The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP016176	Xenorhabdus hominickii strain ANU1, complete genome	4522699	3400	59735	4522699	transposase,plate,holin,protease,tail	Salmonella_phage(37.04%)	56	NA	NA
WP_069314916.1|3400_4018_-	phage repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	45.6	8.4e-48
WP_069314917.1|4256_4595_+	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	55.4	8.4e-26
WP_069314918.1|4687_6703_+	replication endonuclease	NA	F1BUM9	Cronobacter_phage	54.6	2.5e-186
WP_069314919.1|6816_7044_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069314920.1|7062_7299_+	DinI family protein	NA	A0A1S6L014	Salmonella_phage	42.1	1.4e-11
WP_069314921.1|7535_7739_+|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	56.7	2.9e-18
WP_069314922.1|7751_8288_+	endopeptidase	NA	H2DE61	Erwinia_phage	51.6	7.8e-18
WP_069314923.1|8455_9091_+|plate	phage baseplate assembly protein V	plate	A0A2I8TV69	Erwinia_phage	65.3	5.5e-71
WP_069314924.1|9087_9438_+|plate	baseplate assembly protein	plate	F1BUP4	Erwinia_phage	61.3	1.2e-30
WP_069314925.1|9460_10369_+|plate	baseplate assembly protein	plate	A0A0F7LCQ9	Escherichia_phage	73.2	3.3e-117
WP_069314926.1|10361_10970_+|tail	phage tail protein I	tail	F1BUP2	Erwinia_phage	67.3	3.4e-78
WP_084023285.1|13410_13956_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_084022915.1|14027_15314_-	hypothetical protein	NA	A0A1S6KZZ8	Salmonella_phage	55.6	9.0e-36
WP_069314928.1|15793_16603_+	DUF2829 domain-containing protein	NA	NA	NA	NA	NA
WP_157104576.1|16835_17003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069314929.1|17172_18348_+|tail	phage tail sheath protein	tail	F1BUU3	Erwinia_phage	72.3	3.8e-158
WP_069314930.1|18359_18878_+|tail	phage major tail tube protein	tail	F1BUU2	Erwinia_phage	64.9	8.0e-60
WP_069314931.1|18972_19281_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	55.8	7.4e-21
WP_071824073.1|19301_19424_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	66.7	5.7e-09
WP_069314932.1|19416_23019_+|tail	phage tail protein	tail	A0A1S6L010	Salmonella_phage	36.8	3.7e-10
WP_069314933.1|23015_23522_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	62.9	2.5e-42
WP_069314934.1|23518_25069_+	phage late control D family protein	NA	A0A0M5M5V5	Salmonella_phage	40.8	4.1e-91
WP_069314935.1|25138_25375_+	transcriptional regulator	NA	E5G6Q4	Salmonella_phage	67.7	2.0e-18
WP_069314936.1|25525_25744_-	YdcH family protein	NA	NA	NA	NA	NA
WP_069314937.1|26011_26488_+|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_069314938.1|26786_27494_+	aquaporin Z	NA	NA	NA	NA	NA
WP_069314939.1|27595_28039_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_084022916.1|28140_29361_-	MFS transporter	NA	NA	NA	NA	NA
WP_069314940.1|29471_30062_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_069314941.1|31326_32337_+	L-tyrosine/L-tryptophan isonitrile synthase family protein	NA	NA	NA	NA	NA
WP_069314942.1|32364_33264_+	TauD/TfdA family dioxygenase	NA	NA	NA	NA	NA
WP_069314943.1|33267_34551_+	rhabduscin glycosyltransferase	NA	NA	NA	NA	NA
WP_069314944.1|34890_35472_-	YceI family protein	NA	NA	NA	NA	NA
WP_069314945.1|35474_36047_-	cytochrome b	NA	NA	NA	NA	NA
WP_069314946.1|36501_37131_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_069314947.1|37514_39419_-	propionate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	31.4	7.3e-58
WP_069314948.1|39513_40965_-	bifunctional 2-methylcitrate dehydratase/aconitate hydratase	NA	NA	NA	NA	NA
WP_069314949.1|41075_42251_-	2-methylcitrate synthase	NA	NA	NA	NA	NA
WP_069314950.1|42243_43164_-	methylisocitrate lyase	NA	NA	NA	NA	NA
WP_069314951.1|43476_45141_+	propionate catabolism operon regulatory protein PrpR	NA	NA	NA	NA	NA
WP_069314952.1|46956_47298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069318368.1|47839_48253_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_069314953.1|48820_49033_+	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	72.9	7.1e-23
WP_145957488.1|49702_50062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_084022917.1|50015_50354_-	DUF2829 domain-containing protein	NA	NA	NA	NA	NA
WP_069314956.1|50335_50515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069314957.1|52997_53240_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157104577.1|53285_53979_+|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_069314960.1|54013_54262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145957517.1|54731_56147_+	site-specific DNA-methyltransferase	NA	A0A2K5B2C1	Erysipelothrix_phage	39.3	1.0e-80
WP_069314962.1|56201_56537_+|holin	phage holin, lambda family	holin	A0A1P8DTE4	Proteus_phage	50.0	1.7e-23
WP_069314963.1|56520_56922_+	structural protein	NA	L7P7L2	Pseudomonas_phage	58.6	5.3e-35
WP_069314964.1|57090_57780_+	hypothetical protein	NA	Q5G8R0	Enterobacteria_phage	70.9	4.6e-87
WP_069314965.1|57782_58163_+	hypothetical protein	NA	NA	NA	NA	NA
WP_084022918.1|58050_58314_+	peptidase	NA	U5P461	Shigella_phage	53.8	1.5e-14
WP_069314966.1|58952_59735_+	DNA-binding protein	NA	Q9MCN2	Enterobacteria_phage	52.2	6.0e-67
>prophage 2
NZ_CP016176	Xenorhabdus hominickii strain ANU1, complete genome	4522699	81999	87756	4522699	plate	Shigella_phage(33.33%)	7	NA	NA
WP_069314991.1|81999_82284_+	hypothetical protein	NA	A0A1W6JPH4	Morganella_phage	43.8	4.7e-14
WP_084022923.1|82574_83258_+	hypothetical protein	NA	A0A1V0DX27	Synechococcus_virus	32.3	2.3e-22
WP_069314992.1|83239_83785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_084023287.1|83807_84356_+|plate	phage baseplate assembly protein	plate	U5P081	Shigella_phage	36.8	4.4e-16
WP_069314994.1|84352_84799_+	hypothetical protein	NA	B5TK74	Pseudomonas_phage	53.1	1.3e-18
WP_069314995.1|85920_86517_+	YmfQ family protein	NA	A0A0C4UR33	Shigella_phage	31.1	1.5e-17
WP_069314996.1|86571_87756_+	hypothetical protein	NA	A0A1C9II52	Salmonella_phage	46.7	1.1e-11
>prophage 3
NZ_CP016176	Xenorhabdus hominickii strain ANU1, complete genome	4522699	523560	544790	4522699	terminase,integrase,holin,transposase	Enterobacteria_phage(21.05%)	33	541472:541531	548750:549531
WP_069315305.1|523560_523869_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_069315306.1|524833_525199_-	hypothetical protein	NA	A0A077KAW7	Edwardsiella_phage	42.5	7.2e-23
WP_084022955.1|525657_525921_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069315308.1|526060_527230_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_069315309.1|527340_527535_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069315310.1|527547_528045_-	hypothetical protein	NA	A0A190XCA2	Acinetobacter_phage	32.9	2.3e-11
WP_069315311.1|528048_528378_-	DUF2213 domain-containing protein	NA	A0A219YCD3	Aeromonas_phage	50.9	4.1e-09
WP_069315312.1|528380_528845_-	hypothetical protein	NA	A0A077KGU5	Edwardsiella_phage	47.6	1.3e-32
WP_157104588.1|530950_531103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069315313.1|531095_531494_+	antitermination protein	NA	A0A088CD47	Shigella_phage	48.8	9.6e-29
WP_069315314.1|531678_532119_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_069315315.1|532386_532581_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069315316.1|532739_532970_+	hypothetical protein	NA	K7PKT0	Enterobacteria_phage	38.0	3.5e-07
WP_069315317.1|533045_533261_+	hypothetical protein	NA	K7PJU3	Enterobacteria_phage	69.7	2.7e-22
WP_071933824.1|533532_533736_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069318387.1|533918_534233_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	58.0	5.2e-30
WP_069315318.1|534232_534634_+	structural protein	NA	A0A2H4J6R1	uncultured_Caudovirales_phage	55.9	5.5e-32
WP_069315319.1|534801_535380_+	antirepressor	NA	A0A2R2Z339	Escherichia_phage	72.6	4.0e-76
WP_069315320.1|535385_535766_+	hypothetical protein	NA	NA	NA	NA	NA
WP_084022957.1|535653_535914_+	peptidase	NA	B6SCZ0	Bacteriophage	63.0	3.1e-20
WP_157104589.1|536468_536618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069315322.1|536760_536973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069315323.1|537033_537384_+	HNH endonuclease	NA	A0A1W6JP27	Morganella_phage	75.0	3.3e-49
WP_069315324.1|537636_538098_+|terminase	phage terminase small subunit P27 family	terminase	K7PHI2	Enterobacteria_phage	69.4	1.9e-57
WP_069315327.1|540116_540527_+	hypothetical protein	NA	G0YQE7	Erwinia_phage	49.6	5.0e-33
WP_069315328.1|540523_540937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069315329.1|540933_541263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071933826.1|541274_541460_+	hypothetical protein	NA	A0A1P8DTH3	Proteus_phage	51.6	1.2e-13
541472:541531	attL	GGTCATGTATTAAATAGTTAGTTGTTGTGATATGCTTCCCGCCTTTTAAGGGTAAAGCAT	NA	NA	NA	NA
WP_157104580.1|541529_542223_+|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_069315330.1|542247_542562_+	DUF2591 domain-containing protein	NA	A0A1P8DTH6	Proteus_phage	38.9	7.8e-10
WP_069315331.1|542551_543193_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	62.4	5.2e-69
WP_071933909.1|543402_543750_+	helix-turn-helix domain-containing protein	NA	M1FJ59	Enterobacteria_phage	61.2	7.3e-33
WP_069315333.1|543626_544790_+|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	71.9	9.3e-165
548750:549531	attR	ATGCTTTACCCTTAAAAGGCGGGAAGCATATCACAACAACTAACTATTTAATACATGACCGAAATAGGTATGGGAATTGATTCAGACTACTTTGGCAAGGGCGTAGGTTCAAAGATGATGGAGTTTGCGATCGATTATGCATTTAATTGGTTAGGTTGTATCAGAATTGCATTGGGGGTGTTTAGTGATAATAAAAGAGCAATAGCCTTGTATTCAAAATTTTGATTTGAGGTTGAAGATATCCGACGCAAGCAAGCATTAAGGAATGGTCAATATTGCGATGTGATGGGGATGTCCTTAATTAATAGTCGGTTGATATGATTTTTTTACGATTTATGGCAATAATCTAGATAGAGGAAGCATCGGTTTGAGGGCTTCCTCTTTATTTTATATTAAGATAAAAAAGATATTATGATACGAAAACTAAAAACCTCGCTGTAATATCTTACATTCGTACTCTTGTGAATCTAGTTGTGTGGTCAACTGTGTCATAAGTATATTTTTATGTTTAAAATTATTGCAGATAAATAAATCAATTGCTGCATAATGGTATTCAGGCCATGTATGTATTGTGAAATGTGATTCGGCCAATATAATGACACCGCTCACTCCCCATGGTTTAAATTCATGAAAATGGTGGTTGACTATATTAAGATCACATTTACGGGCAATATTGAGCATGATCTCTTCAACAATAGGAATGGATTTTAATTTATTACTATCACAATCCTTCATTTCTATCACAATGTGAGTACCAAGTTGTTTGGTATCAAATATCTTGT	NA	NA	NA	NA
>prophage 4
NZ_CP016176	Xenorhabdus hominickii strain ANU1, complete genome	4522699	609575	615998	4522699		Proteus_phage(33.33%)	12	NA	NA
WP_069315381.1|609575_610619_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	46.7	1.5e-76
WP_069318391.1|610938_611202_-	pyocin activator protein PrtN	NA	A0A1W6JP35	Morganella_phage	59.0	4.7e-16
WP_069315382.1|611204_611519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157104590.1|611508_611685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069315383.1|611681_612182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069315384.1|612416_612920_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069315385.1|612916_613120_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069315386.1|613112_613292_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069315387.1|613288_613714_-	hypothetical protein	NA	G0YQE7	Erwinia_phage	48.1	9.9e-32
WP_069315388.1|613795_614098_-	hypothetical protein	NA	A0A1B0UY47	Roseobacter_phage	56.9	1.7e-17
WP_069315389.1|614362_615193_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	81.8	6.5e-120
WP_069315390.1|615185_615998_-	exodeoxyribonuclease VIII	NA	A0A1P8DTH1	Proteus_phage	60.3	3.7e-96
>prophage 5
NZ_CP016176	Xenorhabdus hominickii strain ANU1, complete genome	4522699	621118	715766	4522699	transposase,terminase,integrase,holin,tRNA,lysis	Edwardsiella_phage(20.0%)	110	617440:617490	707963:708013
617440:617490	attL	ATCATTTTCCTATATTCAGGTAATAAAAAGCCCCGCATTGGCGAGGCTGGT	NA	NA	NA	NA
WP_069315400.1|621118_621823_-	helix-turn-helix transcriptional regulator	NA	A0A2I6PIE7	Escherichia_phage	44.5	2.4e-46
WP_069315401.1|621926_622142_+	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	66.7	3.9e-21
WP_069318394.1|622522_623446_+	replication protein	NA	A5VW95	Enterobacteria_phage	77.8	2.0e-53
WP_099139758.1|623427_624153_+	DNA replication protein	NA	A0A2H4J1B6	uncultured_Caudovirales_phage	56.2	3.3e-67
WP_069318393.1|624160_624490_+	hypothetical protein	NA	A0A2R2YAW5	Pseudomonas_phage	58.5	3.3e-27
WP_069315403.1|624489_624846_+	DUF2591 domain-containing protein	NA	F8TVJ2	EBPR_siphovirus	37.2	9.8e-09
WP_145957450.1|624842_625127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_084022964.1|625123_625300_+	restriction alleviation protein, Lar family	NA	NA	NA	NA	NA
WP_069315405.1|625300_625774_+	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	49.0	6.2e-35
WP_069315406.1|625770_626439_+	serine/threonine-protein phosphatase	NA	Q71TJ1	Escherichia_phage	58.9	2.4e-72
WP_069318395.1|626618_627050_+	HNH endonuclease	NA	E7EKU5	Edwardsiella_phage	43.1	1.6e-29
WP_071933830.1|626985_627270_+	DUF1364 domain-containing protein	NA	A0A220NQY2	Salmonella_phage	78.7	4.7e-38
WP_069315408.1|627828_628665_+	antitermination protein	NA	M9NZB0	Enterobacteria_phage	46.9	1.5e-63
WP_069315409.1|628809_629124_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069315682.1|629361_629598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069315410.1|629566_629896_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_069315411.1|630142_631738_+	site-specific DNA-methyltransferase	NA	A0A2K5B2C1	Erysipelothrix_phage	33.1	3.4e-61
WP_084022966.1|631829_632177_+|holin	phage holin, lambda family	holin	NA	NA	NA	NA
WP_069315412.1|632176_632611_+	lysozyme	NA	A0A223W0U3	Agrobacterium_phage	59.2	5.9e-40
WP_069315413.1|632607_633084_+|lysis	lysis protein	lysis	NA	NA	NA	NA
WP_071933911.1|633133_633277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069315415.1|633825_634368_+	KilA-N domain-containing protein	NA	A0A2H4FQV0	Salmonella_phage	58.5	2.2e-52
WP_069315416.1|634632_634986_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_069315417.1|635000_635393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071933831.1|635409_635646_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071933832.1|635658_636291_+|terminase	terminase small subunit	terminase	A0A2R3UAN5	Myoviridae_environmental_samples	50.6	8.3e-43
WP_069315418.1|636488_637928_+|terminase	phage terminase large subunit	terminase	H9C0U8	Aeromonas_phage	38.8	1.2e-84
WP_084023293.1|638098_639496_+	DUF1073 domain-containing protein	NA	A0A192RWX3	Acinetobacter_phage	32.9	1.1e-58
WP_069318398.1|639479_640184_+	hypothetical protein	NA	A0A077KGU5	Edwardsiella_phage	40.4	1.7e-41
WP_069315420.1|640186_641419_+	DUF2213 domain-containing protein	NA	A0A219YCD3	Aeromonas_phage	33.7	7.0e-46
WP_069315421.1|641428_641917_+	hypothetical protein	NA	E2GLV4	Acinetobacter_phage	30.3	5.7e-07
WP_069315422.1|641996_643010_+	DUF2184 domain-containing protein	NA	Q2NPC4	Xanthomonas_phage	33.3	1.5e-46
WP_069315423.1|643075_643429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069315424.1|643428_643842_+	DUF4054 domain-containing protein	NA	NA	NA	NA	NA
WP_069315425.1|643845_644310_+	hypothetical protein	NA	A0A1V0DZD6	Acinetobacter_phage	34.2	3.0e-10
WP_069315426.1|644354_644735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069315427.1|644722_645007_-	type V toxin-antitoxin system endoribonuclease antitoxin GhoS	NA	NA	NA	NA	NA
WP_069315428.1|645195_645411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069315429.1|645478_645844_+	hypothetical protein	NA	A0A077KAW7	Edwardsiella_phage	42.5	9.4e-23
WP_069315430.1|645828_646377_+	hypothetical protein	NA	A0A077KC88	Edwardsiella_phage	29.2	6.3e-15
WP_069315431.1|646360_647839_+	DUF3383 domain-containing protein	NA	A0A1X9SFB3	Acinetobacter_phage	34.5	3.1e-64
WP_069315432.1|647838_648276_+	hypothetical protein	NA	Q2NPD1	Xanthomonas_phage	37.2	1.5e-19
WP_069315433.1|648275_648680_+	hypothetical protein	NA	H9C0W7	Aeromonas_phage	46.2	6.3e-20
WP_157104593.1|648676_648877_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069315435.1|648888_651042_+	hypothetical protein	NA	Q858G0	Salmonella_phage	44.0	9.5e-22
WP_069315436.1|651041_651857_+	hypothetical protein	NA	A0A077KGW3	Edwardsiella_phage	35.5	3.5e-33
WP_069318399.1|651856_652162_+	hypothetical protein	NA	A0A077K9U4	Edwardsiella_phage	50.5	9.2e-24
WP_069315437.1|652158_653016_+	hypothetical protein	NA	A0A077KC17	Edwardsiella_phage	32.1	8.4e-38
WP_069315438.1|653008_653701_+	oxidoreductase	NA	A0A077KAY0	Edwardsiella_phage	43.8	2.1e-39
WP_145957472.1|653700_654393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069315440.1|654893_655739_+	AAA family ATPase	NA	A0A1X9IGI7	Lactococcus_phage	35.4	1.5e-31
WP_069315441.1|655731_656127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069315442.1|656129_656804_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069315443.1|656928_657396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_084022971.1|657528_657813_-	Arc family DNA-binding protein	NA	H6WRU6	Salmonella_phage	66.0	6.0e-09
WP_071933834.1|657938_658115_+	Arc family DNA-binding protein	NA	I6R9A8	Salmonella_phage	49.1	3.8e-06
WP_069318400.1|658185_658890_+	DNA-binding protein	NA	G0ZND1	Cronobacter_phage	49.1	4.9e-44
WP_069315444.1|659131_660013_+	antirepressor	NA	I6S627	Salmonella_phage	43.9	3.6e-60
WP_157104594.1|660111_660285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069315445.1|660504_660855_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069315446.1|660873_661602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069315447.1|661656_661851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069315448.1|662012_662369_+	hypothetical protein	NA	A0A2R3UAP1	Myoviridae_environmental_samples	36.9	2.0e-09
WP_069315449.1|662365_663607_+	hypothetical protein	NA	A0A077KGW9	Edwardsiella_phage	50.9	6.3e-111
WP_069315450.1|663608_664202_+	DUF2612 domain-containing protein	NA	A0A077K9U8	Edwardsiella_phage	44.7	2.9e-37
WP_157104637.1|664579_665806_+	hypothetical protein	NA	C9DGQ8	Escherichia_phage	41.1	4.9e-15
WP_157104579.1|665805_665982_+	hypothetical protein	NA	NA	NA	NA	NA
WP_084022973.1|666242_667274_-	hypothetical protein	NA	A0A0R6PIZ6	Moraxella_phage	20.7	2.7e-06
WP_069315452.1|667995_669090_-|integrase	site-specific integrase	integrase	A0A1W6JP34	Morganella_phage	66.8	9.7e-140
WP_069315453.1|669305_669932_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_099139822.1|670015_671326_+	uracil permease	NA	Q9KX94	Enterobacteria_phage	38.5	7.9e-64
WP_099139813.1|672701_673421_+	DnaA inactivator Hda	NA	NA	NA	NA	NA
WP_069315458.1|673525_673882_-	arsenate reductase (glutaredoxin)	NA	NA	NA	NA	NA
WP_069315459.1|673894_675358_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_069315460.1|675505_676570_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_069315461.1|677021_677495_-	thioredoxin-dependent thiol peroxidase	NA	NA	NA	NA	NA
WP_069315462.1|677509_678085_-	glycine cleavage system transcriptional repressor	NA	NA	NA	NA	NA
WP_069315463.1|678323_679223_+	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_069315464.1|679239_680286_+	outer membrane protein assembly factor BamC	NA	NA	NA	NA	NA
WP_069315465.1|680421_681135_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FGF0	Synechococcus_phage	36.6	5.3e-38
WP_069315466.1|681353_681680_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069315467.1|682149_682602_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_069315468.1|682598_684743_+|tRNA	tRNA(Met) cytidine acetyltransferase	tRNA	NA	NA	NA	NA
WP_071933835.1|684687_684882_-	YpfN family protein	NA	NA	NA	NA	NA
WP_069315469.1|684930_685599_-	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_069315470.1|685595_686723_-	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_069315471.1|686742_687147_-	ArsC family reductase	NA	NA	NA	NA	NA
WP_069315472.1|687491_688127_-	response regulator	NA	NA	NA	NA	NA
WP_069315473.1|688736_691016_+	NADP-dependent oxaloacetate-decarboxylating malate dehydrogenase	NA	NA	NA	NA	NA
WP_069318402.1|691183_692077_+	iron-regulated protein	NA	NA	NA	NA	NA
WP_069315474.1|692189_692993_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_069318403.1|693164_695219_+	S9 family peptidase	NA	NA	NA	NA	NA
WP_084022975.1|695340_697614_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_069315476.1|697674_699042_-	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	32.9	2.9e-40
WP_069318404.1|699215_700682_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.1	4.0e-88
WP_069315477.1|700758_702336_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_084022977.1|702548_703523_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	G9L697	Escherichia_phage	55.1	3.3e-91
WP_069315479.1|703519_704404_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_069315480.1|704714_704993_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_069315481.1|706002_706572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157104595.1|706570_706729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_084022981.1|706703_707192_-	hypothetical protein	NA	B6SCX6	Bacteriophage	72.9	1.5e-23
WP_069315483.1|708011_708218_+	hypothetical protein	NA	NA	NA	NA	NA
707963:708013	attR	ATCATTTTCCTATATTCAGGTAATAAAAAGCCCCGCATTGGCGAGGCTGGT	NA	NA	NA	NA
WP_099139814.1|708451_708661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_084022982.1|708776_709643_+	hypothetical protein	NA	A0A0M4R313	Salmonella_phage	58.5	5.4e-77
WP_069315487.1|711985_712345_-	darcynin	NA	NA	NA	NA	NA
WP_069315488.1|712422_713040_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_084022983.1|713960_714227_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_084022984.1|714153_714429_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_069315489.1|714596_715766_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP016176	Xenorhabdus hominickii strain ANU1, complete genome	4522699	836126	896814	4522699	tRNA,holin,transposase	Escherichia_phage(17.65%)	57	NA	NA
WP_069315555.1|836126_836444_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	59.2	5.3e-30
WP_084022999.1|836649_836793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071933842.1|836845_837382_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069315557.1|837378_837615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069315558.1|838084_838720_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_069315559.1|839079_841353_+	arginine decarboxylase	NA	NA	NA	NA	NA
WP_069315560.1|841370_842729_+	arginine/agmatine antiporter	NA	NA	NA	NA	NA
WP_099139823.1|843021_844137_-	MFS transporter	NA	NA	NA	NA	NA
WP_071933843.1|844357_844588_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SLN2	Escherichia_phage	54.9	2.6e-15
WP_069318410.1|844951_845839_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_084023000.1|846124_846292_-	hypothetical protein	NA	U5P0U6	Shigella_phage	77.4	4.3e-15
WP_157104600.1|846331_846472_-	hypothetical protein	NA	Q71TF0	Escherichia_phage	58.5	7.2e-08
WP_069315562.1|847471_847873_+	hypothetical protein	NA	A0A023NGV8	Nitrincola_phage	48.4	1.8e-22
WP_069315563.1|847905_848721_+	aminoglycoside 3-N-acetyltransferase	NA	NA	NA	NA	NA
WP_084023298.1|849196_849241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_084023004.1|849264_849456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069315565.1|849682_850111_+	universal stress protein	NA	A0A1W6JNV4	Morganella_phage	42.3	2.9e-23
WP_069315566.1|850213_850651_+	universal stress protein	NA	A0A1W6JNV4	Morganella_phage	42.9	1.3e-23
WP_069315567.1|850937_851120_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069315568.1|851396_852401_+	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_069315569.1|852830_853619_+	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	67.3	2.1e-80
WP_157104580.1|853711_854405_+|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_145957475.1|854522_854744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071933845.1|855722_855926_-|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	43.4	6.2e-08
WP_069315572.1|855922_856198_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_084023006.1|856225_856444_+	DUF2569 family protein	NA	NA	NA	NA	NA
WP_069315574.1|856835_857927_-	hypothetical protein	NA	A0A1P8DTJ0	Proteus_phage	37.2	9.0e-37
WP_069315575.1|858504_859341_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_069315576.1|860444_861536_-	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_069318411.1|861647_862238_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_069315577.1|862624_862894_+	stress-induced protein YchH	NA	NA	NA	NA	NA
WP_069315578.1|863003_864992_-	autotransporter domain-containing protein	NA	NA	NA	NA	NA
WP_069315579.1|865216_867217_-	autotransporter domain-containing protein	NA	NA	NA	NA	NA
WP_145957477.1|868215_869163_-	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	38.9	5.4e-46
WP_069315581.1|869222_870128_-	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_069315582.1|870127_870745_-	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_069315583.1|871017_872280_+|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_069315584.1|872310_873393_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	46.0	3.7e-06
WP_069315585.1|873392_874253_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_069315586.1|874236_875046_+	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_069315587.1|875139_875994_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	40.1	5.8e-47
WP_069315588.1|876693_878388_-	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	26.3	1.1e-30
WP_069315590.1|880781_881186_+	DUF1801 domain-containing protein	NA	NA	NA	NA	NA
WP_084023008.1|882643_883771_+	MFS transporter	NA	NA	NA	NA	NA
WP_084023010.1|883826_884675_+	transcription factor	NA	NA	NA	NA	NA
WP_069315592.1|884671_885895_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_069315593.1|885891_886755_+	aldolase	NA	NA	NA	NA	NA
WP_069315594.1|886751_887630_+	acetaldehyde dehydrogenase (acetylating)	NA	G9E526	Ostreococcus_lucimarinus_virus	32.0	1.3e-33
WP_099139818.1|887640_888645_+	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	38.5	1.1e-52
WP_069315596.1|888647_889592_+	ornithine cyclodeaminase family protein	NA	NA	NA	NA	NA
WP_069315597.1|889588_890104_+	MaoC family dehydratase	NA	NA	NA	NA	NA
WP_069315598.1|890311_890728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069315599.1|890729_892049_-	phosphatase PAP2/dual specificity phosphatase family protein	NA	NA	NA	NA	NA
WP_069315600.1|893862_894477_-	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_069315601.1|894945_895632_+	YafY family transcriptional regulator	NA	A0A1B0RXM1	Streptococcus_phage	34.9	1.3e-17
WP_069315602.1|895914_896103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157104584.1|896119_896814_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP016176	Xenorhabdus hominickii strain ANU1, complete genome	4522699	950375	1140434	4522699	capsid,transposase,terminase,integrase,portal,plate,head,holin,protease,tail,tRNA	Morganella_phage(20.0%)	168	985524:985548	1140472:1140496
WP_069315644.1|950375_951071_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_069315645.1|951193_951781_+	Slp family lipoprotein	NA	NA	NA	NA	NA
WP_069315646.1|952216_953908_+	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	29.1	2.6e-30
WP_069315647.1|954083_955214_+	ribonuclease D	NA	NA	NA	NA	NA
WP_069315648.1|955709_955979_-	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_069315649.1|955982_956795_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_069315650.1|956818_957502_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_069315651.1|957650_957929_+	YcgL domain-containing protein	NA	NA	NA	NA	NA
WP_069315652.1|957976_959062_+	lytic murein transglycosylase	NA	NA	NA	NA	NA
WP_069315653.1|959143_959800_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_069315654.1|959821_960256_+	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
WP_157104601.1|960294_960492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069315655.1|960494_960791_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_157104584.1|961101_961795_+|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_069315656.1|962512_962905_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069315657.1|964162_964966_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_069315658.1|965174_965486_+	type V toxin-antitoxin system endoribonuclease antitoxin GhoS	NA	NA	NA	NA	NA
WP_069315659.1|965956_966391_-	META domain-containing protein	NA	NA	NA	NA	NA
WP_069318417.1|966418_967414_-	2-hydroxyacid dehydrogenase	NA	M1I636	Acanthocystis_turfacea_Chlorella_virus	41.8	1.1e-65
WP_069315660.1|967780_970411_+	YdbH family protein	NA	NA	NA	NA	NA
WP_069315661.1|970407_970632_+	YnbE family lipoprotein	NA	NA	NA	NA	NA
WP_069315662.1|970642_970963_+	YdbL family protein	NA	NA	NA	NA	NA
WP_069315663.1|970991_971630_-	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_069315664.1|971957_975863_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	32.1	3.0e-58
WP_069315665.1|975943_976945_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_069315666.1|976994_979571_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_069318418.1|979656_980343_-	molecular chaperone	NA	NA	NA	NA	NA
WP_069315667.1|980441_980972_-	fimbrial protein	NA	NA	NA	NA	NA
WP_084023014.1|981839_983312_-	amino acid permease	NA	NA	NA	NA	NA
WP_069315669.1|983610_984564_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
985524:985548	attL	TTTTGGTCATGTATTAAATAGTTAG	NA	NA	NA	NA
WP_157104602.1|985556_986251_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_069315672.1|986303_986900_+|integrase	site-specific integrase	integrase	H6WRW7	Salmonella_phage	50.0	4.3e-49
WP_069315673.1|986856_987048_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_069315674.1|987593_987827_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069315675.1|987819_988044_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	40.3	2.2e-06
WP_069315676.1|988332_988623_+	hypothetical protein	NA	A0A1B5FPB9	Escherichia_phage	35.9	2.5e-10
WP_069315677.1|988664_989054_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099139819.1|989047_990679_+	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	70.9	8.5e-140
WP_069315679.1|990678_991023_+	antitermination protein	NA	S5M7R9	Escherichia_phage	55.5	1.7e-29
WP_069315680.1|991330_992104_+	DUF2829 domain-containing protein	NA	NA	NA	NA	NA
WP_069315681.1|992232_992463_+	KilA-N domain-containing protein	NA	NA	NA	NA	NA
WP_069315682.1|992575_992812_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069315410.1|992780_993110_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_069315683.1|993359_993683_+	negative regulator GrlR	NA	NA	NA	NA	NA
WP_069315685.1|994954_995305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069315686.1|995316_995799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_084023020.1|996038_996602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069315687.1|997422_997956_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069315688.1|999008_999293_+	hypothetical protein	NA	A0A1W6JPH4	Morganella_phage	44.4	1.4e-13
WP_084023021.1|999577_1000261_+	hypothetical protein	NA	V5Q8G6	Xylella_phage	34.8	2.3e-30
WP_069315689.1|1000262_1000643_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069315690.1|1000642_1000978_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069315691.1|1000974_1001514_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_069315692.1|1001518_1001707_+	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_145957476.1|1001778_1001967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069315694.1|1001947_1002196_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069315695.1|1002192_1003284_+|tail	phage tail protein	tail	Q8HAC0	Salmonella_phage	29.5	1.0e-35
WP_084023302.1|1003306_1003909_+|plate	phage baseplate assembly protein	plate	Q8SBG6	Shigella_phage	37.5	8.2e-16
WP_069315697.1|1004272_1005409_+|plate	baseplate J/gp47 family protein	plate	B5TK75	Pseudomonas_phage	30.3	1.5e-31
WP_069315698.1|1005405_1006002_+	YmfQ family protein	NA	NA	NA	NA	NA
WP_084023023.1|1006053_1007052_+	hypothetical protein	NA	C9DGQ8	Escherichia_phage	30.1	6.6e-10
WP_145957478.1|1007246_1007666_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	43.5	1.4e-25
WP_069315700.1|1007691_1008669_-	hypothetical protein	NA	A0A2K9VLC3	Shigella_phage	44.9	2.8e-21
WP_069315701.1|1009718_1011251_+	Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_069315702.1|1011261_1012650_+	Re/Si-specific NAD(P)(+) transhydrogenase subunit beta	NA	NA	NA	NA	NA
WP_069315703.1|1013105_1015763_+	non-ribosomal peptide synthetase	NA	A0A2K9L3I8	Tupanvirus	28.0	2.3e-57
WP_069315704.1|1015862_1018808_-	salicylate synthase	NA	Q75ZG1	Hepacivirus	22.6	1.1e-20
WP_069318421.1|1018807_1019584_-	thioesterase	NA	NA	NA	NA	NA
WP_069315705.1|1019610_1020708_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069315706.1|1020704_1032506_-	hybrid non-ribosomal peptide synthetase/type I polyketide synthase	NA	D0R7J2	Paenibacillus_phage	40.0	2.5e-55
WP_069315707.1|1032502_1038703_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	27.4	2.6e-40
WP_069315708.1|1038754_1040548_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	31.5	2.5e-28
WP_069315709.1|1040534_1042349_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	24.9	1.1e-23
WP_069315710.1|1042341_1043607_-	MFS transporter	NA	NA	NA	NA	NA
WP_084023025.1|1043603_1045610_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_069315712.1|1045904_1046876_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_069315713.1|1047017_1048748_-	cytochrome-c oxidase	NA	NA	NA	NA	NA
WP_157104603.1|1049318_1049456_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069315714.1|1049915_1050929_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1P8DJ76	Virus_Rctr85	35.6	1.4e-44
WP_069315715.1|1051121_1051988_+	DMT family transporter	NA	NA	NA	NA	NA
WP_069315716.1|1052227_1053319_+	amidinotransferase	NA	NA	NA	NA	NA
WP_069315717.1|1054541_1055405_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069315718.1|1055502_1056450_-	universal stress protein UspE	NA	NA	NA	NA	NA
WP_069315719.1|1056577_1057333_-	FNR family transcription factor	NA	NA	NA	NA	NA
WP_157104604.1|1057563_1058478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069315721.1|1058978_1060937_+	tyrosine decarboxylase	NA	NA	NA	NA	NA
WP_069315722.1|1061226_1061841_-	LysE family translocator	NA	NA	NA	NA	NA
WP_069315723.1|1061962_1062427_+	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	30.6	6.1e-11
WP_069315724.1|1062627_1063881_+|integrase	site-specific integrase	integrase	A0A291AWU1	Escherichia_phage	48.3	1.5e-112
WP_069315725.1|1064019_1064337_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069315726.1|1064326_1064599_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069315727.1|1064598_1064823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069315728.1|1064815_1065040_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	41.7	1.3e-06
WP_069315729.1|1065052_1065583_-	hypothetical protein	NA	A0A088C4R7	Shewanella_sp._phage	34.8	4.0e-22
WP_069315730.1|1065579_1065816_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069315731.1|1065826_1066615_-	ORF6N domain-containing protein	NA	H6WRU9	Salmonella_phage	45.6	2.1e-51
WP_069315732.1|1066614_1066833_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069315733.1|1066832_1067021_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_069315734.1|1067013_1067349_-	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_069315735.1|1067345_1067672_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069315737.1|1068148_1068502_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145957496.1|1068904_1069066_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_069315739.1|1069079_1069430_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069315740.1|1069550_1070231_-	helix-turn-helix domain-containing protein	NA	K7PLZ5	Enterobacterial_phage	45.4	1.1e-48
WP_069315741.1|1070337_1070535_+	hypothetical protein	NA	A5VW97	Enterobacteria_phage	52.5	7.5e-11
WP_145957497.1|1070718_1071231_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069315744.1|1071224_1072856_+	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	67.5	7.3e-216
WP_069315745.1|1072852_1073833_+	DNA primase	NA	A0A2L1IV48	Escherichia_phage	56.9	2.0e-104
WP_069315746.1|1073832_1074237_+	antitermination protein	NA	S5M7R9	Escherichia_phage	55.6	5.9e-34
WP_069315747.1|1074845_1075721_+	DUF2829 domain-containing protein	NA	NA	NA	NA	NA
WP_069315748.1|1076123_1076927_-	DUF3800 domain-containing protein	NA	Q19UP3	Mannheimia_phage	46.3	9.8e-65
WP_069315749.1|1077261_1078839_+	site-specific DNA-methyltransferase	NA	A0A2K5B255	Erysipelothrix_phage	32.5	6.4e-60
WP_069315750.1|1078946_1079282_+|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	53.3	6.0e-24
WP_069315751.1|1079265_1079667_+	structural protein	NA	A0A0A1IX72	Pseudomonas_phage	57.0	9.0e-35
WP_069315752.1|1079834_1080413_+	antirepressor	NA	A0A2R2Z339	Escherichia_phage	71.6	6.8e-76
WP_069315753.1|1080418_1080799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_084023029.1|1080686_1080950_+	peptidase	NA	U5P461	Shigella_phage	53.8	1.2e-14
WP_069315754.1|1081673_1082105_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069315755.1|1082109_1082460_+	HNH endonuclease	NA	A0A1W6JP27	Morganella_phage	75.9	1.1e-49
WP_069315756.1|1082725_1083220_+|terminase	phage terminase small subunit P27 family	terminase	Q8HAD7	Salmonella_phage	78.0	2.8e-70
WP_069315757.1|1083216_1084947_+|terminase	terminase large subunit	terminase	U5P0Q5	Shigella_phage	83.2	1.7e-292
WP_069315758.1|1085094_1086324_+|portal	phage portal protein	portal	A0A1W6JP33	Morganella_phage	83.0	1.1e-200
WP_069315759.1|1086316_1086916_+|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	78.9	1.4e-87
WP_069315760.1|1086925_1088149_+|capsid	phage major capsid protein	capsid	A0A1W6JP20	Morganella_phage	75.9	5.7e-173
WP_069315761.1|1088231_1088534_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	63.0	1.3e-30
WP_069315762.1|1088544_1088865_+|head	phage head closure protein	head	A0A1W6JP44	Morganella_phage	69.5	1.2e-34
WP_099139691.1|1088867_1089308_+	HK97 gp10 family phage protein	NA	A0A1W6JP15	Morganella_phage	67.1	6.6e-47
WP_069315764.1|1089304_1089640_+	hypothetical protein	NA	A0A1W6JP05	Morganella_phage	60.4	1.4e-33
WP_069315765.1|1089696_1090173_+|tail	phage tail protein	tail	A0A1W6JP06	Morganella_phage	74.0	5.8e-57
WP_069315766.1|1090178_1090565_+|tail	phage tail protein	tail	A0A0P0ZE84	Stx2-converting_phage	56.5	3.4e-31
WP_069315767.1|1090588_1090858_+	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	58.0	7.1e-20
WP_069315768.1|1090867_1094305_+	tape measure protein	NA	A0A1P8DTH2	Proteus_phage	37.3	5.7e-154
WP_069315769.1|1094304_1094658_+|tail	phage tail protein	tail	K7PHJ6	Enterobacteria_phage	47.0	1.7e-24
WP_069315770.1|1094666_1095413_+|tail	phage minor tail protein L	tail	A0A1W6JNX9	Morganella_phage	59.4	3.9e-84
WP_069318422.1|1095423_1096125_+	peptidase P60	NA	A0A1W6JP31	Morganella_phage	56.3	2.4e-75
WP_069315771.1|1096164_1096395_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069315772.1|1096449_1097025_+|tail	tail assembly protein	tail	F1C572	Cronobacter_phage	63.0	8.9e-60
WP_069315773.1|1097076_1100361_+	host specificity protein J	NA	F1C571	Cronobacter_phage	50.7	0.0e+00
WP_069315774.1|1100361_1101357_+	hypothetical protein	NA	NA	NA	NA	NA
WP_084023304.1|1102092_1102599_+	hypothetical protein	NA	A0A1W6JNZ8	Morganella_phage	55.6	5.4e-53
WP_069315776.1|1102640_1103405_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145957470.1|1103875_1104169_+	hypothetical protein	NA	NA	NA	NA	NA
WP_084023031.1|1104396_1104936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_084023033.1|1104945_1106136_-	MFS transporter	NA	NA	NA	NA	NA
WP_069315779.1|1106300_1107056_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_069315780.1|1107124_1108615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069315781.1|1108845_1111899_-|protease	autotransporter serine protease	protease	NA	NA	NA	NA
WP_069315782.1|1112729_1113215_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_069315783.1|1114095_1115535_+	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	29.7	3.1e-29
WP_084023306.1|1115576_1115975_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_069315785.1|1116857_1117451_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_069315786.1|1117471_1118359_-	EamA family transporter	NA	NA	NA	NA	NA
WP_084023035.1|1118340_1118550_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069315787.1|1118535_1119027_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_069315788.1|1119168_1121178_-	TonB-dependent copper receptor	NA	NA	NA	NA	NA
WP_084023037.1|1121303_1121675_-	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
WP_069315789.1|1122445_1123792_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_069315792.1|1124428_1124863_+	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_069315793.1|1126257_1127169_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_099139811.1|1127213_1128092_-	DMT family transporter	NA	NA	NA	NA	NA
WP_069315795.1|1128187_1129522_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_069315796.1|1129718_1129919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069315797.1|1130354_1131488_+	alkene reductase	NA	NA	NA	NA	NA
WP_069315798.1|1131523_1132708_+	P1 family peptidase	NA	NA	NA	NA	NA
WP_069315799.1|1132846_1133863_+	serine hydrolase	NA	NA	NA	NA	NA
WP_069315800.1|1134279_1135101_-	intradiol ring-cleavage dioxygenase	NA	NA	NA	NA	NA
WP_069315803.1|1137894_1139382_+	DUF560 domain-containing protein	NA	NA	NA	NA	NA
WP_157104580.1|1139739_1140434_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
1140472:1140496	attR	CTAACTATTTAATACATGACCAAAA	NA	NA	NA	NA
>prophage 8
NZ_CP016176	Xenorhabdus hominickii strain ANU1, complete genome	4522699	1189909	1285299	4522699	coat,terminase,integrase,holin,protease,tail,lysis	Escherichia_phage(16.39%)	103	1180648:1180663	1233930:1233945
1180648:1180663	attL	TCACGGCTTGAGCCAG	NA	NA	NA	NA
WP_069315849.1|1189909_1190956_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	32.0	1.6e-22
WP_069315850.1|1191167_1191932_+	YciK family oxidoreductase	NA	NA	NA	NA	NA
WP_069315851.1|1192014_1192938_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_069315852.1|1193024_1193645_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_069315853.1|1193656_1194535_-	PHP domain-containing protein	NA	NA	NA	NA	NA
WP_069315854.1|1195287_1196847_+	anthranilate synthase component 1	NA	NA	NA	NA	NA
WP_069315855.1|1196846_1197425_+	anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	35.9	1.6e-29
WP_069315856.1|1197511_1198510_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	39.0	4.1e-52
WP_069315857.1|1198512_1199877_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	NA	NA	NA	NA
WP_069315858.1|1199904_1201095_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_069315859.1|1201094_1201895_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_069315860.1|1202128_1202773_-	outer membrane protein OmpW	NA	NA	NA	NA	NA
WP_069315861.1|1203240_1203999_+	UPF0259 family protein	NA	NA	NA	NA	NA
WP_069315862.1|1204070_1205792_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	28.9	2.9e-21
WP_069315863.1|1206016_1206553_+	septation protein A	NA	NA	NA	NA	NA
WP_069315864.1|1206630_1207062_+	acyl-CoA thioester hydrolase YciA	NA	NA	NA	NA	NA
WP_038196706.1|1208089_1208311_-	YcxB family protein	NA	NA	NA	NA	NA
WP_069315866.1|1208307_1208679_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069315867.1|1209144_1209324_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069315868.1|1209782_1211039_-|integrase	site-specific integrase	integrase	A0A291AWU1	Escherichia_phage	46.1	9.8e-104
WP_071933914.1|1211398_1212124_-	TonB system transport protein TonB	NA	NA	NA	NA	NA
WP_071933851.1|1212218_1212398_-	YciY family protein	NA	NA	NA	NA	NA
WP_069315870.1|1212601_1214062_+	cardiolipin synthase	NA	NA	NA	NA	NA
WP_099139800.1|1214219_1214573_+	YciU family protein	NA	NA	NA	NA	NA
WP_069315871.1|1214695_1215697_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.7	3.7e-21
WP_069315872.1|1215693_1216692_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.5	2.3e-15
WP_069315873.1|1216703_1217612_-	oligopeptide ABC transporter permease OppC	NA	NA	NA	NA	NA
WP_069315874.1|1217626_1218547_-	oligopeptide ABC transporter permease OppB	NA	NA	NA	NA	NA
WP_069315875.1|1218630_1220277_-	oligopeptide ABC transporter substrate-binding protein OppA	NA	NA	NA	NA	NA
WP_069315876.1|1220417_1222058_-	oligopeptide ABC transporter substrate-binding protein OppA	NA	NA	NA	NA	NA
WP_069315877.1|1222664_1223309_-	YchE family NAAT transporter	NA	NA	NA	NA	NA
WP_069315878.1|1223804_1226471_+	bifunctional acetaldehyde-CoA/alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_069315879.1|1226578_1227175_-	thymidine kinase	NA	A7XF40	Enterobacteria_phage	59.3	4.1e-60
WP_069315880.1|1227817_1228222_+	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_069315881.1|1228461_1229472_-	NAD-dependent epimerase	NA	A0A0E3FNQ3	Synechococcus_phage	28.3	3.2e-28
WP_069315882.1|1229480_1230824_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	37.0	3.4e-78
WP_069315883.1|1230848_1231766_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	45.5	8.9e-62
WP_069315884.1|1231997_1233023_-	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_145957469.1|1233176_1233638_+	YchJ family protein	NA	NA	NA	NA	NA
WP_069315886.1|1233706_1234555_+	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	32.4	8.3e-14
1233930:1233945	attR	CTGGCTCAAGCCGTGA	NA	NA	NA	NA
WP_069315887.1|1235260_1236124_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_069315888.1|1236776_1237583_+	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_069315889.1|1237763_1239698_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.4	1.0e-38
WP_069315891.1|1241163_1242159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069315892.1|1242159_1245348_-	host specificity protein J	NA	F1C571	Cronobacter_phage	54.0	0.0e+00
WP_069315893.1|1245402_1245978_-|tail	tail assembly protein	tail	F1C572	Cronobacter_phage	62.5	2.0e-59
WP_069318427.1|1245982_1246714_-	peptidase P60	NA	A0A1W6JP31	Morganella_phage	55.8	2.7e-77
WP_069315894.1|1246724_1247465_-|tail	phage minor tail protein L	tail	A0A1W6JNX9	Morganella_phage	59.8	7.9e-85
WP_099139807.1|1247461_1247803_-|tail	phage tail protein	tail	A0A2H4JI07	uncultured_Caudovirales_phage	42.0	7.7e-19
WP_084023047.1|1247960_1248806_-	ORF6N domain-containing protein	NA	A0A2R2Z302	Escherichia_phage	60.0	7.2e-34
WP_084023049.1|1249047_1249833_-	KilA-N domain-containing protein	NA	A0A0P0ZDC0	Stx2-converting_phage	56.1	5.3e-39
WP_069315896.1|1249931_1250099_-	Arc family DNA binding domain-containing protein	NA	G9L6D7	Escherichia_phage	72.3	9.8e-12
WP_069315897.1|1250228_1250666_+	Arc family DNA-binding protein	NA	G9L6D6	Escherichia_phage	53.6	9.2e-25
WP_069315898.1|1250773_1250971_-	type II toxin-antitoxin system HicA family toxin	NA	A0A0M4RCZ9	Salmonella_phage	83.1	5.4e-25
WP_069315899.1|1250997_1251213_-	DUF1902 domain-containing protein	NA	A0A0M4R2Z9	Salmonella_phage	44.0	2.4e-10
WP_069315900.1|1251313_1251892_-	hypothetical protein	NA	I6PDJ9	Cronobacter_phage	37.3	1.5e-22
WP_069315901.1|1251940_1252825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069315902.1|1253013_1253541_+	hypothetical protein	NA	A0A2H4JB10	uncultured_Caudovirales_phage	57.4	7.2e-08
WP_069315903.1|1253597_1256444_-|tail	phage tail tape measure protein	tail	E4WL33	Enterobacteria_phage	36.3	1.3e-119
WP_069315904.1|1256484_1257243_-	DNA-binding protein	NA	K7PH51	Enterobacterial_phage	44.8	4.8e-53
WP_069315905.1|1257519_1257699_+	hypothetical protein	NA	A0A192Y6A8	Salmonella_phage	79.7	1.6e-20
WP_069315906.1|1257715_1258078_-	hypothetical protein	NA	E7C9U7	Salmonella_phage	62.8	1.6e-38
WP_069315907.1|1258091_1258376_-	hypothetical protein	NA	A0A2H4J4F7	uncultured_Caudovirales_phage	50.0	1.2e-12
WP_069315908.1|1258393_1258696_-	hypothetical protein	NA	A0A1V0DZ05	Salmonella_phage	36.9	4.4e-10
WP_069315909.1|1258737_1259394_-|tail	phage tail protein	tail	G8C7Q3	Escherichia_phage	58.0	7.0e-61
WP_069315910.1|1259439_1259841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069315911.1|1259837_1260419_-	hypothetical protein	NA	G8C7Q1	Escherichia_phage	47.9	6.0e-40
WP_069315912.1|1260420_1260774_-	hypothetical protein	NA	I6PD77	Cronobacter_phage	49.1	2.5e-25
WP_069315913.1|1260776_1261253_-	hypothetical protein	NA	G8C7P9	Escherichia_phage	47.8	1.3e-35
WP_069315914.1|1261293_1262298_-|coat	phage coat protein	coat	A0A2H4JIE6	uncultured_Caudovirales_phage	68.1	7.1e-129
WP_069315916.1|1263110_1264232_-	hypothetical protein	NA	I6PD76	Cronobacter_phage	47.7	1.4e-96
WP_069315917.1|1264233_1265610_-	DUF4055 domain-containing protein	NA	A0A1W6JNV0	Morganella_phage	78.2	5.2e-207
WP_069315918.1|1265611_1267096_-|terminase	terminase	terminase	A0A1W6JNY3	Morganella_phage	86.0	4.7e-262
WP_069315919.1|1267098_1267611_-|terminase	terminase small subunit	terminase	I6PDJ6	Cronobacter_phage	71.3	5.8e-63
WP_069315920.1|1267613_1268138_-	hypothetical protein	NA	A0A2H4JGJ6	uncultured_Caudovirales_phage	52.4	1.7e-46
WP_069315921.1|1268147_1268525_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099139797.1|1268584_1269151_-	hypothetical protein	NA	A0A1I9KF52	Aeromonas_phage	34.9	4.4e-11
WP_069315415.1|1269276_1269819_-	KilA-N domain-containing protein	NA	A0A2H4FQV0	Salmonella_phage	58.5	2.2e-52
WP_069315923.1|1270400_1270790_-	hypothetical protein	NA	Q71TL7	Escherichia_phage	47.2	2.2e-25
WP_069315924.1|1270926_1271136_-	hypothetical protein	NA	A0A2H4YG75	Citrobacter_phage	48.4	3.8e-05
WP_069315925.1|1271132_1271594_-|lysis	lysis protein	lysis	NA	NA	NA	NA
WP_069315926.1|1271590_1272025_-	lysozyme	NA	R9TMH8	Aeromonas_phage	56.6	1.2e-40
WP_069315927.1|1272021_1272330_-|holin	holin	holin	E7C9S8	Salmonella_phage	65.5	2.6e-26
WP_069315928.1|1272654_1273032_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069315929.1|1273093_1274683_-	site-specific DNA-methyltransferase	NA	A0A2K5B255	Erysipelothrix_phage	32.6	5.9e-61
WP_069315410.1|1274929_1275259_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_069315682.1|1275227_1275464_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069315409.1|1275701_1276016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069315408.1|1276160_1276997_-	antitermination protein	NA	M9NZB0	Enterobacteria_phage	46.9	1.5e-63
WP_071933830.1|1277555_1277840_-	DUF1364 domain-containing protein	NA	A0A220NQY2	Salmonella_phage	78.7	4.7e-38
WP_069318395.1|1277775_1278207_-	HNH endonuclease	NA	E7EKU5	Edwardsiella_phage	43.1	1.6e-29
WP_069315930.1|1278386_1279055_-	serine/threonine-protein phosphatase	NA	Q71TJ1	Escherichia_phage	58.9	8.1e-73
WP_069315931.1|1279051_1279495_-	hypothetical protein	NA	A0A1P8DTD8	Proteus_phage	75.3	1.7e-26
WP_084023051.1|1279734_1279995_-	hypothetical protein	NA	A0A1P8DTG8	Proteus_phage	59.6	1.5e-11
WP_069315933.1|1279981_1280194_-	restriction alleviation protein, Lar family	NA	NA	NA	NA	NA
WP_069315934.1|1280190_1280547_-	DUF2591 domain-containing protein	NA	F8TVJ2	EBPR_siphovirus	41.5	1.4e-10
WP_069315935.1|1280680_1280914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069315936.1|1280934_1281843_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	58.6	6.7e-94
WP_069315937.1|1281839_1282583_-	DNA replication protein	NA	A0A1P8DTF3	Proteus_phage	58.4	6.3e-74
WP_069318428.1|1282579_1283509_-	replication protein	NA	A5VW95	Enterobacteria_phage	75.0	1.2e-50
WP_069315938.1|1283657_1284026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069315939.1|1284253_1284478_-	helix-turn-helix domain-containing protein	NA	A0A0N7C1T6	Escherichia_phage	82.2	1.2e-28
WP_069315940.1|1284588_1285299_+	helix-turn-helix transcriptional regulator	NA	A0A2H4FNG6	Salmonella_phage	62.3	3.5e-82
>prophage 9
NZ_CP016176	Xenorhabdus hominickii strain ANU1, complete genome	4522699	1288988	1370790	4522699	tail,tRNA,integrase,plate	Enterobacteria_phage(25.0%)	67	1285459:1285474	1311099:1311114
1285459:1285474	attL	TTATATTGAATCCATC	NA	NA	NA	NA
WP_071933916.1|1288988_1289654_+	exodeoxyribonuclease X	NA	A0A1W5PTR6	Pseudoalteromonas_phage	32.7	8.8e-19
WP_069315946.1|1289660_1290341_+	AAA family ATPase	NA	K7PMI2	Enterobacteria_phage	66.5	3.0e-83
WP_157104608.1|1290992_1291157_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069315948.1|1291221_1291482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069315949.1|1291536_1291962_+	hypothetical protein	NA	A9YX19	Burkholderia_phage	46.0	1.7e-31
WP_157104609.1|1291961_1292114_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069315950.1|1292126_1292381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_084023053.1|1292519_1292897_+	DUF2591 domain-containing protein	NA	A0A1P8DTH6	Proteus_phage	43.0	4.4e-15
WP_069315953.1|1292886_1293528_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	62.4	8.1e-70
WP_069315954.1|1293662_1293884_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_069315955.1|1293860_1295045_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	35.9	4.7e-63
WP_157104610.1|1295192_1295360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069315956.1|1295737_1296289_-	NAD(P)H nitroreductase	NA	NA	NA	NA	NA
WP_069315957.1|1296457_1298350_+	signal peptide peptidase SppA	NA	A0A2I6UG67	Salinibacter_virus	22.5	6.0e-12
WP_069315958.1|1298585_1299605_+	asparaginase	NA	NA	NA	NA	NA
WP_069315959.1|1299631_1300267_+	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L2K0	Tupanvirus	33.0	8.4e-19
WP_084023055.1|1301383_1302175_+|tail	tail fiber protein	tail	Q9MCR6	Enterobacteria_phage	40.1	4.0e-26
WP_145957485.1|1302190_1302772_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069315961.1|1303481_1303781_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069315962.1|1304285_1304486_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069315963.1|1306615_1306885_-	DUF1315 family protein	NA	NA	NA	NA	NA
WP_069315964.1|1307065_1307479_-	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_069315965.1|1307846_1308842_+	glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_069315966.1|1309022_1309904_+	D-hexose-6-phosphate mutarotase	NA	NA	NA	NA	NA
WP_069315967.1|1309976_1311044_-	alanine racemase	NA	NA	NA	NA	NA
WP_069315968.1|1311060_1312362_-	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
1311099:1311114	attR	TTATATTGAATCCATC	NA	NA	NA	NA
WP_069315969.1|1313439_1315608_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.8	7.3e-38
WP_069315970.1|1315631_1318223_+	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
WP_069315971.1|1318219_1319287_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069315972.1|1319324_1319948_+	DUF3540 domain-containing protein	NA	NA	NA	NA	NA
WP_069315973.1|1319958_1320351_+	DUF4150 domain-containing protein	NA	NA	NA	NA	NA
WP_069315974.1|1320397_1320949_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_069315975.1|1320941_1322291_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_099139831.1|1322287_1323520_+	DotU family type VI secretion system protein	NA	NA	NA	NA	NA
WP_069315977.1|1323523_1327162_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_069315978.1|1327203_1328310_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_069315979.1|1328435_1328966_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_069315980.1|1328969_1330472_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_069315981.1|1330626_1331118_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_069315982.1|1332958_1333513_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_069315983.1|1333544_1335419_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_069318433.1|1335464_1336499_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_069315984.1|1336564_1339219_+	type VI secretion system ATPase TssH	NA	A0A223W0B1	Agrobacterium_phage	31.1	2.2e-81
WP_069315985.1|1339269_1339992_-	fatty acid metabolism transcriptional regulator FadR	NA	NA	NA	NA	NA
WP_069315986.1|1340227_1341772_+	sodium/proton antiporter NhaB	NA	NA	NA	NA	NA
WP_069318434.1|1341948_1342467_+	disulfide bond formation protein DsbB	NA	NA	NA	NA	NA
WP_069315987.1|1342541_1343435_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	68.1	5.9e-103
WP_069315988.1|1343912_1344896_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_069315989.1|1344920_1346546_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_069315990.1|1346855_1347359_+	thiol peroxidase	NA	NA	NA	NA	NA
WP_069315991.1|1347741_1349673_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_069315992.1|1349700_1352271_+	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
WP_069315993.1|1352267_1353341_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_069315994.1|1353355_1353973_+	DUF3540 domain-containing protein	NA	NA	NA	NA	NA
WP_069315995.1|1353984_1354389_+	DUF4150 domain-containing protein	NA	NA	NA	NA	NA
WP_084023317.1|1354522_1355065_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_069315996.1|1355091_1356450_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_069315997.1|1356446_1357664_+	DotU family type VI secretion system protein	NA	NA	NA	NA	NA
WP_069315998.1|1357676_1361348_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_069315999.1|1361391_1362465_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_069316000.1|1362587_1363142_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_069316001.1|1363145_1364648_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_069316002.1|1364808_1365294_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_069316003.1|1365371_1367201_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069316004.1|1367282_1367837_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069318436.1|1367850_1369725_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_069316005.1|1369746_1370790_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
>prophage 10
NZ_CP016176	Xenorhabdus hominickii strain ANU1, complete genome	4522699	1432862	1446177	4522699	tRNA	Tupanvirus(33.33%)	13	NA	NA
WP_069316059.1|1432862_1434845_-	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	26.7	5.1e-22
WP_069316060.1|1434844_1435822_-	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	A8CG95	Salmonella_phage	34.7	3.3e-38
WP_069316061.1|1435822_1436968_-	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L470	Tupanvirus	27.4	8.8e-35
WP_069316062.1|1437113_1437881_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A1V0SE00	Indivirus	26.6	5.6e-09
WP_069316063.1|1437926_1438922_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_010847339.1|1439024_1439321_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	38.9	4.2e-13
WP_069316064.1|1439325_1441713_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	30.2	2.3e-08
WP_069316065.1|1441727_1442711_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	37.1	3.8e-34
WP_157104638.1|1442866_1442914_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_010847342.1|1443012_1443369_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_006118955.1|1443412_1443610_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_071933854.1|1443705_1444245_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.9	5.6e-16
WP_069316067.1|1444248_1446177_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.6	6.3e-126
>prophage 11
NZ_CP016176	Xenorhabdus hominickii strain ANU1, complete genome	4522699	1457985	1531246	4522699	transposase,integrase,holin,protease,lysis	Pectobacterium_phage(15.0%)	68	1487233:1487259	1523977:1524003
WP_069316080.1|1457985_1458870_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_069316081.1|1459049_1461146_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	32.8	7.4e-80
WP_069316082.1|1461165_1461873_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_069316083.1|1461968_1462466_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_069316084.1|1463039_1463393_-	YebY family protein	NA	NA	NA	NA	NA
WP_069316085.1|1463479_1464442_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_069316086.1|1464441_1464828_-	copper homeostasis periplasmic binding protein CopC	NA	NA	NA	NA	NA
WP_069316087.1|1465060_1465567_-	non-heme ferritin	NA	NA	NA	NA	NA
WP_069316088.1|1465912_1466143_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	3.1e-16
WP_069318437.1|1466188_1467139_-	prolyl aminopeptidase	NA	NA	NA	NA	NA
WP_069316089.1|1467221_1467593_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069316090.1|1467694_1467877_-	YoaH family protein	NA	NA	NA	NA	NA
WP_069316091.1|1468014_1469385_+	aminodeoxychorismate synthase component 1	NA	A0A0B5J984	Pandoravirus	32.4	9.9e-41
WP_069316092.1|1469381_1469951_+	CoA pyrophosphatase	NA	NA	NA	NA	NA
WP_069316093.1|1470120_1471485_+	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_069316094.1|1472037_1473003_+	PTS mannose transporter subunit IIAB	NA	NA	NA	NA	NA
WP_069316095.1|1473086_1473884_+	PTS mannose/fructose/sorbose transporter subunit IIC	NA	NA	NA	NA	NA
WP_099139830.1|1473888_1474755_+	PTS mannose transporter subunit IID	NA	NA	NA	NA	NA
WP_069316097.1|1474845_1475304_+	DUF986 domain-containing protein	NA	NA	NA	NA	NA
WP_145957487.1|1475698_1476283_+	manganese efflux pump MntP	NA	NA	NA	NA	NA
WP_069316099.1|1476411_1477227_-	23S rRNA (guanine(745)-N(1))-methyltransferase	NA	NA	NA	NA	NA
WP_069316100.1|1477386_1477932_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_069316101.1|1478005_1479337_-	MFS transporter	NA	NA	NA	NA	NA
WP_069316103.1|1480195_1481719_-	signal transduction histidine-protein kinase/phosphatase UhpB	NA	NA	NA	NA	NA
WP_069316104.1|1481718_1482327_-	transcriptional regulator UhpA	NA	NA	NA	NA	NA
WP_069316105.1|1482469_1483846_-	hexose-6-phosphate:phosphate antiporter	NA	NA	NA	NA	NA
WP_069316106.1|1484121_1485288_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	40.8	5.2e-75
WP_084023059.1|1485582_1485981_-	DUF4431 domain-containing protein	NA	NA	NA	NA	NA
WP_157104611.1|1486500_1487195_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
1487233:1487259	attL	CTAACTATTTAATACATGACCAGATAT	NA	NA	NA	NA
WP_157104612.1|1489054_1489213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069316110.1|1489620_1490658_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_069316111.1|1491183_1491477_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_069316112.1|1491479_1491749_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_069316113.1|1491884_1492580_-|transposase	IS6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	39.2	2.7e-34
WP_069316114.1|1492655_1493513_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_069316115.1|1493650_1495165_+	MFS transporter	NA	NA	NA	NA	NA
WP_069316116.1|1495909_1496791_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069316117.1|1496787_1497462_-	RraA family protein	NA	NA	NA	NA	NA
WP_069316118.1|1499137_1499893_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_069316119.1|1499889_1500828_-	3-hydroxy-3-methylglutaryl-CoA lyase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	29.7	3.3e-19
WP_069316120.1|1500820_1502029_-	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	28.2	4.5e-29
WP_157104613.1|1503347_1503488_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069316122.1|1503802_1504033_+	DUF4224 domain-containing protein	NA	K7PHA0	Enterobacterial_phage	50.0	3.2e-13
WP_069316123.1|1504025_1504808_+|integrase	integrase	integrase	H9C152	Pectobacterium_phage	58.8	9.8e-86
WP_084023065.1|1511590_1512109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069316125.1|1512158_1512707_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071933856.1|1512736_1513324_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145957483.1|1513445_1515065_-	HlyD family type I secretion periplasmic adaptor subunit	NA	W8CYL7	Bacillus_phage	34.9	1.2e-40
WP_069316127.1|1515764_1516064_+	hypothetical protein	NA	H9C172	Pectobacterium_phage	59.8	9.7e-26
WP_069316128.1|1516200_1516626_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145957482.1|1517168_1517564_+	DUF1240 domain-containing protein	NA	NA	NA	NA	NA
WP_069316130.1|1518244_1519672_-	hypothetical protein	NA	NA	NA	NA	NA
WP_084023069.1|1521179_1522508_-	hypothetical protein	NA	B6SD37	Bacteriophage	72.3	3.3e-182
WP_069316131.1|1522643_1522976_-	hypothetical protein	NA	A0A076L7R3	Bacteriophage	55.3	9.7e-27
WP_157104580.1|1523273_1523967_+|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_069316132.1|1524056_1524590_-	hypothetical protein	NA	NA	NA	NA	NA
1523977:1524003	attR	CTAACTATTTAATACATGACCAGATAT	NA	NA	NA	NA
WP_069316133.1|1524654_1525314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069316134.1|1525439_1525724_+	type V toxin-antitoxin system endoribonuclease antitoxin GhoS	NA	NA	NA	NA	NA
WP_069316135.1|1525720_1525924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157104614.1|1526006_1526174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069314966.1|1526189_1526972_-	DNA-binding protein	NA	Q9MCN2	Enterobacteria_phage	52.2	6.0e-67
WP_069316136.1|1527388_1527571_+	hypothetical protein	NA	B8K1I9	Salmonella_phage	76.3	2.2e-20
WP_069316137.1|1527593_1527968_-	hypothetical protein	NA	R9VYK9	Serratia_phage	43.1	2.8e-22
WP_069316138.1|1528020_1528350_-	hypothetical protein	NA	A0A192Y905	Salmonella_phage	42.2	2.8e-10
WP_069316139.1|1528346_1528808_-|lysis	lysis protein	lysis	NA	NA	NA	NA
WP_069316140.1|1528804_1529239_-	lysozyme	NA	A0A088FRS5	Escherichia_phage	56.9	1.9e-38
WP_069316141.1|1529225_1529561_-|holin	phage holin, lambda family	holin	A0A0K2FJ23	Enterobacteria_phage	53.2	7.0e-25
WP_069316142.1|1529668_1531246_-	site-specific DNA-methyltransferase	NA	A0A2K5B255	Erysipelothrix_phage	32.8	1.5e-61
>prophage 12
NZ_CP016176	Xenorhabdus hominickii strain ANU1, complete genome	4522699	1535287	1540893	4522699		Escherichia_phage(33.33%)	7	NA	NA
WP_069316147.1|1535287_1535647_-	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	68.5	1.6e-43
WP_084023071.1|1535646_1536630_-	DNA primase	NA	A0A2L1IV48	Escherichia_phage	55.8	2.3e-100
WP_069318441.1|1536626_1538249_-	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	66.0	2.7e-210
WP_069316148.1|1538334_1539138_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069316149.1|1539263_1539647_-	hypothetical protein	NA	A0A1B5FPB9	Escherichia_phage	39.5	2.8e-09
WP_069316150.1|1539826_1540057_-	hypothetical protein	NA	A0A088CE43	Shigella_phage	67.1	3.8e-22
WP_069316151.1|1540146_1540893_+	helix-turn-helix transcriptional regulator	NA	A0A088CBP2	Shigella_phage	52.9	6.7e-68
>prophage 13
NZ_CP016176	Xenorhabdus hominickii strain ANU1, complete genome	4522699	1547466	1641366	4522699	capsid,transposase,terminase,integrase,portal,plate,head,holin,tail,tRNA,lysis	Salmonella_phage(12.5%)	115	1546476:1546490	1652240:1652255
1546476:1546490	attL	ATATTCATGAGGGCA	NA	NA	NA	NA
WP_069316163.1|1547466_1548594_+|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	58.8	1.4e-125
1546476:1546490	attL	ATATTCATGAGGGCA	NA	NA	NA	NA
WP_069316164.1|1548713_1549967_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	5.2e-20
WP_069316165.1|1550107_1550737_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_069316166.1|1550729_1551182_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_069316167.1|1551289_1552393_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_069316168.1|1552395_1553022_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_069316169.1|1553058_1554429_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	46.2	1.1e-111
WP_069316170.1|1554845_1555529_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_069318443.1|1555521_1557045_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_069315479.1|1557064_1557949_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_069316171.1|1558182_1559304_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_069316172.1|1559430_1560663_-	peptidase T	NA	NA	NA	NA	NA
WP_069316173.1|1560731_1561562_-	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	33.0	5.8e-20
WP_069316174.1|1561768_1563016_-	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_069316175.1|1563015_1563735_-	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	41.8	1.9e-35
WP_069316176.1|1563727_1564930_-	lipoprotein-releasing ABC transporter permease subunit LolC	NA	NA	NA	NA	NA
WP_069316177.1|1565959_1566433_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069316178.1|1567200_1570641_+	transcription-repair coupling factor	NA	NA	NA	NA	NA
1567552:1567566	attR	TGCCCTCATGAATAT	NA	NA	NA	NA
WP_069316179.1|1570710_1571202_-	UmoD	NA	NA	NA	NA	NA
1567552:1567566	attR	TGCCCTCATGAATAT	NA	NA	NA	NA
WP_069316180.1|1571867_1573172_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_069316181.1|1573613_1574633_-	beta-N-acetylhexosaminidase	NA	NA	NA	NA	NA
WP_069316182.1|1574755_1575616_-	phosphotransferase	NA	NA	NA	NA	NA
WP_069316183.1|1575602_1576172_-	penicillin-binding protein activator LpoB	NA	NA	NA	NA	NA
WP_069316184.1|1576238_1576589_-	purine nucleoside phosphoramidase	NA	NA	NA	NA	NA
WP_069316185.1|1576590_1577394_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_069316186.1|1577416_1578424_-	DNA polymerase III subunit delta'	NA	NA	NA	NA	NA
WP_069316187.1|1578457_1579093_-	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	36.1	5.8e-28
WP_069316188.1|1579089_1580115_-	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_069316189.1|1580205_1581033_-	aminodeoxychorismate lyase	NA	NA	NA	NA	NA
WP_069316190.1|1581216_1582458_-	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_012989255.1|1582532_1582769_-	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	50.0	2.0e-10
WP_069316191.1|1582920_1583655_-	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.0	4.2e-14
WP_069316192.1|1583666_1584596_-	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_069316193.1|1584614_1585568_-	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_071933858.1|1585575_1586625_-	phosphate acyltransferase PlsX	NA	NA	NA	NA	NA
WP_004247080.1|1586653_1586824_-	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_069316195.1|1586836_1587361_-	23S rRNA accumulation protein YceD	NA	NA	NA	NA	NA
WP_069316196.1|1587505_1588099_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_069316197.1|1588092_1589049_-	23S rRNA pseudouridine(955/2504/2580) synthase RluC	NA	NA	NA	NA	NA
WP_069316198.1|1589603_1592837_+	ribonuclease E	NA	NA	NA	NA	NA
WP_069316199.1|1593046_1593673_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_069316200.1|1593748_1594069_-	DUF496 family protein	NA	NA	NA	NA	NA
WP_084023077.1|1594210_1594522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069316201.1|1595146_1595329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069316202.1|1595328_1596519_-	hypothetical protein	NA	A0A1C9II52	Salmonella_phage	46.7	1.1e-11
WP_069316203.1|1596573_1597170_-	YmfQ family protein	NA	NA	NA	NA	NA
WP_069316204.1|1597166_1598303_-|plate	baseplate J/gp47 family protein	plate	B5TK75	Pseudomonas_phage	31.6	1.5e-34
WP_069316205.1|1598292_1598739_-	hypothetical protein	NA	B5TK74	Pseudomonas_phage	53.1	1.3e-18
WP_084023323.1|1598735_1599284_-|plate	phage baseplate assembly protein	plate	U5P081	Shigella_phage	36.0	4.4e-16
WP_069316207.1|1599306_1600398_-|tail	phage tail protein	tail	Q8HAC0	Salmonella_phage	29.2	1.7e-35
WP_069316208.1|1600394_1601804_-	hypothetical protein	NA	Q8W619	Enterobacteria_phage	25.7	1.2e-25
WP_084023079.1|1601870_1602689_-	hypothetical protein	NA	B6SCX2	Bacteriophage	56.8	4.5e-33
WP_069316209.1|1602718_1602901_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_099139834.1|1602993_1603266_+	Arc family DNA-binding protein	NA	G0ZNE9	Cronobacter_phage	54.9	2.3e-05
WP_069316212.1|1604466_1606401_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069316213.1|1606519_1606816_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_069316214.1|1606825_1607194_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_069316215.1|1607203_1608694_-|tail	phage tail protein	tail	B5TK67	Pseudomonas_phage	43.8	2.7e-100
WP_069315692.1|1608693_1608882_-	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_069316216.1|1608886_1609426_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_069316217.1|1609422_1609758_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069316218.1|1609757_1610147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069316219.1|1610148_1611195_-|capsid	major capsid protein	capsid	V5Q8G6	Xylella_phage	33.6	4.9e-48
WP_069316220.1|1611267_1611660_-|head	head decoration protein	head	A0A291AUM0	Sinorhizobium_phage	41.2	1.8e-08
WP_069316221.1|1611659_1612250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069316222.1|1612251_1613103_-	S49 family peptidase	NA	A0A248XD65	Klebsiella_phage	50.5	5.9e-52
WP_099139833.1|1613099_1614698_-|portal	phage portal protein	portal	A0A291AUL8	Sinorhizobium_phage	35.7	3.9e-89
WP_069316224.1|1614754_1615003_-|head,tail	phage head-tail adapter protein	head,tail	NA	NA	NA	NA
WP_069316225.1|1615012_1616989_-|terminase	phage terminase large subunit family protein	terminase	G8EXZ6	Synechococcus_phage	46.7	2.1e-140
WP_069316226.1|1616963_1617548_-	RNA polymerase subunit sigma-70	NA	NA	NA	NA	NA
WP_069316227.1|1617689_1618172_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145957524.1|1618212_1618614_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069316229.1|1618657_1619317_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069315961.1|1619404_1619704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069315924.1|1620496_1620706_-	hypothetical protein	NA	A0A2H4YG75	Citrobacter_phage	48.4	3.8e-05
WP_069315925.1|1620702_1621164_-|lysis	lysis protein	lysis	NA	NA	NA	NA
WP_069316230.1|1621160_1621595_-	lysozyme	NA	R9TMH8	Aeromonas_phage	57.3	4.1e-41
WP_069316231.1|1621591_1621900_-|holin	holin	holin	E7C9S8	Salmonella_phage	64.3	7.6e-26
WP_069316232.1|1622007_1623585_-	site-specific DNA-methyltransferase	NA	A0A2K5B2C1	Erysipelothrix_phage	33.1	1.3e-60
WP_069316233.1|1624022_1624514_-	DUF1133 family protein	NA	M1FPN0	Enterobacteria_phage	69.4	9.9e-60
WP_069316234.1|1624510_1624705_-	hypothetical protein	NA	A0A1P8DTD3	Proteus_phage	52.4	7.0e-09
WP_069316235.1|1624701_1625331_-	hypothetical protein	NA	S4TSR3	Salmonella_phage	55.9	1.2e-49
WP_145957522.1|1625403_1625481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069315930.1|1625564_1626233_-	serine/threonine-protein phosphatase	NA	Q71TJ1	Escherichia_phage	58.9	8.1e-73
WP_069316236.1|1626229_1626673_-	hypothetical protein	NA	A0A1P8DTD8	Proteus_phage	75.3	4.9e-26
WP_099139740.1|1626912_1627212_-	hypothetical protein	NA	A0A1P8DTG8	Proteus_phage	59.6	1.4e-11
WP_069316237.1|1627331_1627724_-	DUF2591 domain-containing protein	NA	F8TVJ2	EBPR_siphovirus	32.0	7.7e-07
WP_157104615.1|1627720_1627879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069316238.1|1627901_1629275_-	replicative DNA helicase	NA	E5AGF0	Erwinia_phage	60.0	1.9e-153
WP_069316239.1|1629276_1630350_-	DNA replication protein	NA	E5AGE9	Erwinia_phage	52.0	1.1e-82
WP_069316240.1|1630569_1630917_-	transcriptional regulator	NA	A0A1P8DTF0	Proteus_phage	45.8	2.1e-19
WP_069316241.1|1631161_1631371_-	helix-turn-helix transcriptional regulator	NA	I6S1U2	Salmonella_phage	59.4	4.2e-20
WP_084023083.1|1631478_1631892_+	helix-turn-helix domain-containing protein	NA	A0A1P8DTH0	Proteus_phage	57.1	2.1e-18
WP_145957444.1|1632241_1632805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145957443.1|1632781_1633051_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157104616.1|1633212_1633386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069316245.1|1633754_1633940_+	DUF551 domain-containing protein	NA	NA	NA	NA	NA
WP_069316246.1|1633942_1634176_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069316247.1|1634177_1634591_+	hypothetical protein	NA	A0A0P0I438	Acinetobacter_phage	29.1	4.1e-06
WP_069316248.1|1634583_1634847_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157104617.1|1634891_1635041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145957442.1|1635039_1635306_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069316250.1|1635302_1635584_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069316251.1|1635580_1636318_+	phage recombination protein Bet	NA	A0A0M4RD39	Salmonella_phage	71.0	3.0e-68
WP_069316252.1|1636298_1636937_+	exonuclease	NA	A0A0U2BXF3	Paracoccus_phage	51.5	3.2e-50
WP_157104608.1|1637156_1637321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069316253.1|1637376_1637664_+	hypothetical protein	NA	A5VWB2	Enterobacteria_phage	48.1	2.1e-14
WP_069316254.1|1637683_1638109_+	hypothetical protein	NA	A9YX19	Burkholderia_phage	46.0	2.9e-31
WP_157104618.1|1638108_1638261_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069316255.1|1638272_1638761_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071933860.1|1638772_1638973_+	hypothetical protein	NA	A0A1P8DTH3	Proteus_phage	54.0	1.3e-13
WP_069316256.1|1638935_1639205_+	hypothetical protein	NA	A0A0F6TK62	Escherichia_coli_O157_typing_phage	69.1	2.2e-21
WP_069316257.1|1639179_1639821_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	61.5	4.0e-69
WP_069316259.1|1640018_1640207_+	AlpA family phage regulatory protein	NA	A0A0P0ZBL0	Stx2-converting_phage	58.6	4.5e-13
WP_069316260.1|1640187_1641366_-|integrase	site-specific integrase	integrase	A0A0P0ZCE7	Stx2-converting_phage	59.4	2.1e-140
1652240:1652255	attR	CATCAGTGACTGTTTC	NA	NA	NA	NA
>prophage 14
NZ_CP016176	Xenorhabdus hominickii strain ANU1, complete genome	4522699	1669398	1722092	4522699	plate,transposase	Haemophilus_phage(15.0%)	51	NA	NA
WP_069316283.1|1669398_1669827_-|transposase	IS200/IS605 family transposase	transposase	D9CGB6	Hyperthermophilic_Archaeal_Virus_2	36.2	2.1e-18
WP_069316284.1|1670063_1670345_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_069316285.1|1670443_1671451_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.3	2.5e-86
WP_069316286.1|1671729_1671957_+	YejL family protein	NA	NA	NA	NA	NA
WP_069316287.1|1671987_1673733_+	DUF3413 domain-containing protein	NA	NA	NA	NA	NA
WP_069316201.1|1674268_1674451_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157104619.1|1674609_1674768_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157104584.1|1674848_1675542_+|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_069316290.1|1676591_1677248_-	DUF2612 domain-containing protein	NA	A0A075DXV1	Acinetobacter_phage	43.0	7.4e-10
WP_069316291.1|1677240_1678365_-|plate	baseplate J/gp47 family protein	plate	D0UIH5	Aggregatibacter_phage	39.2	6.2e-73
WP_069316292.1|1678348_1678708_-	hypothetical protein	NA	Q7Y5S5	Haemophilus_phage	50.5	3.7e-24
WP_069316293.1|1678704_1679370_-|plate	baseplate protein	plate	Q7Y5S7	Haemophilus_phage	59.5	3.8e-46
WP_069316294.1|1679347_1680196_-	hypothetical protein	NA	D0UIH8	Aggregatibacter_phage	55.7	4.8e-86
WP_069316295.1|1680170_1680509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069318445.1|1680508_1681267_-	hypothetical protein	NA	Q7Y5T0	Haemophilus_phage	42.9	1.1e-33
WP_038197159.1|1681336_1681543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069316296.1|1681660_1682557_-	hypothetical protein	NA	A0A0P0J0J7	Acinetobacter_phage	51.9	1.3e-41
WP_084023087.1|1682629_1682785_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_069316297.1|1682900_1683149_+	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	35.4	4.9e-07
WP_069316298.1|1683319_1684153_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069316299.1|1684286_1684631_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069316300.1|1684858_1685758_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157104584.1|1685832_1686527_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_084023089.1|1686782_1687010_-	hypothetical protein	NA	A0A023NGV8	Nitrincola_phage	75.8	9.3e-05
WP_069316301.1|1687510_1688104_+	chitin-binding protein	NA	A0A0K1Y848	Apis_mellifera_filamentous_virus	35.5	6.0e-27
WP_069316302.1|1688248_1688644_+	VOC family protein	NA	NA	NA	NA	NA
WP_069316303.1|1688756_1689191_-	lysozyme	NA	A0A223W0U3	Agrobacterium_phage	52.8	2.6e-35
WP_145957447.1|1689931_1690195_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069316304.1|1690209_1690398_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069316305.1|1691082_1691664_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_069316306.1|1691786_1692560_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A223VZK2	Agrobacterium_phage	27.6	4.3e-09
WP_069316307.1|1693087_1693354_-	2Fe-2S ferredoxin-like protein	NA	G9IAA2	Pseudomonas_phage	63.2	1.6e-19
WP_069316308.1|1693355_1694486_-	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	79.4	6.2e-174
WP_069316309.1|1694498_1696790_-	ribonucleoside-diphosphate reductase subunit alpha	NA	I3UMG3	Colwellia_phage	64.6	3.0e-292
WP_069316310.1|1697151_1697886_-	bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG	NA	NA	NA	NA	NA
WP_069316311.1|1698080_1700714_+	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	32.6	3.8e-105
WP_071933862.1|1700904_1703793_+	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	26.1	1.3e-34
WP_069316313.1|1703859_1704510_-	transcriptional regulator RcsB	NA	NA	NA	NA	NA
WP_069316314.1|1704511_1707235_-	phosphotransferase RcsD	NA	NA	NA	NA	NA
WP_069316315.1|1708161_1709367_+	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_069316316.1|1709425_1709968_-	porin	NA	NA	NA	NA	NA
WP_069316317.1|1710094_1711516_-	o-succinylbenzoate--CoA ligase	NA	NA	NA	NA	NA
WP_069316318.1|1711506_1712487_-	o-succinylbenzoate synthase	NA	NA	NA	NA	NA
WP_069316319.1|1712486_1713344_-	1,4-dihydroxy-2-naphthoyl-CoA synthase	NA	NA	NA	NA	NA
WP_069316320.1|1713357_1714164_-	2-succinyl-6-hydroxy-2, 4-cyclohexadiene-1-carboxylate synthase	NA	NA	NA	NA	NA
WP_069316321.1|1714124_1715816_-	2-succinyl-5-enolpyruvyl-6-hydroxy-3- cyclohexene-1-carboxylic-acid synthase	NA	NA	NA	NA	NA
WP_069316322.1|1716068_1716953_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_069316323.1|1716965_1719491_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_145957446.1|1719586_1720267_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_069318446.1|1720541_1721072_-	fimbrial protein	NA	NA	NA	NA	NA
WP_069316283.1|1721663_1722092_-|transposase	IS200/IS605 family transposase	transposase	D9CGB6	Hyperthermophilic_Archaeal_Virus_2	36.2	2.1e-18
>prophage 15
NZ_CP016176	Xenorhabdus hominickii strain ANU1, complete genome	4522699	1738378	1745292	4522699		Morganella_phage(33.33%)	9	NA	NA
WP_084023090.1|1738378_1738765_-	hypothetical protein	NA	A0A1W6JPI6	Morganella_phage	58.5	1.7e-14
WP_069316341.1|1739031_1741398_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	35.9	1.3e-133
WP_069316342.1|1741391_1741697_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071933865.1|1741699_1741870_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_069316343.1|1741862_1742111_-	hypothetical protein	NA	A0A1W6JPD9	Morganella_phage	53.2	1.2e-08
WP_069316344.1|1742107_1742296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069316345.1|1743159_1743966_-	anti-repressor protein	NA	A0A0A7RVQ9	Clostridium_phage	52.2	8.4e-24
WP_069316346.1|1744052_1744268_-	AlpA family transcriptional regulator	NA	A0A2H4J8C8	uncultured_Caudovirales_phage	48.1	2.5e-07
WP_069316347.1|1744383_1745292_-	hypothetical protein	NA	A0A2H4JEC4	uncultured_Caudovirales_phage	42.4	2.3e-09
>prophage 16
NZ_CP016176	Xenorhabdus hominickii strain ANU1, complete genome	4522699	1827260	1838297	4522699	protease,tRNA	Bacillus_phage(28.57%)	9	NA	NA
WP_069316399.1|1827260_1829030_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	23.9	3.4e-25
WP_069316400.1|1829032_1830805_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	24.4	1.7e-21
WP_069316401.1|1830782_1831472_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_069316402.1|1831627_1831846_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_069316403.1|1831922_1834211_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	43.5	5.5e-169
WP_069316404.1|1834242_1834563_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	50.0	2.6e-16
WP_069316405.1|1834888_1835134_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	59.7	5.7e-16
WP_069316406.1|1835244_1837185_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	41.3	9.1e-40
WP_069316407.1|1837184_1838297_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	37.2	2.8e-09
>prophage 17
NZ_CP016176	Xenorhabdus hominickii strain ANU1, complete genome	4522699	2746405	2805377	4522699	protease,integrase,plate	uncultured_Caudovirales_phage(18.18%)	40	2740646:2740662	2806412:2806428
2740646:2740662	attL	TTCATTATTCAACGCAT	NA	NA	NA	NA
WP_069317043.1|2746405_2747677_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	37.5	7.2e-70
WP_069317044.1|2747813_2748020_+	AlpA family transcriptional regulator	NA	A0A2H4J8C8	uncultured_Caudovirales_phage	50.0	1.4e-07
WP_084023153.1|2748126_2750232_+	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	61.0	8.4e-116
WP_069317045.1|2750589_2750784_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069317046.1|2750883_2751153_-	immunity protein	NA	NA	NA	NA	NA
WP_145957434.1|2751165_2751873_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069317048.1|2753108_2753879_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_069317049.1|2753875_2755882_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_069317050.1|2755926_2757684_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_145957421.1|2757833_2758199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069317051.1|2759035_2759305_+	transcriptional regulator	NA	F6MII4	Haemophilus_phage	52.0	8.5e-13
WP_069317052.1|2759669_2759912_-	hypothetical protein	NA	NA	NA	NA	NA
WP_084023155.1|2759950_2760151_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_084023157.1|2760492_2762331_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069317054.1|2762343_2764353_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_069317055.1|2764352_2765564_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_069317056.1|2765582_2768708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069317057.1|2768708_2769659_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069317058.1|2769860_2770841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069317061.1|2772089_2775227_-|protease	autotransporter serine protease	protease	NA	NA	NA	NA
WP_069317062.1|2775671_2776943_-	enterobactin transporter EntS	NA	NA	NA	NA	NA
WP_145957435.1|2776981_2785477_-	amino acid adenylation domain-containing protein	NA	A0A2K9KZV5	Tupanvirus	26.4	9.7e-62
WP_069317064.1|2785717_2785930_-	MbtH family protein	NA	NA	NA	NA	NA
WP_069317065.1|2785975_2787277_-	enterochelin esterase	NA	NA	NA	NA	NA
WP_069317066.1|2789941_2791132_+	isochorismate synthase	NA	NA	NA	NA	NA
WP_069317067.1|2791128_2792757_+	(2,3-dihydroxybenzoyl)adenylate synthase	NA	NA	NA	NA	NA
WP_069317068.1|2792753_2793629_+	isochorismatase	NA	NA	NA	NA	NA
WP_069317069.1|2793628_2794387_+	2,3-dihydro-2,3-dihydroxybenzoate dehydrogenase	NA	NA	NA	NA	NA
WP_069318492.1|2794653_2795148_+	TIGR00645 family protein	NA	NA	NA	NA	NA
WP_069317070.1|2795210_2795696_-	tellurium resistance protein TerW	NA	NA	NA	NA	NA
WP_069317071.1|2795856_2796795_-	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_069317072.1|2796794_2797886_-|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.3	3.0e-40
WP_069317073.1|2797878_2798679_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069317074.1|2798671_2799811_-	adenine/guanine phosphoribosyltransferase	NA	A0A172Q0Y1	Acinetobacter_phage	28.1	4.8e-33
WP_069317075.1|2800236_2800824_+	tellurium resistance protein TerZ	NA	K4JRX3	Caulobacter_phage	30.6	5.8e-14
WP_069317076.1|2800823_2801990_+	tellurium resistance protein TerA	NA	NA	NA	NA	NA
WP_069317077.1|2802095_2802551_+	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_069317078.1|2802578_2803607_+	TerC/Alx family metal homeostasis membrane protein	NA	K7QKE8	Escherichia_phage	47.5	1.7e-74
WP_069317079.1|2803662_2804241_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	39.5	7.1e-33
WP_069317080.1|2804750_2805377_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	49.7	4.3e-52
2806412:2806428	attR	TTCATTATTCAACGCAT	NA	NA	NA	NA
>prophage 18
NZ_CP016176	Xenorhabdus hominickii strain ANU1, complete genome	4522699	3225823	3234032	4522699		Synechococcus_phage(50.0%)	8	NA	NA
WP_069317381.1|3225823_3226516_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	29.5	2.3e-06
WP_069317382.1|3226512_3227889_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	28.1	8.7e-21
WP_069317383.1|3228229_3228610_+	HAD-IIIC family phosphatase	NA	M4QRS4	Synechococcus_phage	45.5	8.9e-16
WP_069317384.1|3228600_3230172_+	capsular biosynthesis protein	NA	M4QT73	Synechococcus_phage	25.8	2.6e-21
WP_069317385.1|3230168_3230885_+	capsular biosynthesis protein	NA	A0A222YX14	Synechococcus_phage	32.8	1.2e-24
WP_069317386.1|3230900_3231779_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069317387.1|3231765_3233031_+	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_069317388.1|3233042_3234032_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	42.5	3.2e-17
>prophage 19
NZ_CP016176	Xenorhabdus hominickii strain ANU1, complete genome	4522699	3512276	3566581	4522699	tRNA,plate,transposase	Planktothrix_phage(33.33%)	41	NA	NA
WP_069317591.1|3512276_3512714_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_069317592.1|3512794_3513712_+	fatty acid biosynthesis protein FabY	NA	NA	NA	NA	NA
WP_069317594.1|3515726_3517112_-	uracil-xanthine permease	NA	H9YQ34	environmental_Halophage	75.5	6.0e-54
WP_069317595.1|3517354_3518566_+	sodium/glutamate symporter	NA	NA	NA	NA	NA
WP_069317596.1|3518692_3520774_-	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_069317597.1|3520854_3521571_-|tRNA	tRNA (guanosine(18)-2'-O)-methyltransferase TrmH	tRNA	NA	NA	NA	NA
WP_069317598.1|3521577_3523692_-	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A1B1IUF0	uncultured_Mediterranean_phage	35.9	6.3e-10
WP_069317599.1|3523710_3523986_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_069317600.1|3524045_3524669_-	guanylate kinase	NA	A0A218KC48	Bacillus_phage	33.5	3.4e-12
WP_069317601.1|3524975_3526760_+	NAD-dependent DNA ligase LigB	NA	G3M9X7	Bacillus_virus	22.7	9.3e-23
WP_069317602.1|3526816_3527434_-	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_069317603.1|3527568_3528885_+	DUF3748 domain-containing protein	NA	NA	NA	NA	NA
WP_069317604.1|3528958_3529327_-	YceK/YidQ family lipoprotein	NA	NA	NA	NA	NA
WP_069317605.1|3529940_3531197_-	valine--pyruvate transaminase	NA	NA	NA	NA	NA
WP_069317606.1|3531383_3531962_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_069317607.1|3532163_3533087_+|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_069317608.1|3533096_3535166_+|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_069317609.1|3535981_3537592_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_069317610.1|3537740_3538760_+	dipeptide ABC transporter permease DppB	NA	NA	NA	NA	NA
WP_069317611.1|3538770_3539673_+	dipeptide ABC transporter permease DppC	NA	NA	NA	NA	NA
WP_069317612.1|3539685_3540666_+	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.0	3.0e-15
WP_099139673.1|3540731_3541715_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.7	9.0e-20
WP_069317613.1|3541952_3542660_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_069317614.1|3542765_3544241_+	insulinase family protein	NA	NA	NA	NA	NA
WP_069315479.1|3544505_3545390_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_069317615.1|3545578_3546247_-	DNA oxidative demethylase AlkB	NA	NA	NA	NA	NA
WP_069317616.1|3546657_3547722_-	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	NA	NA	NA	NA
WP_069317617.1|3547876_3548095_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_069317618.1|3548206_3548413_-	4-oxalocrotonate tautomerase family protein	NA	NA	NA	NA	NA
WP_069317619.1|3548502_3549480_-	inner membrane protein YhjD	NA	NA	NA	NA	NA
WP_069317620.1|3549768_3554178_-	filamentous hemagglutinin N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_069317621.1|3554275_3555961_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_069317622.1|3556664_3557183_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_069317623.1|3558098_3558596_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_069317624.1|3558616_3560095_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_069317625.1|3560097_3560538_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_069317626.1|3560538_3562371_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_069317627.1|3562334_3563387_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_069317628.1|3563392_3564688_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_069317629.1|3564671_3565226_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_069317630.1|3565228_3566581_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 20
NZ_CP016176	Xenorhabdus hominickii strain ANU1, complete genome	4522699	3749059	3807258	4522699	protease,terminase,tRNA,transposase	uncultured_Caudovirales_phage(15.38%)	57	NA	NA
WP_069315479.1|3749059_3749944_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_069317759.1|3750411_3750732_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	64.5	2.5e-27
WP_069318546.1|3750832_3751186_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	77.8	5.8e-46
WP_010847912.1|3751859_3752156_-	DNA-binding transcriptional regulator Fis	NA	NA	NA	NA	NA
WP_071933896.1|3752163_3753147_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_069317763.1|3753430_3754312_-	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_069317764.1|3754349_3755792_-	sodium/pantothenate symporter	NA	NA	NA	NA	NA
WP_069317765.1|3755781_3756024_-	YhdT family protein	NA	NA	NA	NA	NA
WP_069317766.1|3756795_3760890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_084023215.1|3761896_3762283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069317768.1|3762381_3763731_-	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_069317769.1|3763742_3764198_-	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_069317770.1|3764225_3764678_-	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_069317771.1|3764833_3765808_-	oxidoreductase	NA	NA	NA	NA	NA
WP_047768715.1|3766690_3767734_+	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	3.0e-05
WP_069317772.1|3768899_3769388_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_069317773.1|3769480_3770068_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_069317774.1|3770064_3771534_+	ribonuclease G	NA	NA	NA	NA	NA
WP_069317775.1|3771594_3775428_+	AsmA2 domain-containing protein	NA	NA	NA	NA	NA
WP_069317776.1|3775424_3776273_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_069317777.1|3776291_3777737_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_069318547.1|3777903_3778374_+	barnase	NA	NA	NA	NA	NA
WP_069317778.1|3778378_3778645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157104580.1|3778707_3779402_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_069317779.1|3779961_3780744_+	hypothetical protein	NA	M1HQ65	Paramecium_bursaria_Chlorella_virus	28.2	1.0e-10
WP_084023217.1|3780833_3781796_-	D-2-hydroxyacid dehydrogenase family protein	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	29.8	1.0e-15
WP_069317781.1|3782030_3782567_-	ribosome-associated protein	NA	NA	NA	NA	NA
WP_069317782.1|3782765_3784109_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_069317783.1|3784160_3784571_-	nucleoside diphosphate kinase regulator	NA	NA	NA	NA	NA
WP_069317784.1|3784775_3786008_-	alanine racemase	NA	NA	NA	NA	NA
WP_145957428.1|3786218_3786443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069317786.1|3786471_3786744_-	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_069317787.1|3786776_3787628_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	29.3	1.1e-05
WP_069317788.1|3787666_3788134_-	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_069317789.1|3788321_3788609_-	ribosome hibernation promoting factor	NA	NA	NA	NA	NA
WP_069317790.1|3788632_3790066_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_069317791.1|3790145_3790871_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.9	1.1e-22
WP_069317792.1|3790877_3791426_-	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_069317793.1|3791406_3792000_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_069317794.1|3792018_3792582_-	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	79.3	3.4e-56
WP_069317795.1|3792633_3793602_-	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.5	9.4e-38
WP_069317796.1|3793637_3794615_-	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_069317797.1|3794846_3795650_+	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	33.3	1.6e-19
WP_069318548.1|3795660_3796443_+	lipid asymmetry maintenance ABC transporter permease subunit MlaE	NA	NA	NA	NA	NA
WP_069317798.1|3796447_3796960_+	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_069318549.1|3796993_3797623_+	phospholipid-binding protein MlaC	NA	NA	NA	NA	NA
WP_069317799.1|3797624_3797978_+	lipid asymmetry maintenance protein MlaB	NA	NA	NA	NA	NA
WP_069317800.1|3798113_3798368_+	BolA family transcriptional regulator	NA	NA	NA	NA	NA
WP_069317801.1|3798425_3799688_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_069317802.1|3799760_3800819_-	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	30.5	1.4e-10
WP_069317803.1|3801081_3802461_-	Do family serine endopeptidase	NA	A0A1B1IT49	uncultured_Mediterranean_phage	27.9	1.1e-23
WP_069317804.1|3802761_3803166_-	DUF1043 family protein	NA	NA	NA	NA	NA
WP_069317805.1|3803470_3804598_+	cell division protein ZapE	NA	NA	NA	NA	NA
WP_012990147.1|3804858_3805287_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_069317806.1|3805302_3805695_+	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_069317807.1|3806130_3806772_+	stringent starvation protein A	NA	NA	NA	NA	NA
WP_069317808.1|3806775_3807258_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	46.8	8.0e-30
>prophage 21
NZ_CP016176	Xenorhabdus hominickii strain ANU1, complete genome	4522699	3831535	3933483	4522699	capsid,transposase,terminase,integrase,portal,head,holin,tail,tRNA	Cronobacter_phage(51.11%)	102	3859992:3860042	3888582:3888632
WP_157104580.1|3831535_3832230_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_069317828.1|3833383_3835405_-	NADPH-dependent 2,4-dienoyl-CoA reductase	NA	NA	NA	NA	NA
WP_069317829.1|3835726_3836323_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_069317830.1|3836355_3837294_-	DUF535 domain-containing protein	NA	NA	NA	NA	NA
WP_069317831.1|3837585_3838020_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_069318552.1|3838365_3839544_-	MFS transporter	NA	NA	NA	NA	NA
WP_069317832.1|3839946_3840789_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_069317833.1|3840943_3842173_-	beta-ketoacyl-ACP synthase	NA	NA	NA	NA	NA
WP_069317834.1|3842169_3842901_-	3-oxoacyl-ACP reductase FabG	NA	NA	NA	NA	NA
WP_069317835.1|3842897_3843374_-	hotdog family protein	NA	NA	NA	NA	NA
WP_069317836.1|3843373_3844540_-	beta-ketoacyl-[acyl-carrier-protein] synthase family protein	NA	NA	NA	NA	NA
WP_069317837.1|3844543_3845122_-	DUF3261 domain-containing protein	NA	NA	NA	NA	NA
WP_069317838.1|3845118_3847443_-	MMPL family transporter	NA	NA	NA	NA	NA
WP_099139683.1|3847414_3848035_-	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
WP_069317839.1|3848049_3848472_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_069317840.1|3848475_3850200_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_069317841.1|3850190_3850550_-	hydroxymyristoyl-ACP dehydratase	NA	NA	NA	NA	NA
WP_069317842.1|3850536_3851919_-	AMP-binding protein	NA	NA	NA	NA	NA
WP_069318554.1|3851915_3852452_-	DNA gyrase subunit B	NA	NA	NA	NA	NA
WP_069317843.1|3852535_3852802_-	acyl carrier protein	NA	NA	NA	NA	NA
WP_069317844.1|3852813_3853071_-	hypothetical protein	NA	NA	NA	NA	NA
WP_084023360.1|3853089_3853863_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_069317846.1|3853882_3854602_-	beta-ketoacyl synthase chain length factor	NA	NA	NA	NA	NA
WP_084023231.1|3854615_3855737_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_069317848.1|3855941_3856331_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069317849.1|3857119_3857389_+	transcriptional regulator	NA	F1BUM8	Cronobacter_phage	59.0	5.1e-18
WP_069317850.1|3858075_3858360_+	VapA/VapB family virulence-associated protein	NA	NA	NA	NA	NA
WP_157104580.1|3858471_3859165_+|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
3859992:3860042	attL	AAATTTGGTGGCCCCTGCTGGACTTGAACCAGCGACCAAGCGATTATGAGT	NA	NA	NA	NA
WP_069317851.1|3860106_3861150_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	92.7	1.4e-191
WP_069317852.1|3861146_3861725_-	phage repressor protein CI	NA	A0A218M4J1	Erwinia_phage	58.8	1.2e-61
WP_069317853.1|3861853_3862117_+	hypothetical protein	NA	A0A218M4I5	Erwinia_phage	67.4	2.6e-27
WP_069317854.1|3862147_3862360_+	hypothetical protein	NA	E5G6L3	Salmonella_phage	50.0	3.8e-08
WP_069317855.1|3862338_3862695_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069317856.1|3862838_3863192_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069317857.1|3863271_3863523_+	DUF2732 family protein	NA	NA	NA	NA	NA
WP_069317858.1|3863515_3863863_+	DUF3850 domain-containing protein	NA	NA	NA	NA	NA
WP_069317859.1|3863859_3866022_+	replication endonuclease	NA	F1BUS0	Erwinia_phage	59.1	2.2e-212
WP_069317861.1|3866772_3866988_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069317862.1|3866964_3867285_-	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	70.2	8.5e-36
WP_069317863.1|3867281_3868316_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	62.9	5.2e-127
WP_069317864.1|3868315_3870100_-|terminase	terminase	terminase	F1BUM5	Cronobacter_phage	64.5	1.4e-223
WP_069317865.1|3870287_3871100_+|capsid	phage capsid protein	capsid	F1BUM4	Cronobacter_phage	52.0	2.9e-64
WP_069317866.1|3871132_3872194_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	74.0	7.7e-142
WP_069317867.1|3872193_3872940_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	50.4	5.2e-60
WP_069317868.1|3873002_3873455_+|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	54.7	7.2e-41
WP_069317869.1|3873451_3873952_+|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	44.8	2.3e-32
WP_069317870.1|3873948_3874623_+	hypothetical protein	NA	F1BUL6	Cronobacter_phage	64.3	1.8e-75
WP_069317871.1|3874646_3875768_+	DUF2586 domain-containing protein	NA	F1BUL5	Cronobacter_phage	66.2	2.3e-136
WP_069317872.1|3875764_3876220_+	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	62.9	1.0e-50
WP_069318555.1|3876231_3876525_+|holin	holin	holin	S4TP56	Salmonella_phage	54.7	2.1e-17
WP_069317873.1|3876521_3876860_+	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	76.0	2.3e-39
WP_069317874.1|3876859_3877249_+	hypothetical protein	NA	F1BUL2	Cronobacter_phage	51.5	3.9e-19
WP_069317875.1|3877350_3877617_+	hypothetical protein	NA	A5X9I7	Aeromonas_virus	47.1	1.8e-15
WP_069317876.1|3877804_3879913_+|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	48.4	2.7e-170
WP_069317877.1|3879905_3880241_+	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	68.0	4.1e-33
WP_069317878.1|3880230_3881415_+	hypothetical protein	NA	F1BUK6	Cronobacter_phage	65.0	1.6e-148
WP_069317879.1|3881407_3882064_+	hypothetical protein	NA	F1BUK5	Cronobacter_phage	61.9	9.8e-63
WP_069317880.1|3882077_3884003_+|tail	phage tail protein	tail	F1BUK3	Cronobacter_phage	55.0	8.1e-81
WP_157104628.1|3884126_3884285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069317881.1|3884268_3884994_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	38.0	8.9e-41
WP_069317882.1|3884965_3885505_+	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	57.7	6.2e-47
WP_069317883.1|3885501_3887139_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	50.8	2.7e-162
WP_045959536.1|3887258_3887432_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0M3LQ86	Mannheimia_phage	68.4	2.9e-14
WP_069317884.1|3887486_3887903_+	type II toxin-antitoxin system HicB family antitoxin	NA	F1C593	Cronobacter_phage	58.6	8.4e-36
WP_069317885.1|3888953_3889748_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
3888582:3888632	attR	AAATTTGGTGGCCCCTGCTGGACTTGAACCAGCGACCAAGCGATTATGAGT	NA	NA	NA	NA
WP_069317886.1|3889803_3891651_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	35.2	3.2e-34
WP_069317887.1|3891975_3893724_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.6	1.8e-71
WP_001144069.1|3893838_3894054_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_069317888.1|3894546_3895584_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	56.6	5.1e-106
WP_069317889.1|3895711_3896686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069317890.1|3897267_3897810_-	hypothetical protein	NA	G9L6F0	Escherichia_phage	64.6	2.0e-16
WP_069318556.1|3897824_3898310_-	hypothetical protein	NA	G9L6F1	Escherichia_phage	77.7	1.7e-35
WP_069317891.1|3898667_3899708_-	zinc-dependent alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_069317892.1|3900184_3900841_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_069317893.1|3900949_3901303_+	bifunctional dihydroneopterin aldolase/7,8-dihydroneopterin epimerase	NA	NA	NA	NA	NA
WP_069317894.1|3901410_3902583_-	multifunctional CCA addition/repair protein	NA	A0A0F6YPT7	Sinorhizobium_phage	40.9	9.3e-72
WP_069317895.1|3902600_3903221_-	SH3 domain-containing protein	NA	NA	NA	NA	NA
WP_069317896.1|3903511_3904498_+	inorganic triphosphatase	NA	NA	NA	NA	NA
WP_084023235.1|3904531_3907405_+	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
WP_069317897.1|3907506_3908931_+	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.6	1.6e-38
WP_069318558.1|3909043_3909319_-	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_069317898.1|3909759_3910413_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	42.0	1.0e-43
WP_069317899.1|3910735_3911512_+	4,5-DOPA dioxygenase extradiol	NA	NA	NA	NA	NA
WP_069317900.1|3911528_3912689_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	47.3	5.0e-94
WP_069317901.1|3912695_3913391_-	DUF1190 family protein	NA	A0A191ZBZ0	Erwinia_phage	49.3	2.1e-39
WP_069317902.1|3913569_3914934_-	outer membrane channel protein TolC	NA	NA	NA	NA	NA
WP_069317903.1|3915150_3915798_+	ADP-ribose diphosphatase	NA	A0A1S6L1P8	Vibrio_phage	35.9	2.6e-23
WP_069317904.1|3915896_3916736_+	3',5'-cyclic-AMP phosphodiesterase	NA	NA	NA	NA	NA
WP_069317905.1|3916735_3917344_+	esterase YqiA	NA	NA	NA	NA	NA
WP_069317906.1|3917417_3919313_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	34.6	1.1e-93
WP_069317907.1|3919385_3921632_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	33.6	6.1e-88
WP_069317908.1|3921692_3922421_+	1-acylglycerol-3-phosphate O-acyltransferase	NA	NA	NA	NA	NA
WP_069317909.1|3922795_3924208_+	cell division protein FtsP	NA	NA	NA	NA	NA
WP_069317910.1|3924409_3924895_+	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	41.4	3.6e-30
WP_069317911.1|3924970_3925798_-	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	NA	NA	NA	NA
WP_069317912.1|3925800_3926178_-	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
WP_069317913.1|3926215_3927031_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_069317914.1|3927023_3928025_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_069317915.1|3928002_3929307_-	peptidylprolyl isomerase SurA	NA	NA	NA	NA	NA
WP_069317916.1|3929371_3931729_-	LPS assembly protein LptD	NA	NA	NA	NA	NA
WP_069317917.1|3931975_3932785_+	co-chaperone DjlA	NA	NA	NA	NA	NA
WP_069317918.1|3932829_3933483_-|tRNA	bifunctional tRNA pseudouridine(32) synthase/23S rRNA pseudouridine(746) synthase RluA	tRNA	NA	NA	NA	NA
>prophage 22
NZ_CP016176	Xenorhabdus hominickii strain ANU1, complete genome	4522699	4021952	4124919	4522699	capsid,transposase,terminase,integrase,portal,head,holin,protease,tail,tRNA,lysis	Morganella_phage(30.43%)	96	4032388:4032404	4129494:4129510
WP_069317981.1|4021952_4023299_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_069317982.1|4023776_4024250_+	VapA/VapB family virulence-associated protein	NA	NA	NA	NA	NA
WP_069317983.1|4024408_4024867_+	VapA/VapB family virulence-associated protein	NA	NA	NA	NA	NA
WP_069317984.1|4024997_4025261_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_069317985.1|4025595_4026297_+	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_069317986.1|4026386_4028105_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_069317987.1|4028220_4028928_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_069317988.1|4029007_4029391_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_069317989.1|4029544_4030360_-	MetQ/NlpA family lipoprotein	NA	NA	NA	NA	NA
WP_069317990.1|4030515_4031169_-	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_069317991.1|4031161_4032193_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	37.7	3.0e-34
WP_069317992.1|4032371_4032938_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
4032388:4032404	attL	CCGCCGTATTTTTAGAT	NA	NA	NA	NA
WP_069317993.1|4038723_4039653_+	homoserine O-succinyltransferase	NA	NA	NA	NA	NA
WP_099139661.1|4039965_4041561_+	malate synthase A	NA	NA	NA	NA	NA
WP_069317994.1|4041618_4042926_+	isocitrate lyase	NA	NA	NA	NA	NA
WP_069317995.1|4043063_4044839_+	bifunctional isocitrate dehydrogenase kinase/phosphatase	NA	NA	NA	NA	NA
WP_069317996.1|4045035_4045596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069317997.1|4047681_4048512_-	glyoxylate bypass operon transcriptional repressor IclR	NA	NA	NA	NA	NA
WP_069317999.1|4049009_4050383_-	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_069318000.1|4050677_4052324_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_069318001.1|4052506_4053016_+	chorismate lyase	NA	NA	NA	NA	NA
WP_099139663.1|4053031_4053898_+	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_069318003.1|4054005_4056480_-	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_069318004.1|4056617_4056989_+	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_069318005.1|4057107_4057725_+	repressor LexA	NA	U5P451	Shigella_phage	44.4	2.8e-11
WP_069318006.1|4057875_4058388_-	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_145957430.1|4058567_4059200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069318009.1|4059238_4059658_-	DUF2628 domain-containing protein	NA	NA	NA	NA	NA
WP_069318010.1|4059902_4061096_-	MFS transporter	NA	NA	NA	NA	NA
WP_069318565.1|4061539_4061815_-	pyocin activator protein PrtN	NA	A0A1D9C9N7	Salinivibrio_phage	46.5	4.4e-17
WP_145957431.1|4062060_4062426_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157104580.1|4062543_4063238_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_069318012.1|4063279_4063582_-	hypothetical protein	NA	A0A1W6JP41	Morganella_phage	66.7	5.9e-31
WP_069318013.1|4063653_4064481_-	YfdQ family protein	NA	A0A2R2Z323	Escherichia_phage	60.1	4.2e-87
WP_069318014.1|4064545_4064917_-	hypothetical protein	NA	Q8HAA1	Salmonella_phage	66.4	7.0e-42
WP_069318015.1|4065368_4066016_-	helix-turn-helix domain-containing protein	NA	A0A2P0VGT6	Streptococcus_phage	42.9	3.7e-06
WP_069318016.1|4066116_4066344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069318017.1|4066381_4066915_+	hypothetical protein	NA	A5LH68	Enterobacteria_phage	41.5	7.3e-32
WP_157104629.1|4066922_4067099_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069318018.1|4067088_4067271_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_069318019.1|4067280_4068390_+	replication protein	NA	A0A248SL49	Klebsiella_phage	46.9	2.6e-31
WP_069318020.1|4068389_4069049_+	phage N-6-adenine-methyltransferase	NA	Q8SBE9	Shigella_phage	68.1	1.9e-82
WP_069318021.1|4069036_4069717_+	antirepressor	NA	G0ZND1	Cronobacter_phage	56.4	1.4e-59
WP_069318022.1|4069713_4070721_+	DUF968 domain-containing protein	NA	A0A1W6JP62	Morganella_phage	47.9	4.3e-86
WP_084023364.1|4070639_4071398_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069318024.1|4071592_4071793_+	hypothetical protein	NA	A0A1W6JP28	Morganella_phage	57.8	3.8e-10
WP_069318025.1|4071900_4072938_+	site-specific DNA-methyltransferase	NA	A0A1W6JP25	Morganella_phage	66.7	9.8e-134
WP_069318026.1|4073090_4073939_+	DUF2829 domain-containing protein	NA	NA	NA	NA	NA
WP_145957432.1|4074117_4074402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069318028.1|4074510_4074825_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069318029.1|4075036_4075810_+	DUF2829 domain-containing protein	NA	NA	NA	NA	NA
WP_069318030.1|4075973_4076678_+	hypothetical protein	NA	A0A2L0UZ77	Agrobacterium_phage	47.7	4.3e-56
WP_069316231.1|4076762_4077071_+|holin	holin	holin	E7C9S8	Salmonella_phage	64.3	7.6e-26
WP_069318031.1|4077498_4077972_+|lysis	lysis protein	lysis	NA	NA	NA	NA
WP_069318032.1|4077952_4078180_+	hypothetical protein	NA	E5EYD6	Acinetobacter_phage	56.0	1.4e-16
WP_157104630.1|4078758_4078908_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069318034.1|4079338_4079689_+	HNH endonuclease	NA	A0A1W6JP27	Morganella_phage	75.0	2.5e-49
WP_069315756.1|4079955_4080450_+|terminase	phage terminase small subunit P27 family	terminase	Q8HAD7	Salmonella_phage	78.0	2.8e-70
WP_069315757.1|4080446_4082177_+|terminase	terminase large subunit	terminase	U5P0Q5	Shigella_phage	83.2	1.7e-292
WP_069318035.1|4082324_4083554_+|portal	phage portal protein	portal	A0A1W6JP33	Morganella_phage	83.2	1.4e-200
WP_069318036.1|4083546_4084146_+|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	77.4	7.5e-86
WP_069318037.1|4084155_4085379_+|capsid	phage major capsid protein	capsid	A0A1W6JP20	Morganella_phage	75.9	5.7e-173
WP_099139691.1|4085978_4086419_+	HK97 gp10 family phage protein	NA	A0A1W6JP15	Morganella_phage	67.1	6.6e-47
WP_069315764.1|4086415_4086751_+	hypothetical protein	NA	A0A1W6JP05	Morganella_phage	60.4	1.4e-33
WP_069315765.1|4086807_4087284_+|tail	phage tail protein	tail	A0A1W6JP06	Morganella_phage	74.0	5.8e-57
WP_069315766.1|4087289_4087676_+|tail	phage tail protein	tail	A0A0P0ZE84	Stx2-converting_phage	56.5	3.4e-31
WP_069318040.1|4087699_4087972_+	DUF4035 domain-containing protein	NA	A0A0P0ZED8	Stx2-converting_phage	58.2	1.8e-18
WP_069315769.1|4091361_4091715_+|tail	phage tail protein	tail	K7PHJ6	Enterobacteria_phage	47.0	1.7e-24
WP_069318041.1|4091723_4092470_+|tail	phage minor tail protein L	tail	A0A1W6JNX9	Morganella_phage	59.4	3.0e-84
WP_069318566.1|4092480_4093191_+	peptidase P60	NA	A0A1W6JP31	Morganella_phage	56.3	4.1e-75
WP_069315893.1|4093826_4094402_+|tail	tail assembly protein	tail	F1C572	Cronobacter_phage	62.5	2.0e-59
WP_069318043.1|4094453_4097738_+	host specificity protein J	NA	F1C571	Cronobacter_phage	50.7	0.0e+00
WP_069315774.1|4097738_4098734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_084023368.1|4099469_4099976_+	hypothetical protein	NA	A0A1W6JNZ8	Morganella_phage	56.0	1.6e-52
WP_069318045.1|4100354_4101143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069318046.1|4101812_4102904_-|integrase	site-specific integrase	integrase	A0A1W6JP34	Morganella_phage	71.4	8.4e-152
WP_069318047.1|4102992_4104030_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_069318048.1|4104068_4105052_-	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_069318049.1|4105444_4106662_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	59.7	1.3e-145
WP_069318050.1|4106789_4107101_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_069318051.1|4107239_4107575_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	49.5	1.1e-20
WP_069318052.1|4107571_4107874_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	62.5	9.5e-29
WP_069318053.1|4107873_4108278_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	59.6	4.6e-39
WP_069318054.1|4108425_4108779_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	80.3	6.2e-48
WP_069318055.1|4108775_4110437_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	79.2	3.7e-268
WP_069318056.1|4110971_4111880_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_069318057.1|4112421_4112679_+	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	66.2	2.2e-18
WP_069318058.1|4113070_4114480_+	replicative DNA helicase	NA	A0A1B0VG30	Salmonella_phage	76.3	3.6e-195
WP_069318059.1|4114629_4115709_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.9	2.0e-28
WP_069318060.1|4115776_4116973_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_069318061.1|4117326_4118058_+	RNA ligase family protein	NA	NA	NA	NA	NA
WP_069318062.1|4118054_4119182_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_069318063.1|4119339_4119906_-	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_069318064.1|4120348_4123180_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.7	4.0e-310
WP_069318065.1|4123435_4123951_+	single-stranded DNA-binding protein SSB1	NA	A0A1B0VAF5	Salmonella_phage	66.1	2.6e-58
WP_084023245.1|4124478_4124919_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
4129494:4129510	attR	ATCTAAAAATACGGCGG	NA	NA	NA	NA
>prophage 23
NZ_CP016176	Xenorhabdus hominickii strain ANU1, complete genome	4522699	4329446	4434422	4522699	capsid,terminase,integrase,portal,head,holin,protease,tail,tRNA,lysis	Enterobacteria_phage(17.14%)	120	4326047:4326062	4406780:4406795
4326047:4326062	attL	CGCATCACCCAAAATA	NA	NA	NA	NA
WP_069318584.1|4329446_4330079_-|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
WP_069318198.1|4330046_4330733_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.2	2.7e-31
WP_069318199.1|4330729_4333162_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_069318200.1|4333308_4334613_-	MFS transporter	NA	NA	NA	NA	NA
WP_069318201.1|4334640_4335453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069318202.1|4335924_4336539_+	riboflavin synthase	NA	NA	NA	NA	NA
WP_069318203.1|4336759_4337827_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_084023269.1|4337823_4338402_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_069318204.1|4338539_4339262_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_069318205.1|4339285_4339780_-	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_069318206.1|4340323_4341706_+|tRNA	cysteine--tRNA ligase	tRNA	A0A161HRB7	Powai_lake_megavirus	32.7	1.7e-40
WP_071933904.1|4341833_4342070_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069318207.1|4342805_4343018_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_069318208.1|4343017_4343893_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	36.5	4.8e-33
WP_069318209.1|4344228_4344411_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_069318210.1|4344410_4344728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069316160.1|4344717_4344990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069318211.1|4344989_4345214_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069318212.1|4345206_4345818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069318213.1|4345814_4346060_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069318214.1|4346070_4346859_-	ORF6N domain-containing protein	NA	H6WRU9	Salmonella_phage	45.6	1.1e-49
WP_069315732.1|4346858_4347077_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069318215.1|4347076_4347298_-	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_069318216.1|4347294_4347621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099139801.1|4348097_4348400_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069318219.1|4348447_4348819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145957466.1|4348852_4349014_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_069318220.1|4349078_4349402_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069318221.1|4349845_4350316_-	helix-turn-helix domain-containing protein	NA	F1C599	Cronobacter_phage	59.1	3.6e-19
WP_069318222.1|4350418_4350610_+	hypothetical protein	NA	A0A2R2Z333	Escherichia_phage	58.7	3.3e-11
WP_145957467.1|4350799_4351141_+	hypothetical protein	NA	A0A1B5FPB9	Escherichia_phage	40.2	8.5e-10
WP_069318224.1|4351314_4352190_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069318225.1|4352194_4353805_+	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	69.0	5.0e-217
WP_069318226.1|4353801_4354782_+	DNA primase	NA	A0A2L1IV48	Escherichia_phage	56.0	9.1e-105
WP_069318227.1|4354784_4355564_+	antitermination protein	NA	F1C595	Cronobacter_phage	46.9	4.7e-64
WP_069318228.1|4355703_4356018_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069318229.1|4356091_4356328_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069318230.1|4356603_4358199_+	site-specific DNA-methyltransferase	NA	A0A2K5B2C1	Erysipelothrix_phage	33.1	4.5e-61
WP_084022966.1|4358290_4358638_+|holin	phage holin, lambda family	holin	NA	NA	NA	NA
WP_069318231.1|4358637_4359072_+	lysozyme	NA	A0A088FRS5	Escherichia_phage	59.0	3.1e-41
WP_069318232.1|4359068_4359542_+|lysis	lysis protein	lysis	NA	NA	NA	NA
WP_069318233.1|4359538_4359868_+	hypothetical protein	NA	A0A192Y905	Salmonella_phage	42.2	4.8e-10
WP_071933905.1|4359953_4360133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069315415.1|4360467_4361010_+	KilA-N domain-containing protein	NA	A0A2H4FQV0	Salmonella_phage	58.5	2.2e-52
WP_099139797.1|4361135_4361702_+	hypothetical protein	NA	A0A1I9KF52	Aeromonas_phage	34.9	4.4e-11
WP_069318234.1|4361761_4362142_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069318235.1|4362146_4362482_+|holin	holin	holin	A0A2I6PIG1	Escherichia_phage	67.0	1.6e-40
WP_069318236.1|4362676_4363150_+|terminase	terminase	terminase	K7PGU7	Enterobacterial_phage	54.8	4.8e-35
WP_069318237.1|4363159_4364686_+|terminase	terminase large subunit	terminase	Q9MCV7	Escherichia_phage	67.6	1.9e-189
WP_069318586.1|4364731_4365973_+|portal	phage portal protein	portal	A0A1P8DTI5	Proteus_phage	71.4	6.4e-164
WP_069318587.1|4365941_4366796_+|protease	Clp protease ClpP	protease	A0A1P8DTI2	Proteus_phage	62.4	4.6e-97
WP_069318238.1|4366808_4368026_+|capsid	phage major capsid protein	capsid	A0A1P8DTJ7	Proteus_phage	70.6	3.2e-160
WP_069318239.1|4368074_4368407_+|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	49.1	3.7e-18
WP_069318240.1|4368415_4368736_+|head	phage head closure protein	head	A0A1W6JP44	Morganella_phage	47.6	1.7e-20
WP_069318241.1|4368732_4369176_+	hypothetical protein	NA	A0A1P8DTH7	Proteus_phage	59.0	9.6e-38
WP_071933906.1|4369172_4369508_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_069318243.1|4369527_4369998_+|tail	phage tail protein	tail	A0A1W6JP06	Morganella_phage	60.6	1.1e-42
WP_069318244.1|4369994_4370375_+|tail	phage tail protein	tail	K7PKV6	Enterobacterial_phage	52.0	1.4e-29
WP_084023273.1|4370383_4370650_+	DUF4035 domain-containing protein	NA	K7PJX0	Enterobacterial_phage	54.4	3.9e-18
WP_069318245.1|4370658_4374018_+	tape measure protein	NA	A0A1P8DTH2	Proteus_phage	35.0	3.0e-107
WP_069318246.1|4374017_4374350_+|tail	phage tail protein	tail	K7PKL8	Enterobacterial_phage	50.9	2.1e-29
WP_069318247.1|4374362_4375112_+|tail	phage minor tail protein L	tail	K7PGX3	Enterobacteria_phage	58.5	9.4e-86
WP_069318248.1|4375114_4375819_+	C40 family peptidase	NA	K7P6F5	Enterobacteria_phage	67.2	2.6e-93
WP_069318249.1|4375883_4376348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069318250.1|4376402_4377026_+|tail	tail assembly protein	tail	F1C572	Cronobacter_phage	51.3	2.7e-46
WP_069318251.1|4377068_4380266_+	host specificity protein J	NA	F1C571	Cronobacter_phage	53.1	0.0e+00
WP_069318252.1|4380266_4381262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_084023374.1|4381958_4382489_+	hypothetical protein	NA	A0A1W6JNZ8	Morganella_phage	55.4	1.1e-48
WP_084022973.1|4382568_4383600_-	hypothetical protein	NA	A0A0R6PIZ6	Moraxella_phage	20.7	2.7e-06
WP_069318254.1|4384403_4385063_-	methyltransferase	NA	NA	NA	NA	NA
WP_069318256.1|4385862_4387107_-|integrase	site-specific integrase	integrase	A0A248SL35	Klebsiella_phage	32.3	2.3e-36
WP_069318257.1|4388903_4389110_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	50.0	9.6e-09
WP_084023376.1|4389218_4391657_+	hypothetical protein	NA	Q7M2A8	Enterobacteria_phage	42.7	2.0e-169
WP_069318258.1|4392301_4394314_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	26.9	7.2e-32
WP_069318259.1|4394310_4395141_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_069318260.1|4395161_4395431_+	type VI secretion system PAAR protein	NA	NA	NA	NA	NA
WP_084023378.1|4396204_4397065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069318261.1|4397120_4397966_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069318262.1|4399350_4400220_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_145957489.1|4400213_4400456_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069318263.1|4400477_4400738_+	transcriptional regulator	NA	F6MII4	Haemophilus_phage	57.8	1.4e-12
WP_069318264.1|4401236_4401995_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_069318265.1|4401991_4402213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069318266.1|4404310_4405468_-|integrase	site-specific integrase	integrase	A0A0M4R586	Salmonella_phage	76.1	1.7e-174
WP_069318267.1|4405862_4406258_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069318268.1|4406534_4407146_-	LexA family transcriptional regulator	NA	A0A2H4FNG6	Salmonella_phage	53.5	1.6e-11
4406780:4406795	attR	TATTTTGGGTGATGCG	NA	NA	NA	NA
WP_069318269.1|4407299_4407536_+	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	44.3	2.6e-10
WP_069318270.1|4407614_4408397_+	helix-turn-helix domain-containing protein	NA	H9C164	Pectobacterium_phage	78.8	6.9e-39
WP_069318271.1|4408412_4408997_+	AAA family ATPase	NA	K7PLU3	Enterobacteria_phage	43.2	4.2e-41
WP_069318272.1|4408993_4410355_+	AAA family ATPase	NA	K7P852	Enterobacteria_phage	45.9	3.5e-99
WP_069318273.1|4410373_4410763_+	antitermination protein	NA	A0A1W6JNX1	Morganella_phage	69.2	6.0e-44
WP_069318274.1|4410983_4411184_+	hypothetical protein	NA	A0A1W6JP28	Morganella_phage	51.6	2.1e-08
WP_069318275.1|4411283_4412321_+	site-specific DNA-methyltransferase	NA	A0A1W6JP25	Morganella_phage	67.6	5.8e-134
WP_069318276.1|4412472_4413306_+	DUF2829 domain-containing protein	NA	NA	NA	NA	NA
WP_099139842.1|4413531_4413864_+|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	56.8	7.7e-24
WP_046335925.1|4413847_4414267_+	lysozyme	NA	R9TMH8	Aeromonas_phage	56.1	4.5e-37
WP_069318277.1|4414278_4414728_+|lysis	lysis protein	lysis	A0A0H4IT10	Shigella_phage	42.9	6.6e-18
WP_069318279.1|4415309_4415666_+	HNH endonuclease	NA	A0A1P8DTD1	Proteus_phage	65.5	3.3e-41
WP_069318280.1|4416325_4418056_+|terminase	terminase large subunit	terminase	U5P0Q5	Shigella_phage	81.5	4.0e-289
WP_157104634.1|4418063_4418207_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069318281.1|4418241_4419474_+|portal	phage portal protein	portal	Q8W629	Enterobacteria_phage	73.8	1.7e-177
WP_069318592.1|4419451_4420102_+|head,protease	HK97 family phage prohead protease	head,protease	Q8HAD3	Salmonella_phage	74.1	7.1e-90
WP_069318282.1|4420114_4421326_+|capsid	phage major capsid protein	capsid	M1FPN2	Enterobacteria_phage	59.1	1.3e-129
WP_069318283.1|4421341_4421644_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	56.0	1.5e-26
WP_069318284.1|4421654_4421975_+|head	phage head closure protein	head	Q7Y406	Yersinia_phage	42.6	2.9e-12
WP_069318285.1|4421967_4422360_+	hypothetical protein	NA	Q7Y405	Yersinia_phage	53.2	7.7e-31
WP_069318286.1|4422352_4422757_+	hypothetical protein	NA	Q7Y404	Yersinia_phage	52.7	1.1e-27
WP_069318287.1|4422776_4423238_+|tail	phage tail protein	tail	Q6UAX0	Klebsiella_phage	71.6	5.1e-58
WP_069318288.1|4423234_4423582_+|tail	phage tail protein	tail	Q6UAW8	Klebsiella_phage	50.4	2.9e-21
WP_069318289.1|4423785_4427121_+|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	40.7	1.1e-194
WP_069318290.1|4427120_4427453_+|tail	phage tail protein	tail	K7PHJ6	Enterobacteria_phage	43.6	1.2e-16
WP_069318291.1|4427464_4428202_+|tail	phage minor tail protein L	tail	K7PGX3	Enterobacteria_phage	56.0	3.1e-81
WP_099139840.1|4428204_4428951_+	peptidase P60	NA	A0A1P8DTI6	Proteus_phage	53.8	3.5e-72
WP_069318292.1|4428947_4429523_+|tail	tail assembly protein	tail	F1C572	Cronobacter_phage	60.1	2.7e-56
WP_069318293.1|4429540_4432174_+	host specificity protein J	NA	A0A1W6JNZ7	Morganella_phage	52.4	2.2e-262
WP_069318594.1|4432201_4432627_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_069318294.1|4432626_4432881_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_069318295.1|4433215_4433545_+	type I toxin-antitoxin system SymE family toxin	NA	NA	NA	NA	NA
WP_069318296.1|4433684_4434041_+	type I addiction module toxin, SymE family	NA	NA	NA	NA	NA
WP_069318297.1|4434125_4434422_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A141GEX6	Brucella_phage	57.9	2.0e-23
