e-17
WP_069356819.1|81847_82069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_084746457.1|82479_82674_-	DUF2187 domain-containing protein	NA	NA	NA	NA	NA
WP_157452958.1|82708_83320_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	49.5	3.0e-50
WP_069356772.1|83574_83769_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_069356684.1|83898_84504_-	recombinase family protein	NA	I1ZBD6	Salisaeta_icosahedral_phage	32.0	2.4e-15
WP_157452921.1|84896_85796_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	37.3	1.5e-24
>prophage 1
NZ_CP015251	Bacillus thuringiensis Bt18247 plasmid p174778, complete sequence	174778	467	87861	174778	integrase,protease,transposase	Macacine_betaherpesvirus(34.62%)	59	3473:3532	16635:17861
WP_157452921.1|467_1367_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	37.3	1.5e-24
WP_069354784.1|1321_1591_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_069356676.1|2469_3360_+	hypothetical protein	NA	NA	NA	NA	NA
3473:3532	attL	GTGAGGTGGTACAGTAAAACTGGAACACAGTATAGAGATAAATTATTCTATATGAAGAGG	NA	NA	NA	NA
WP_069354784.1|3540_3810_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_157452921.1|3764_4664_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	37.3	1.5e-24
WP_069356678.1|5286_5862_-	recombinase family protein	NA	A0A1V0E035	Clostridioides_phage	35.6	1.6e-24
WP_157452946.1|6034_6208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157452921.1|7185_8085_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	37.3	1.5e-24
WP_069354784.1|8039_8309_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_157452947.1|8349_8523_+	hypothetical protein	NA	S6AND0	Bacillus_phage	74.2	1.9e-05
WP_069356679.1|8495_9497_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_069356680.1|9900_11073_+|integrase	site-specific integrase	integrase	A0A142F1N9	Bacillus_phage	25.0	1.2e-05
WP_069356683.1|12540_13467_+|integrase	site-specific integrase	integrase	A0A1B1P793	Bacillus_phage	44.3	2.3e-65
WP_157452921.1|15502_16402_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	37.3	1.5e-24
WP_069354784.1|16356_16626_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_069356684.1|18634_19240_+	recombinase family protein	NA	I1ZBD6	Salisaeta_icosahedral_phage	32.0	2.4e-15
16635:17861	attR	CCTCTTCATATAGAATAATTTATCTCTATACTGTGTTCCAGTTTTACTGTACCACCTCACAATGAGTCCAATGTTCTACATTACAAAGGATATCTAATACAGTTCTCTCAGGTAAGCGTTGTATAATTTCTTTTTCCAACAATTTGCTACTTATTGACACAGTTTTTCGTACAAATCGTTTTAAAATTGGTTCCCCATCTTCTGTTATCATAACCTGGCCATTATTCGGATAATTTGAATCTACCGTATTCGCAACAGAAGTTAAGTTCTGTTTCAGTTGTTTAACAAATTGAGTAGGAGAGGAAGGGAAGTTAAGTTCTTTACAATATTCTTTAACTAACGGTTCACATTCTTCCCAAGATAATAACTGTTTCCTATAATCGGCGTATTTTTCAGAACCTTGTACACTCACATCACCTGTCTTTAATTCTGAAGCTAAATAGGAAAATATACAGATTTCAAGCCGTTTACGATACAATAAATTAGAACCTTTTCCAACTCGAAGAGTTTGTTTCCATTGCTCGTTAGCAAATGATAAATCAATCCTAGTAGGAAGGTGTTCTACCCTTCGATTTTCATTTAACAATAAAAATTGTAAAGCTTTTATGAGAGAATCATCCTGAGTTGTTGAATCTAATTTTAATAATGAAATCAATCGAAATAAGGTCTTTCTATGACTGTTATAAAATTTTTCTAGTAGAGGAAGATAGTTATTCCCGTTATACGAAGAAAGGGCTAAACAATCTTGTTGTAAAGAGTCTATGCCACCTCTTCTTTCGAATAATTCTGTTATTTCACTTCCTATTATATTCGTATCGTCATGCATATGAGTCGTATGTAAAACTTCACTCAATATAGAAATAAGATTTTCACTTATCGAGCGCTGTTTTTCTCGCAAAAGAGCTAATTCTTCTTTTCCCTTTTTATGTATCCTAGCAATCCTTTTTAAAAACATATCTATTAAGTGATCTCTTGTTATAATTTGCGAACGATAAATGACTGATAATAGGAGTGTATATCTTTTCGCCATAGTAAAATCTTTCATTTCCGATGCATCTAAAGCTAATGCTTCTAATGCGAAATTTTTGACTTTAGAATTTGGAACTTCTTTTAACAATTCTTCGATGTTTGACATAAACGATGTAATAAAATCTAATTTGTTTTGTAGCTCTTTCATGTGAGATATTGAAGGACTTTTAGGTAGTTCTTTAAAATAATTAAAACTGG	NA	NA	NA	NA
WP_069356685.1|22283_22856_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_157452921.1|23289_24189_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	37.3	1.5e-24
WP_069354784.1|24143_24413_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_069356686.1|24661_25573_-	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	31.4	8.7e-09
WP_069356687.1|25554_26664_-	polysaccharide pyruvyl transferase family protein	NA	A0A2H4UTU3	Bodo_saltans_virus	25.4	7.1e-05
WP_069356688.1|28877_29240_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069356689.1|29309_29657_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_069356690.1|31201_32200_+	glycosyltransferase family 1 protein	NA	L7RD44	Acanthamoeba_polyphaga_moumouvirus	41.6	1.0e-10
WP_069356691.1|32162_33260_+	polysaccharide pyruvyl transferase family protein	NA	NA	NA	NA	NA
WP_069354784.1|36167_36437_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_157452921.1|36391_37291_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	37.3	1.5e-24
WP_084746426.1|38131_38515_+	DUF418 domain-containing protein	NA	NA	NA	NA	NA
WP_069356693.1|38891_39482_+	DUF3967 domain-containing protein	NA	A0A1Z1LZN4	Bacillus_phage	31.6	1.2e-08
WP_069354784.1|41898_42168_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_157452921.1|42122_43022_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	37.3	1.5e-24
WP_069356695.1|43167_44244_-	CDP-glucose 4,6-dehydratase	NA	J7Q7J8	Aeropyrum_coil-shaped_virus	37.9	3.1e-13
WP_069356696.1|44259_45228_-	SDR family NAD(P)-dependent oxidoreductase	NA	A0A1V0SKV4	Klosneuvirus	29.2	7.3e-22
WP_069356697.1|45260_47375_-	glycosyl transferase	NA	NA	NA	NA	NA
WP_069356698.1|47394_48135_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_069356699.1|50225_50726_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069356700.1|50752_51247_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157452948.1|52698_52944_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_069354782.1|54159_55455_-|transposase	IS21 family transposase	transposase	A0A059NT83	Lactococcus_phage	31.8	2.2e-42
WP_069356704.1|56099_56525_+	hypothetical protein	NA	NA	NA	NA	NA
WP_084746428.1|59040_60639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069356707.1|61166_61610_-	hypothetical protein	NA	NA	NA	NA	NA
WP_127814282.1|62185_62236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065486709.1|62880_63198_-	hypothetical protein	NA	A0A2H4JAV2	uncultured_Caudovirales_phage	42.1	7.4e-16
WP_069356708.1|63992_64184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069356709.1|64410_64746_-|protease	protease inhibitor I42 family protein	protease	NA	NA	NA	NA
WP_078185372.1|66664_67252_-	methyltransferase	NA	NA	NA	NA	NA
WP_069356711.1|67688_68114_-	hypothetical protein	NA	NA	NA	NA	NA
WP_084746430.1|68372_71093_-	collagenase	NA	NA	NA	NA	NA
WP_069356712.1|71868_72144_-	hypothetical protein	NA	H0USV6	Bacillus_phage	49.5	2.4e-15
WP_069356769.1|73605_74103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069356713.1|74494_74713_-	hypothetical protein	NA	H0USV5	Bacillus_phage	64.9	2.0e-20
WP_157452921.1|75292_76192_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	37.3	1.5e-24
WP_069354784.1|76146_76416_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_069356716.1|78455_78680_+	hypothetical protein	NA	H0USX6	Bacillus_phage	77.8	2.9e-19
WP_157452921.1|81503_82403_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	37.3	1.5e-24
WP_069354784.1|82357_82627_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_069354786.1|85479_86592_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_069356720.1|87153_87861_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.5	9.3e-43
>prophage 1
NZ_CP015254	Bacillus thuringiensis Bt18247 plasmid p81952, complete sequence	81952	2696	63164	81952	bacteriocin,transposase	Streptococcus_phage(21.05%)	54	NA	NA
WP_069355686.1|2696_3809_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_000348470.1|5107_5338_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001106069.1|5534_6071_+	helix-turn-helix transcriptional regulator	NA	A0A0S2SXM8	Bacillus_phage	37.4	4.0e-06
WP_069356896.1|6397_7597_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157452921.1|9954_10854_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	37.3	1.5e-24
WP_069354784.1|10808_11078_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_000846305.1|11368_12565_+	ParM/StbA family protein	NA	NA	NA	NA	NA
WP_000532774.1|12578_12998_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000271589.1|13044_13320_+	hypothetical protein	NA	D2XQ08	Bacillus_virus	56.5	2.2e-16
WP_069356897.1|13724_14021_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000066815.1|14067_14397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000680007.1|14435_14696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069356898.1|14954_17804_+	Mobilization protein	NA	NA	NA	NA	NA
WP_069356899.1|17813_18476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000532062.1|18608_18905_+	hypothetical protein	NA	H0USY0	Bacillus_phage	43.7	5.8e-15
WP_000156991.1|18906_19092_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069356827.1|20523_22329_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	27.2	1.0e-29
WP_069356900.1|22919_23537_+	hypothetical protein	NA	Q2LIA9	Bacillus_phage	46.6	6.0e-38
WP_000468340.1|23541_23778_-	helix-turn-helix transcriptional regulator	NA	S5MBY6	Brevibacillus_phage	41.1	4.8e-12
WP_069355414.1|24391_25537_+|transposase	IS110 family transposase	transposase	Q9JMN8	Wolbachia_phage	28.5	8.3e-41
WP_157452963.1|26210_26456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069356720.1|26474_27182_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.5	9.3e-43
WP_069356684.1|27526_28132_+	recombinase family protein	NA	I1ZBD6	Salisaeta_icosahedral_phage	32.0	2.4e-15
WP_084746135.1|28841_29714_-	recombinase family protein	NA	A0A219Y9V9	Aeromonas_phage	48.6	2.5e-37
WP_069356720.1|30166_30874_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.5	9.3e-43
WP_069354776.1|31052_31805_-	AAA family ATPase	NA	A0A059NT77	Lactococcus_phage	46.9	7.8e-56
WP_069354777.1|31794_33090_-|transposase	IS21 family transposase	transposase	A0A059NT83	Lactococcus_phage	31.0	1.7e-42
WP_069356903.1|33922_34864_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_100248682.1|35299_35524_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069354784.1|35675_35945_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_157452921.1|35899_36799_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	37.3	1.5e-24
WP_084746481.1|36899_37241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069356720.1|37705_38413_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.5	9.3e-43
WP_069356906.1|38478_38667_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069356907.1|39068_39398_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000136353.1|39588_40131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069355686.1|41706_42819_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_061656737.1|43343_43574_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069356930.1|44156_44675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069356931.1|44902_46048_-	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_069356908.1|47227_48649_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_157452964.1|48713_49913_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_069356910.1|49954_51013_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_084746483.1|51242_52841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069356911.1|53372_53816_-	hypothetical protein	NA	NA	NA	NA	NA
WP_084746485.1|54400_54814_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_065486709.1|55053_55371_-	hypothetical protein	NA	A0A2H4JAV2	uncultured_Caudovirales_phage	42.1	7.4e-16
WP_069356913.1|55617_55824_+	DUF2187 domain-containing protein	NA	NA	NA	NA	NA
WP_069356915.1|57672_58311_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.4	2.7e-09
WP_069356916.1|58300_58849_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069356917.1|58862_59372_-	stage II sporulation protein M	NA	NA	NA	NA	NA
WP_069356918.1|59376_61083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016106960.1|61164_61488_-|bacteriocin	circular bacteriocin, circularin A/uberolysin family	bacteriocin	NA	NA	NA	NA
WP_069356919.1|62456_63164_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.0	2.7e-42
