The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP015834	Escherichia coli strain MS6198 chromosome, complete genome	5176750	204459	270284	5176750	plate,protease,tRNA,transposase	Emiliania_huxleyi_virus(11.11%)	56	NA	NA
WP_022645195.1|204459_205812_+|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
WP_001240896.1|205841_208274_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_000758956.1|208395_208881_+	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001139282.1|208884_209910_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|210014_210470_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_000565966.1|210473_211262_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_022645196.1|211261_212410_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_022645197.1|212406_213003_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	2.3e-26
WP_001294757.1|213039_216522_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
WP_000055746.1|216534_217494_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001020966.1|217592_219734_+	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000901098.1|219790_220180_+	VOC family protein	NA	NA	NA	NA	NA
WP_022645198.1|220244_221543_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000062318.1|221591_221852_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000417058.1|221838_222039_-	YaeP family protein	NA	NA	NA	NA	NA
WP_001185283.1|222204_222750_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_000635528.1|222746_223169_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000239184.1|223182_223893_+	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_022645199.1|224048_224873_-	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_022645200.1|224925_226644_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000094006.1|226754_227462_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001202329.1|227458_227863_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_069383053.1|227980_228796_-	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001294600.1|228835_229489_-	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000593991.1|229481_230513_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001140178.1|230700_231273_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_022645201.1|237042_237846_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	35.8	2.7e-38
WP_000648568.1|237842_238757_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001230983.1|238997_239798_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000211702.1|239874_240645_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000644685.1|240692_242051_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001052732.1|242122_242878_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001308373.1|242911_243634_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917883.1|243630_244098_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001308374.1|244162_244894_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	38.6	7.6e-40
WP_022645202.1|245428_246214_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022645203.1|246363_246831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022645204.1|246845_247754_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022645205.1|247797_248280_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_022645206.1|248303_249656_-	ImpA family type VI secretion system protein	NA	NA	NA	NA	NA
WP_122988716.1|249666_253101_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_022645208.1|253209_254625_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_022645209.1|254629_255373_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_022645210.1|255369_258129_-	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	29.0	7.2e-83
WP_022645211.1|258137_258899_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_022645212.1|258903_260235_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001080149.1|260237_260762_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_001113710.1|260758_262039_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_022645213.1|262063_263146_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_022645214.1|263109_264960_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_022645215.1|264963_265377_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_022645216.1|265383_266859_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_022645217.1|266909_267134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000037391.1|267168_267669_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_001142958.1|268365_268884_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_085949836.1|269070_270284_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	58.4	4.7e-103
>prophage 2
NZ_CP015834	Escherichia coli strain MS6198 chromosome, complete genome	5176750	548486	614801	5176750	tRNA,head,terminase,capsid,portal,lysis,integrase,tail,protease,transposase	Enterobacteria_phage(61.11%)	77	558638:558684	606347:606393
WP_000912345.1|548486_549872_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
WP_001143564.1|549907_550429_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|550536_550749_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729155.1|550750_551617_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000776555.1|552088_552631_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_022645303.1|552850_553543_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_022645304.1|553573_556183_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_000691076.1|556195_557203_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_001255235.1|557213_557729_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000805428.1|557731_558364_-	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
558638:558684	attL	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_001299447.1|558697_559861_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.3	3.4e-199
WP_000488407.1|560059_560338_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
WP_022645305.1|560385_560604_-	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	97.2	5.4e-34
WP_000548537.1|560995_561187_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.1e-26
WP_000149544.1|561159_561342_-	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	96.7	6.9e-27
WP_000186848.1|561338_562019_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	100.0	1.6e-132
WP_022645306.1|562015_562801_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	99.2	6.9e-148
WP_020241285.1|562806_563103_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	3.6e-49
WP_000233579.1|563179_563386_-	hypothetical protein	NA	K7PM31	Enterobacteria_phage	83.8	7.1e-28
WP_000858975.1|563980_564670_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	2.8e-92
WP_001067458.1|564774_565005_+	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
WP_001182772.1|565074_565614_+	toxin YdaT domain-containing protein	NA	M9NZI6	Enterobacteria_phage	66.1	1.5e-61
WP_000147901.1|565610_566630_+	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	63.8	4.4e-110
WP_000788890.1|566626_567328_+	Replication protein P	NA	M1FJ72	Enterobacteria_phage	97.4	7.9e-127
WP_000145902.1|567324_567627_+	hypothetical protein	NA	A0A0N6WES4	Escherichia_phage	93.5	1.7e-41
WP_001070451.1|567694_568027_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_032139864.1|568118_568226_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000709074.1|568283_569810_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.7	3.6e-31
WP_001351655.1|569921_570245_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000379700.1|570706_571063_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072130332.1|571152_571254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001053034.1|571250_571706_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	67.5	4.9e-61
WP_000224912.1|571705_571876_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	1.4e-13
WP_000774504.1|571868_572159_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_001099712.1|572155_572518_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000971074.1|572514_572655_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	6.5e-09
WP_022645308.1|572740_573118_+	antitermination protein Q	NA	Q777W5	Enterobacteria_phage	83.3	8.1e-54
WP_000780581.1|573273_573798_-	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	54.1	1.1e-48
WP_000592546.1|573990_574950_+	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_022645309.1|575301_576033_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000839582.1|576997_577213_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	98.6	1.2e-33
WP_001135261.1|577212_577710_+	lysozyme RrrD	NA	A0A1B5FP97	Escherichia_phage	97.6	4.2e-90
WP_000092273.1|577706_578174_+|lysis	lysis protein	lysis	A0A2D1GLQ7	Escherichia_phage	96.8	1.6e-75
WP_001139678.1|578161_578314_+	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	3.1e-20
WP_000079508.1|578665_579076_-	DUF1398 family protein	NA	C6ZCX4	Enterobacteria_phage	76.3	1.3e-52
WP_000105084.1|579132_579366_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	94.4	7.3e-21
WP_000453580.1|579754_580300_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	100.0	2.8e-95
WP_001027268.1|580274_582200_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.7	0.0e+00
WP_000198149.1|582196_582403_+	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001553867.1|582399_584001_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.2	8.5e-310
WP_022645310.1|583981_585301_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	6.9e-233
WP_001297109.1|585310_585643_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	100.0	2.2e-55
WP_022645311.1|585698_586724_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	99.4	1.0e-191
WP_000158919.1|586765_587164_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	100.0	3.1e-64
WP_000753007.1|587175_587529_+|head,tail	head-tail joining protein	head,tail	A0A0K2FJB7	Enterobacteria_phage	99.1	4.4e-62
WP_001595432.1|587540_588119_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
WP_000683105.1|588115_588511_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_001547245.1|588518_589259_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.9	1.7e-127
WP_001468358.1|589274_589697_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	97.9	2.8e-71
WP_022645312.1|589678_590113_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	99.2	1.5e-64
WP_069383054.1|590105_592667_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	92.4	0.0e+00
WP_000847321.1|592663_592993_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	97.2	8.9e-57
WP_001152639.1|592992_593691_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	100.0	2.3e-134
WP_022645314.1|593696_594440_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	5.9e-149
WP_000090891.1|594376_595009_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	2.2e-96
WP_023909233.1|595069_598549_+	host specificity protein J	NA	A5LH43	Enterobacteria_phage	89.6	0.0e+00
WP_038431964.1|598616_599216_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	92.5	4.4e-102
WP_023909117.1|599280_601638_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A1X7QGG5	Escherichia_phage	50.1	2.2e-117
WP_001204892.1|601637_601907_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022645319.1|601919_602960_+|tail	tail fiber domain-containing protein	tail	A0A0E3M4A9	Enterobacteria_phage	91.9	2.1e-176
WP_000386784.1|603971_604721_+	DNA-binding transcriptional activator AppY	NA	NA	NA	NA	NA
WP_001201842.1|604969_605923_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001177457.1|606435_607197_-	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
606347:606393	attR	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_022645321.1|607379_608270_-	DUF4434 family protein	NA	NA	NA	NA	NA
WP_022645322.1|608270_611243_-	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_022645323.1|611229_613467_-	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_022645324.1|613664_614801_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP015834	Escherichia coli strain MS6198 chromosome, complete genome	5176750	931981	1004759	5176750	head,terminase,capsid,portal,lysis,plate,integrase,tail	Salmonella_phage(69.39%)	79	969999:970013	1008487:1008501
WP_001595551.1|931981_933034_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	55.8	4.8e-104
WP_022645415.1|933116_934793_-	DUF4041 domain-containing protein	NA	A0A142LP25	Marinitoga_camini_virus	66.8	9.8e-83
WP_022645416.1|934813_935410_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	42.9	1.4e-39
WP_000188448.1|935505_935727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022645417.1|935759_936269_+	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.2	1.3e-86
WP_000956182.1|936276_936477_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	98.5	7.1e-33
WP_001311552.1|936440_936782_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
WP_001244228.1|936849_937083_+	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	98.7	6.4e-33
WP_001399246.1|937082_937310_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	7.8e-36
WP_000104157.1|937306_938164_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	98.2	4.1e-162
WP_022645418.1|938160_940575_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.6	0.0e+00
WP_001154434.1|940728_940917_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_001217562.1|940927_941161_+	DinI family protein	NA	E5G6M1	Salmonella_phage	98.7	2.3e-35
WP_022645419.1|941335_942394_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022645420.1|942927_944709_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_022645421.1|944745_945780_-|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	85.5	2.3e-167
WP_022645422.1|945779_947546_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
WP_022645423.1|947688_948522_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	91.0	2.8e-123
WP_000742503.1|948538_949597_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	8.4e-181
WP_021534472.1|949600_950251_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	95.8	9.6e-111
WP_000673523.1|950346_950811_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.6	6.4e-77
WP_000868175.1|950810_951014_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
WP_000171568.1|951017_951233_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_022645424.1|951213_951726_+	lysozyme	NA	E5G6N1	Salmonella_phage	91.1	2.0e-87
WP_022645425.1|951727_952105_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	8.8e-16
WP_022645426.1|952101_952530_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	75.2	1.9e-46
WP_001595569.1|952625_953057_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	93.7	9.9e-72
WP_021522006.1|953049_953496_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	84.2	4.0e-60
WP_022645427.1|953437_954244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000993764.1|954347_954926_+|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	86.5	7.2e-94
WP_000177597.1|954922_955282_+	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	85.7	2.8e-51
WP_022645428.1|955268_956177_+|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.7	3.5e-143
WP_022645429.1|956169_956775_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.5	1.2e-110
WP_022645430.1|956771_958313_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	71.2	7.6e-199
WP_022645431.1|958312_958915_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	84.4	3.7e-93
WP_000046146.1|959048_960221_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.0	7.8e-204
WP_001207660.1|960230_960746_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.3	2.1e-89
WP_022645432.1|960800_961103_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	88.0	3.5e-39
WP_000763311.1|961117_961237_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_022645433.1|961229_964307_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	69.3	0.0e+00
WP_022645434.1|964303_964789_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	79.4	1.6e-65
WP_022645435.1|964785_965886_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	85.2	1.0e-176
WP_000972391.1|965976_966195_+	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_001024876.1|966430_968116_-	aspartate:alanine antiporter	NA	NA	NA	NA	NA
WP_000681108.1|968385_968763_+	inner membrane protein YbjM	NA	NA	NA	NA	NA
WP_001195231.1|968792_969050_-	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	63.1	7.8e-24
WP_022645436.1|969209_969497_+	DUF1418 family protein	NA	NA	NA	NA	NA
WP_022645437.1|969480_970203_+	nitroreductase NfsA	NA	NA	NA	NA	NA
969999:970013	attL	CATTTTGGTGCATGA	NA	NA	NA	NA
WP_000684321.1|970263_971166_+	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_000203025.1|971253_971730_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000126075.1|972080_973193_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000996007.1|973287_974421_+	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
WP_000105436.1|974430_975384_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_001061658.1|975380_976226_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_000389260.1|976285_976774_+	YbjO family protein	NA	NA	NA	NA	NA
WP_001149713.1|976814_977942_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.6	3.5e-28
WP_001295905.1|977970_978702_-	ABC transporter substrate-binding protein ArtJ	NA	NA	NA	NA	NA
WP_000464489.1|978927_979596_-	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_001001702.1|979595_980312_-	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_000756575.1|980318_981050_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000027205.1|981067_981796_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
WP_001270657.1|982013_982529_-	lipoprotein	NA	NA	NA	NA	NA
WP_022645438.1|983176_984946_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_001160731.1|985156_985480_+	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001255167.1|985476_986307_+	N-acetylmuramoyl-L-alanine amidase AmiD	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
WP_001305933.1|986303_987317_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_022645439.1|987415_988846_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000566375.1|988856_989858_-	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_000815366.1|989894_991613_-	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.0	6.8e-31
WP_000178691.1|991745_992714_-	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_022645440.1|992725_994378_-	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_022645441.1|994520_995420_-	L-lysine exporter LysO	NA	NA	NA	NA	NA
WP_000488716.1|995877_996573_-	aquaporin Z	NA	NA	NA	NA	NA
WP_000599806.1|996998_998657_+	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_001400542.1|998653_999610_-	DUF535 domain-containing protein	NA	NA	NA	NA	NA
WP_000746460.1|999760_1000876_+	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
WP_022645444.1|1000872_1002819_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	6.5e-38
WP_000410785.1|1002891_1003116_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_022645445.1|1003520_1004759_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	52.5	4.5e-125
1008487:1008501	attR	TCATGCACCAAAATG	NA	NA	NA	NA
>prophage 4
NZ_CP015834	Escherichia coli strain MS6198 chromosome, complete genome	5176750	1402149	1481739	5176750	holin,head,terminase,capsid,portal,integrase,tail,protease,transposase	Escherichia_phage(39.29%)	93	1402937:1402953	1429178:1429194
WP_024181814.1|1402149_1403496_+|transposase	IS4-like element IS4 family transposase	transposase	NA	NA	NA	NA
1402937:1402953	attL	CCAGCCCGCAGGCACGA	NA	NA	NA	NA
WP_000301651.1|1403550_1406226_-	bifunctional acetaldehyde-CoA/alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_022645592.1|1406702_1407350_+	NAAT family transporter YchE	NA	NA	NA	NA	NA
WP_001211525.1|1407507_1407804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000182039.1|1408087_1409719_+	oligopeptide ABC transporter substrate-binding protein OppA	NA	NA	NA	NA	NA
WP_000911112.1|1409804_1410725_+	oligopeptide ABC transporter permease OppB	NA	NA	NA	NA	NA
WP_000979659.1|1410739_1411648_+	oligopeptide ABC transporter permease OppC	NA	NA	NA	NA	NA
WP_000110931.1|1411659_1412673_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppD	NA	G9BWD6	Planktothrix_phage	31.7	2.0e-14
WP_000994905.1|1412669_1413674_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G3M9Y6	Bacillus_virus	30.7	2.3e-15
WP_000366959.1|1413726_1414056_-	YciU family protein	NA	NA	NA	NA	NA
WP_000214516.1|1414090_1415551_-	cardiolipin synthase	NA	NA	NA	NA	NA
WP_001309467.1|1415693_1415867_+	YciY family protein	NA	NA	NA	NA	NA
WP_000020078.1|1415921_1417175_-	voltage-gated potassium channel protein	NA	NA	NA	NA	NA
WP_000967595.1|1417475_1417772_-	YciI family protein	NA	NA	NA	NA	NA
WP_001357407.1|1417995_1418712_+	TonB system transport protein TonB	NA	NA	NA	NA	NA
WP_000108160.1|1418751_1419150_-	acyl-CoA thioester hydrolase YciA	NA	NA	NA	NA	NA
WP_000808667.1|1419254_1419794_-	septation protein A	NA	NA	NA	NA	NA
WP_000028546.1|1419823_1420567_-	UPF0259 family protein	NA	NA	NA	NA	NA
WP_000737218.1|1420923_1421577_+	outer membrane protein OmpW	NA	NA	NA	NA	NA
WP_001735157.1|1421622_1422753_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	51.4	5.7e-103
WP_000113189.1|1422730_1422979_-	excisionase	NA	NA	NA	NA	NA
WP_022645593.1|1423043_1425515_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.2	1.1e-58
WP_001090200.1|1425607_1425799_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|1425795_1425984_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001171942.1|1426551_1426770_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379575.1|1426929_1427085_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_000362153.1|1427350_1427770_-	hypothetical protein	NA	K7PK07	Enterobacteria_phage	65.1	8.8e-25
WP_000391950.1|1427870_1428152_+	helix-turn-helix domain-containing protein	NA	K7PHA1	Enterobacteria_phage	72.6	6.5e-24
WP_000693949.1|1428135_1428561_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262390.1|1428632_1429703_+	hypothetical protein	NA	A0A088CD36	Shigella_phage	56.6	2.6e-52
1429178:1429194	attR	CCAGCCCGCAGGCACGA	NA	NA	NA	NA
WP_022645595.1|1429743_1430166_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.9	7.4e-64
WP_000403785.1|1430223_1430580_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	99.2	1.8e-58
WP_001224662.1|1430673_1430856_+	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	100.0	1.4e-27
WP_000753060.1|1430848_1431025_+	hypothetical protein	NA	A0A2R2X2A8	Escherichia_phage	94.8	6.7e-27
WP_000813254.1|1431946_1432102_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_023141427.1|1432269_1432542_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	50.8	4.2e-12
WP_022645596.1|1432543_1433602_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.0	4.4e-89
WP_000139998.1|1433602_1433965_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.6	9.6e-36
WP_001545909.1|1433979_1434801_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.6	1.8e-77
WP_000562553.1|1435697_1435829_+	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	100.0	3.7e-06
WP_000871291.1|1436109_1436445_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	5.2e-44
WP_000874243.1|1436704_1436893_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	95.2	7.2e-27
WP_001323614.1|1436889_1437051_+	hypothetical protein	NA	Q08JA2	Stx2-converting_phage	91.3	5.4e-15
WP_000372595.1|1437200_1437416_+|holin	class II holin family protein	holin	A0A2R2Z340	Escherichia_phage	98.6	3.4e-33
WP_000193264.1|1437420_1437771_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	94.0	1.4e-36
WP_000992097.1|1437834_1438368_+	lysozyme	NA	Q08J98	Stx2-converting_phage	93.2	1.5e-98
WP_075202333.1|1438584_1438767_+	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	77.0	2.2e-17
WP_000738421.1|1438857_1439151_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	90.7	5.9e-44
WP_001415975.1|1439510_1439705_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.9	4.3e-27
WP_000453611.1|1440093_1440639_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	2.3e-94
WP_022645597.1|1440613_1442539_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.9	0.0e+00
WP_000198149.1|1442535_1442742_+	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_022645598.1|1442738_1444340_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.2	8.5e-310
WP_022645599.1|1444320_1445640_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.6	8.1e-234
WP_001338090.1|1445649_1445982_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	6.5e-55
WP_032140162.1|1446037_1447063_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	96.8	3.8e-186
WP_000158868.1|1447104_1447500_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	95.5	5.7e-58
WP_000752960.1|1447511_1447865_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	99.1	7.6e-62
WP_001398561.1|1447876_1448455_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	97.9	8.6e-79
WP_021550753.1|1448451_1448847_+|tail	phage tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	97.7	8.5e-70
WP_001317730.1|1448854_1449595_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	97.2	5.2e-129
WP_000479193.1|1449610_1450033_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	85.7	2.2e-60
WP_000459457.1|1450014_1450449_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_022645607.1|1450441_1453003_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	89.3	0.0e+00
WP_000847401.1|1452999_1453329_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	92.7	6.0e-53
WP_001152612.1|1453328_1454027_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
WP_022645608.1|1454031_1454775_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	95.1	2.9e-143
WP_071597161.1|1454711_1455344_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.0	1.4e-95
WP_069383056.1|1455404_1458884_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	89.5	0.0e+00
WP_000290529.1|1458942_1461288_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0E3M0V5	Enterobacteria_phage	45.4	9.5e-92
WP_000654156.1|1461284_1461566_+	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	50.0	4.1e-18
WP_000235987.1|1461575_1462280_+	hypothetical protein	NA	A0A1X7QGH6	Escherichia_phage	61.7	9.2e-59
WP_000355602.1|1462290_1462584_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022645610.1|1462777_1463446_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937495.1|1463502_1463772_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	79.4	9.3e-20
WP_000251936.1|1463886_1464057_+	hypothetical protein	NA	A0A0U2RK60	Escherichia_phage	62.5	9.4e-10
WP_001056491.1|1465096_1465597_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000807651.1|1465682_1465862_-	general stress protein	NA	NA	NA	NA	NA
WP_022645611.1|1466252_1467059_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_022645612.1|1467058_1468252_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_001195273.1|1468263_1469622_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	41.2	3.9e-37
WP_000763524.1|1469625_1471221_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	1.7e-52
WP_022645613.1|1471220_1472783_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|1472874_1472919_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285663.1|1473056_1473938_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|1473934_1474555_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_022645614.1|1474582_1476472_+	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001291217.1|1476682_1477558_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_022645615.1|1477727_1478750_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001000715.1|1478759_1479068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001278893.1|1479124_1479715_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559277.1|1479711_1480470_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.4	4.4e-06
WP_000422059.1|1480689_1481739_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 5
NZ_CP015834	Escherichia coli strain MS6198 chromosome, complete genome	5176750	1699083	1766808	5176750	terminase,lysis,portal,tail,transposase	Enterobacteria_phage(50.0%)	61	NA	NA
WP_088895425.1|1699083_1700312_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_022645702.1|1706807_1708400_-	autoinducer-2 kinase	NA	NA	NA	NA	NA
WP_000154352.1|1708478_1709432_-	transcriptional regulator LsrR	NA	NA	NA	NA	NA
WP_001194902.1|1709680_1711216_+	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	24.0	3.2e-16
WP_022645703.1|1711209_1712238_+	autoinducer 2 ABC transporter permease LsrC	NA	NA	NA	NA	NA
WP_001222725.1|1712237_1713230_+	autoinducer 2 ABC transporter permease LsrD	NA	NA	NA	NA	NA
WP_000172485.1|1713241_1714264_+	autoinducer 2 ABC transporter substrate-binding protein LsrB	NA	NA	NA	NA	NA
WP_022645704.1|1714290_1715166_+	3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase	NA	NA	NA	NA	NA
WP_000558525.1|1715189_1715480_+	(4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase	NA	NA	NA	NA	NA
WP_022645705.1|1715536_1716295_+	trans-aconitate 2-methyltransferase	NA	NA	NA	NA	NA
WP_022645706.1|1716298_1717213_-	bestrophin family protein	NA	NA	NA	NA	NA
WP_022645707.1|1717409_1718861_-	tagaturonate reductase	NA	NA	NA	NA	NA
WP_022645708.1|1719088_1720507_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.1	1.4e-18
WP_022645709.1|1720645_1721005_-	DUF4186 domain-containing protein	NA	NA	NA	NA	NA
WP_000257409.1|1721004_1721931_-	glutaminase B	NA	NA	NA	NA	NA
WP_000156623.1|1721994_1723383_-	succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000366505.1|1723483_1724365_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_022645710.1|1724442_1725558_+	putative protein YneK	NA	NA	NA	NA	NA
WP_000210799.1|1725707_1726898_+	L-arabinose MFS transporter	NA	NA	NA	NA	NA
WP_000885033.1|1726922_1727588_-	NAAT family transporter MarC	NA	NA	NA	NA	NA
WP_022645711.1|1727799_1728234_+	multiple antibiotic resistance transcriptional regulator MarR	NA	NA	NA	NA	NA
WP_000091199.1|1728254_1728638_+	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
WP_000803527.1|1728669_1728888_+	multiple antibiotic resistance protein MarB	NA	NA	NA	NA	NA
WP_000087204.1|1728918_1729818_-	O-acetylserine/cysteine exporter	NA	NA	NA	NA	NA
WP_022645712.1|1730012_1731200_+	efflux MFS transporter YdeE	NA	NA	NA	NA	NA
WP_000901367.1|1731326_1731422_+	protein MgtS	NA	NA	NA	NA	NA
WP_000592819.1|1731640_1732531_-	diguanylate cyclase DgcZ	NA	A0A127AWB9	Bacillus_phage	37.0	1.4e-19
WP_022645713.1|1732785_1733178_-	YdeI family stress tolerance OB fold protein	NA	NA	NA	NA	NA
WP_022645714.1|1733543_1735589_-	peptidyl-dipeptidase Dcp	NA	NA	NA	NA	NA
WP_000636571.1|1735725_1736472_+	bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG	NA	NA	NA	NA	NA
WP_022645715.1|1736560_1737247_+	DNA-binding transcriptional regulator YdfH	NA	NA	NA	NA	NA
WP_000214712.1|1737423_1737627_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_000527788.1|1737662_1739123_-	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	30.1	6.6e-43
WP_120795384.1|1741100_1741214_+	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836768.1|1741282_1741516_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_000086527.1|1741832_1742423_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_001546828.1|1742650_1742944_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001546829.1|1742986_1744027_-|tail	tail fiber domain-containing protein	tail	A0A0E3M4A9	Enterobacteria_phage	80.5	4.5e-155
WP_001546830.1|1744037_1744316_-	hypothetical protein	NA	A0A0E3GMJ7	Enterobacteria_phage	54.3	3.8e-24
WP_001546831.1|1744312_1746685_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0E3M0V5	Enterobacteria_phage	47.5	4.1e-103
WP_001228249.1|1746749_1747349_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	92.0	1.5e-102
WP_022645716.1|1747416_1750896_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.3	0.0e+00
WP_023277304.1|1750956_1751604_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.9	4.7e-110
WP_001613114.1|1753134_1754643_-|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.2	1.2e-286
WP_001072975.1|1754642_1754855_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000507029.1|1754851_1756951_-|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	99.0	0.0e+00
WP_000421825.1|1756959_1757499_-	DUF1441 family protein	NA	A5LH26	Enterobacteria_phage	100.0	1.8e-94
WP_000548585.1|1758049_1758256_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	77.9	7.6e-22
WP_023356416.1|1758543_1758954_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	78.5	1.2e-55
WP_001082503.1|1759273_1759738_-|lysis	lysis protein	lysis	A0A0K2FJD0	Enterobacteria_phage	84.2	5.9e-62
WP_001274706.1|1760036_1760570_-	lysozyme	NA	Q08J98	Stx2-converting_phage	95.5	1.7e-97
WP_039052575.1|1760625_1760940_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	98.1	5.4e-51
WP_000839561.1|1760944_1761160_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	95.8	5.9e-33
WP_001348108.1|1761411_1761786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000506936.1|1761957_1762386_-	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_029380182.1|1762752_1762881_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	96.4	4.7e-06
WP_000762866.1|1763602_1764424_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	59.0	1.2e-78
WP_000904112.1|1764420_1764795_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	8.4e-35
WP_001695976.1|1764807_1765857_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.0	2.7e-107
WP_001429486.1|1765858_1766137_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	4.3e-12
WP_000887491.1|1766595_1766808_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	97.1	1.7e-29
>prophage 6
NZ_CP015834	Escherichia coli strain MS6198 chromosome, complete genome	5176750	1769984	1786642	5176750	lysis	Escherichia_phage(33.33%)	21	NA	NA
WP_032285383.1|1769984_1770401_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	90.3	1.8e-62
WP_032285382.1|1770441_1771512_-	phage replisome organizer	NA	A0A088CD36	Shigella_phage	56.1	7.4e-52
WP_032285381.1|1771583_1772009_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001072337.1|1772005_1772260_-	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	60.3	2.8e-18
WP_000233320.1|1772339_1772759_+	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	47.5	4.2e-19
WP_032154077.1|1773056_1773212_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	3.4e-06
WP_000344944.1|1773213_1773789_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000854559.1|1774275_1774464_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001083297.1|1774460_1774652_+|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_069383057.1|1774744_1777216_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.7	8.5e-59
WP_000005552.1|1777288_1777540_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_000876985.1|1777574_1778855_+	DUF3596 domain-containing protein	NA	B6DZ48	Enterobacteria_phage	62.6	1.7e-156
WP_001389342.1|1778856_1778985_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000836037.1|1779042_1780062_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
WP_001295394.1|1780073_1781288_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_001304355.1|1781493_1781820_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	54.5	2.9e-23
WP_000705197.1|1781954_1782296_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001138584.1|1782330_1782891_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_001445899.1|1782893_1783604_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001295396.1|1783711_1784017_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_022645727.1|1784215_1786642_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	1.7e-213
>prophage 7
NZ_CP015834	Escherichia coli strain MS6198 chromosome, complete genome	5176750	2329439	2338155	5176750		Enterobacteria_phage(42.86%)	8	NA	NA
WP_000735124.1|2329439_2330567_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAI1	Catovirus	30.4	5.3e-32
WP_001362820.1|2330576_2331815_-	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_001100791.1|2331846_2332395_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	56.1	4.2e-51
WP_000857549.1|2332399_2333278_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.1	1.5e-106
WP_001023627.1|2333335_2334235_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.6	1.5e-29
WP_000699418.1|2334234_2335320_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.2	1.4e-101
WP_000183060.1|2335692_2336586_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_001116131.1|2336760_2338155_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	2.8e-19
>prophage 8
NZ_CP015834	Escherichia coli strain MS6198 chromosome, complete genome	5176750	2431707	2441149	5176750		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001329822.1|2431707_2432844_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	4.2e-162
WP_022645869.1|2432840_2434841_+	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	95.8	0.0e+00
WP_022645870.1|2434965_2435427_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	98.7	3.5e-75
WP_001295430.1|2435467_2435938_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_012311742.1|2435984_2436704_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001334139.1|2436700_2438386_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.5	9.5e-304
WP_001240398.1|2438607_2439339_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.0	2.8e-111
WP_001216963.1|2439398_2439506_+	protein YohO	NA	NA	NA	NA	NA
WP_022645871.1|2439486_2440218_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_022645872.1|2440222_2441149_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.2e-23
>prophage 9
NZ_CP015834	Escherichia coli strain MS6198 chromosome, complete genome	5176750	3712613	3768103	5176750	tail,tRNA,head,terminase,capsid,portal,protease	uncultured_Caudovirales_phage(50.0%)	54	NA	NA
WP_000366126.1|3712613_3713111_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.8	2.5e-26
WP_000257293.1|3713116_3713755_-	stringent starvation protein A	NA	NA	NA	NA	NA
WP_000829818.1|3714148_3714541_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_000847559.1|3714556_3714985_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_001190805.1|3715203_3716331_-	cell division protein ZapE	NA	NA	NA	NA	NA
WP_001295270.1|3716524_3716923_+	DUF1043 family protein	NA	NA	NA	NA	NA
WP_001295271.1|3717076_3718444_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.6	2.3e-21
WP_000497723.1|3718533_3719601_+	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1S5Y2X3	uncultured_archaeal_virus	24.2	6.8e-05
WP_001315036.1|3719663_3720602_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_001257846.1|3721036_3721507_+	transcriptional regulator ArgR	NA	NA	NA	NA	NA
WP_000695690.1|3721871_3722135_+	peroxide/acid stress response protein YhcN	NA	NA	NA	NA	NA
WP_001029013.1|3722191_3722464_-	barstar family protein	NA	NA	NA	NA	NA
WP_000510964.1|3722555_3724523_-	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
WP_000854023.1|3724528_3725461_-	p-hydroxybenzoic acid efflux pump subunit AaeA	NA	NA	NA	NA	NA
WP_000051841.1|3725468_3725672_-	AaeX family protein	NA	NA	NA	NA	NA
WP_000440317.1|3725854_3726784_+	HTH-type transcriptional activator AaeR	NA	NA	NA	NA	NA
WP_021541362.1|3726911_3728357_-|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_022646171.1|3728512_3732313_-	AsmA2 domain-containing protein YhdP	NA	NA	NA	NA	NA
WP_000123197.1|3732380_3733850_-	ribonuclease G	NA	NA	NA	NA	NA
WP_000203099.1|3733839_3734433_-	nucleoside triphosphate pyrophosphatase YhdE	NA	NA	NA	NA	NA
WP_000179409.1|3734441_3734930_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_000802511.1|3734929_3736033_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_000913396.1|3736098_3737142_-	rod shape-determining protein MreB	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
WP_022646172.1|3737446_3739387_-	RNase E specificity factor CsrD	NA	NA	NA	NA	NA
WP_022646173.1|3739538_3740513_+	oxidoreductase	NA	NA	NA	NA	NA
WP_000838294.1|3740549_3741380_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000354622.1|3742245_3742716_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_000884639.1|3742726_3744076_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_000787055.1|3744167_3745214_-	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
WP_000048617.1|3745210_3746173_-	sugar kinase	NA	NA	NA	NA	NA
WP_000137049.1|3746194_3747184_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_022646174.1|3747184_3748684_-	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	32.3	4.7e-12
WP_001361192.1|3748744_3749635_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_000275531.1|3749670_3750525_-	tagatose bisphosphate family class II aldolase	NA	NA	NA	NA	NA
WP_000843961.1|3750866_3751697_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	27.0	1.2e-09
WP_032140302.1|3751728_3752664_+	sugar kinase	NA	NA	NA	NA	NA
WP_000381171.1|3752756_3752999_+	YhdT family protein	NA	NA	NA	NA	NA
WP_001175698.1|3752988_3754440_+	sodium/pantothenate symporter	NA	NA	NA	NA	NA
WP_001145812.1|3754451_3755333_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_001219652.1|3755661_3756627_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_000462905.1|3756652_3756949_+	DNA-binding transcriptional regulator Fis	NA	NA	NA	NA	NA
WP_001449337.1|3757730_3758012_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022646176.1|3758017_3759679_-|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	82.6	1.2e-277
WP_001353110.1|3759662_3760019_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	83.8	6.1e-51
WP_001251188.1|3760138_3760324_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001145897.1|3760307_3760748_-	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	76.0	9.1e-65
WP_001287546.1|3760747_3761050_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	61.1	1.4e-27
WP_000270252.1|3761042_3762257_-|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	87.3	7.5e-210
WP_000798770.1|3762258_3762819_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	84.4	9.8e-88
WP_000733254.1|3762873_3764043_-|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	75.8	6.7e-163
WP_022646177.1|3764440_3765037_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000365446.1|3765096_3765606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001122065.1|3765640_3765901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001553503.1|3766285_3768103_-	hypothetical protein	NA	Q7M2A8	Enterobacteria_phage	47.9	1.7e-128
>prophage 10
NZ_CP015834	Escherichia coli strain MS6198 chromosome, complete genome	5176750	4661931	4678452	5176750	plate,holin,tail	Burkholderia_phage(33.33%)	22	NA	NA
WP_022646405.1|4661931_4662723_+	nucleotidyltransferase domain-containing protein	NA	A0A2D1GQQ2	Pseudomonas_phage	45.1	2.0e-46
WP_022646406.1|4662736_4663192_-	hypothetical protein	NA	F6MIM0	Haemophilus_phage	42.7	6.6e-26
WP_022646407.1|4663188_4663896_-	DUF4376 domain-containing protein	NA	A0A0E3JQ06	Enterobacteria_phage	42.4	5.3e-14
WP_022646408.1|4663892_4665503_-|tail	phage tail protein	tail	A0A0M3ULH6	Salmonella_phage	39.1	3.8e-84
WP_022646409.1|4665505_4666222_-|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	37.2	3.1e-22
WP_022646410.1|4666214_4667330_-|plate	baseplate J/gp47 family protein	plate	Q6QI99	Burkholderia_phage	51.7	2.0e-100
WP_022646411.1|4667320_4667680_-	GPW/gp25 family protein	NA	Q6QIA0	Burkholderia_phage	64.2	1.1e-34
WP_000679403.1|4667778_4668480_-|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	36.3	6.4e-12
WP_022646412.1|4668489_4669530_-	phage late control D family protein	NA	A4JWL3	Burkholderia_virus	45.1	2.0e-73
WP_001269711.1|4669517_4669727_-|tail	tail protein X	tail	A4JWL2	Burkholderia_virus	60.3	1.3e-16
WP_022646413.1|4669726_4670680_-|tail	phage tail protein	tail	A4JWL1	Burkholderia_virus	50.8	3.3e-35
WP_022646414.1|4670679_4673055_-	hypothetical protein	NA	A4JWL0	Burkholderia_virus	26.0	1.0e-56
WP_015674804.1|4673156_4673285_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_022646415.1|4673244_4673562_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000907502.1|4673612_4674137_-|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.0	9.5e-69
WP_022646416.1|4674136_4675561_-|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.2	7.0e-191
WP_000875310.1|4675550_4675748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022646417.1|4675744_4676200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000777272.1|4676344_4676659_-	membrane protein	NA	Q5ZQY8	Pseudomonas_phage	43.2	9.2e-19
WP_000266448.1|4676671_4677277_-	lytic transglycosylase domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	57.1	3.3e-57
WP_022646418.1|4677279_4677567_-|holin	putative holin	holin	Q6QIC8	Burkholderia_phage	48.6	3.9e-16
WP_000619864.1|4678104_4678452_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	49.0	2.2e-21
>prophage 11
NZ_CP015834	Escherichia coli strain MS6198 chromosome, complete genome	5176750	4707697	4753872	5176750	tail,integrase,tRNA,terminase,lysis,portal,protease	Enterobacteria_phage(56.25%)	55	4729301:4729315	4756222:4756236
WP_000390072.1|4707697_4707871_+	hypothetical protein	NA	K7PJQ2	Enterobacteria_phage	98.2	9.8e-23
WP_001093918.1|4707918_4708200_-	pyocin activator PrtN family protein	NA	K7PGU0	Enterobacteria_phage	98.9	8.7e-45
WP_001061348.1|4708236_4708809_-	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	99.5	1.2e-109
WP_039052442.1|4708808_4709612_-	DUF551 domain-containing protein	NA	K7PH57	Enterobacteria_phage	94.0	5.4e-79
WP_001151811.1|4709615_4709765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024190088.1|4709766_4710354_-	hypothetical protein	NA	Q9MCT8	Escherichia_phage	76.4	4.9e-98
WP_000008179.1|4710344_4710881_-	5'-deoxynucleotidase	NA	A0A0P0ZCH9	Stx2-converting_phage	98.3	1.2e-98
WP_039052441.1|4711008_4711833_-	DUF2303 family protein	NA	U5P439	Shigella_phage	99.3	5.0e-149
WP_039052440.1|4711898_4712261_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	94.2	4.9e-56
WP_000357060.1|4712722_4713226_+	hypothetical protein	NA	A0A077K9U2	Edwardsiella_phage	47.6	1.2e-31
WP_000450740.1|4713593_4714220_-	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	48.8	3.2e-47
WP_032353353.1|4714317_4714518_+	cell division protein	NA	NA	NA	NA	NA
WP_000514174.1|4714555_4715140_+	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	60.9	5.5e-57
WP_001250270.1|4715315_4715528_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	5.4e-15
WP_039052439.1|4715484_4716477_+	hypothetical protein	NA	U5P0A0	Shigella_phage	97.6	1.4e-92
WP_039052438.1|4716571_4717225_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	100.0	1.1e-127
WP_000210187.1|4717221_4717548_+	LexA family transcriptional regulator	NA	A5LH73	Enterobacteria_phage	100.0	1.6e-53
WP_000767134.1|4717544_4717934_+	RusA family crossover junction endodeoxyribonuclease	NA	A5LH74	Enterobacteria_phage	100.0	3.2e-69
WP_001061445.1|4717953_4718763_+	KilA-N domain-containing protein	NA	A0A291AWU7	Escherichia_phage	99.6	4.0e-151
WP_001433852.1|4718770_4719760_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.7	1.9e-195
WP_039052437.1|4719773_4720526_+	antitermination protein	NA	Q8SBE4	Shigella_phage	98.4	7.6e-136
WP_039052436.1|4720806_4721232_+	hypothetical protein	NA	A0A291AWZ9	Escherichia_phage	97.9	3.0e-73
WP_000917724.1|4721455_4721659_+	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	100.0	6.1e-32
WP_021521156.1|4721809_4722862_+	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	99.7	6.1e-208
WP_000839596.1|4722929_4723145_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001529529.1|4723149_4723500_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	94.0	6.4e-37
WP_001529530.1|4723563_4724097_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	97.2	1.3e-100
WP_001300226.1|4724093_4724561_+|lysis	lysis protein	lysis	K7PH77	Enterobacteria_phage	100.0	2.9e-77
WP_001139681.1|4724548_4724701_+	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	4.7e-21
WP_001205135.1|4724842_4725019_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000421825.1|4725374_4725914_+	DUF1441 family protein	NA	A5LH26	Enterobacteria_phage	100.0	1.8e-94
WP_000507030.1|4725922_4728022_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	99.4	0.0e+00
WP_001072975.1|4728018_4728231_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_001529531.1|4728230_4729739_+|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.2	2.3e-288
4729301:4729315	attL	GCGTCAGGAACTGGT	NA	NA	NA	NA
WP_001136590.1|4729683_4731711_+|protease	Clp protease ClpP	protease	A5LH30	Enterobacteria_phage	99.5	0.0e+00
WP_001097055.1|4731797_4732121_+	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	99.1	2.5e-51
WP_001283153.1|4732113_4732389_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_069383065.1|4732400_4732991_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	79.6	9.4e-81
WP_001079398.1|4732987_4733389_+|tail	tail protein	tail	A0A291AWY2	Escherichia_phage	100.0	8.3e-73
WP_000211088.1|4733400_4734144_+|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	99.6	3.0e-132
WP_001398454.1|4734204_4734591_+|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	97.7	2.3e-64
WP_001161009.1|4734599_4734929_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_039052374.1|4739008_4739752_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	95.1	4.7e-146
WP_069383066.1|4740355_4743835_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.2	0.0e+00
WP_001228228.1|4743902_4744502_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	93.0	1.2e-102
WP_069383067.1|4744566_4746915_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0E3M0V5	Enterobacteria_phage	46.3	9.5e-92
WP_022646431.1|4746911_4747193_+	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	50.0	4.1e-18
WP_001595444.1|4747202_4747907_+|tail	tail fiber domain-containing protein	tail	A0A1X7QGH6	Escherichia_phage	61.7	7.0e-59
WP_022646432.1|4747917_4748205_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001217539.1|4748315_4748564_-	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	100.0	1.1e-38
WP_000332260.1|4748625_4749723_-|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	99.2	4.0e-210
WP_077877367.1|4749811_4750849_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_000891408.1|4750982_4751225_+	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_022646433.1|4751390_4752374_-	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000918363.1|4752456_4753872_+	replicative DNA helicase	NA	O80281	Escherichia_phage	78.3	4.8e-200
4756222:4756236	attR	GCGTCAGGAACTGGT	NA	NA	NA	NA
>prophage 12
NZ_CP015834	Escherichia coli strain MS6198 chromosome, complete genome	5176750	4947613	5016452	5176750	holin,protease,tRNA,transposase	Vibrio_phage(20.0%)	57	NA	NA
WP_001162175.1|4947613_4948966_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_001232240.1|4949148_4949535_+	cytochrome b562	NA	NA	NA	NA	NA
WP_001106222.1|4949579_4950044_-	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	H6WXC9	Vibrio_phage	59.7	1.1e-52
WP_000187778.1|4950201_4952340_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.5	1.5e-266
WP_001339491.1|4952733_4954389_-	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_001299664.1|4954438_4955860_-	PTS trehalose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_001181324.1|4955978_4956926_-	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	7.9e-13
WP_001387276.1|4957110_4957164_+	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
WP_000471889.1|4957303_4960000_+	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.4	9.0e-46
WP_000047538.1|4960205_4960592_-	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_000148581.1|4960664_4961126_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000013046.1|4961138_4962074_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	2.9e-52
WP_001296693.1|4962077_4962212_-	pyr operon leader peptide	NA	NA	NA	NA	NA
WP_000230277.1|4962492_4962888_-	RidA family protein	NA	NA	NA	NA	NA
WP_000500725.1|4963018_4963732_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000256670.1|4963802_4964396_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001353502.1|4964540_4964993_+	toxin-antitoxin biofilm protein TabA	NA	NA	NA	NA	NA
WP_000036525.1|4965115_4966090_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001309157.1|4966105_4966459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001309158.1|4966445_4966676_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000012907.1|4966776_4967781_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_000002953.1|4967942_4968359_+	ribonuclease E inhibitor RraB	NA	NA	NA	NA	NA
WP_001059422.1|4968404_4968908_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000079641.1|4969100_4970297_+	DUF898 domain-containing protein	NA	NA	NA	NA	NA
WP_000416382.1|4970352_4973208_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.3e-140
WP_000786399.1|4973207_4973651_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000397144.1|4973906_4975418_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
WP_000584114.1|4975684_4976785_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_001295681.1|4976784_4977867_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_001294573.1|4978027_4979530_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.2	4.6e-84
WP_001309159.1|4979607_4980606_-	DNA-binding transcriptional regulator IdnR	NA	NA	NA	NA	NA
WP_069383069.1|4980672_4981992_-	gnt-II system L-idonate transporter	NA	NA	NA	NA	NA
WP_000998695.1|4982053_4982818_-	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_001197411.1|4982841_4983873_-	L-idonate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000896738.1|4984089_4984653_+	gluconokinase	NA	NA	NA	NA	NA
WP_001309160.1|4984656_4985676_-	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.7	1.1e-44
WP_000050905.1|4990062_4990206_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000483767.1|4990233_4991580_-|transposase	IS4-like element IS4 family transposase	transposase	NA	NA	NA	NA
WP_000179691.1|4992188_4993406_+	MFS transporter	NA	NA	NA	NA	NA
WP_000611568.1|4993417_4994536_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_000594405.1|4994578_4994704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000254999.1|4994756_4995014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085948656.1|4995327_4996494_+|transposase	IS3-like element IS911 family transposase	transposase	Q716C2	Shigella_phage	99.3	1.8e-184
WP_000625671.1|4996429_4996843_-	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_001293436.1|4996905_4998903_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	25.9	7.4e-21
WP_001254932.1|4999959_5001111_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_000177057.1|5002369_5002627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000175457.1|5003183_5003951_-	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
WP_000684852.1|5003951_5004908_-	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	8.2e-18
WP_000125187.1|5004904_5005903_-	iron-dicitrate ABC transporter permease FecC	NA	NA	NA	NA	NA
WP_000879155.1|5005899_5006802_-	Fe(3+) dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
WP_000188283.1|5006846_5009171_-	Fe(3+) dicitrate transport protein FecA	NA	NA	NA	NA	NA
WP_001068910.1|5009257_5010211_-	fec operon regulator FecR	NA	NA	NA	NA	NA
WP_001283626.1|5010207_5010729_-	RNA polymerase sigma factor FecI	NA	NA	NA	NA	NA
WP_000555337.1|5012479_5012737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000823243.1|5013469_5014828_+	esterase-like activity of phytase family protein	NA	NA	NA	NA	NA
WP_000998017.1|5015066_5016452_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	89.5	6.9e-260
>prophage 1
NZ_CP015836	Escherichia coli strain MS6198 plasmid pMS6198B, complete sequence	136327	38555	80357	136327	integrase,transposase	Escherichia_phage(25.0%)	35	39724:39783	88164:89384
WP_061856962.1|38555_39773_-|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	2.0e-226
39724:39783	attL	TGACCTGCTCCCCGTTGATTAGTACACCCCGATGTTAGTAATGTCTTCATAAGCCACATG	NA	NA	NA	NA
WP_087758690.1|39794_40914_+|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
WP_039052454.1|41898_42675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039052447.1|42676_44941_+	UvrD-helicase domain-containing protein	NA	NA	NA	NA	NA
WP_039052448.1|45283_46264_+|transposase	IS5 family transposase	transposase	A0A077SK28	Escherichia_phage	97.2	2.9e-180
WP_039052449.1|47772_48165_-	plasmid partitioning/stability family protein	NA	NA	NA	NA	NA
WP_039052450.1|48169_49141_-	plasmid segregation protein parM	NA	A0A222YXF2	Escherichia_phage	42.6	9.7e-67
WP_000633913.1|49369_50014_+	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	43.0	1.9e-39
WP_000239529.1|50007_50283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157916581.1|50902_51142_-	resolvase	NA	NA	NA	NA	NA
WP_039052451.1|51248_51857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039052452.1|51926_52277_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000246635.1|52954_53950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000991831.1|53953_54886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001586223.1|55178_55364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024187432.1|55364_56267_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001586225.1|56268_57138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001586226.1|57194_58760_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_001586228.1|59046_59559_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000545985.1|59592_60726_-	DUF3800 domain-containing protein	NA	NA	NA	NA	NA
WP_001403958.1|61693_62179_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001586230.1|62569_65191_+	hypothetical protein	NA	A0A1B1IUG5	uncultured_Mediterranean_phage	23.7	5.9e-18
WP_001261274.1|65389_65620_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001403920.1|65708_65984_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_000348883.1|66206_66737_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001275013.1|66740_67010_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_123002471.1|67897_68887_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	63.7	2.5e-102
WP_001586233.1|69209_69950_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	56.9	5.4e-25
WP_042004909.1|70070_70253_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001440647.1|70319_70481_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_029702141.1|71160_71901_-|integrase	tyrosine-type recombinase/integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	1.6e-24
WP_029702172.1|72853_73303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000027057.1|76930_77791_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001235713.1|77973_78531_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_000608644.1|79094_80357_+|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
88164:89384	attR	TGACCTGCTCCCCGTTGATTAGTACACCCCGATGTTAGTAATGTCTTCATAAGCCACATGAGGACATCCCCATGAAGAAGCGTTTTTCCGACGAACAGATCATCAGTATTCTCCGCGAAGCCGAAGCTGGGGTACCCGCCCGTGAACTCTGCCGCAAGCATGCCATTTCCGATGCCACGTTTTACACCTGGCGTAAGAAGTATGGCGGTATGGAGGTGCCTGAAGTTAAGCGCCTGAAGTCGCTTGAGGAAGAGAACACCAGACTCAAGAAGCTGCTTGCCGAAGCCATGCTGGATAAAGAGGCGCTTCAGGTGGCTCTTGGGCGAAAGTACTGACGACAGACCAGAAGCGGGAAGCCGTGATGTTGATGTGTGATGCGACCGGTCTGTCGCAACGTCGTGCCTGCAGGCTTACAGGTTTATCCCTGTCGACCTGCCGCTATGAGGCTCACCGTCCGGCTGCTGATGCGCATTTATCAGGGCGCATCACTGAGCTGGCACTGGAGCGCAGGCGTTTTGGCTACCGTCGTATTTGGCAGTTGCTGCGCCGTGAAGGGCTTCATGTTAATCATAAGCGCGTGTACCGGCTTTATCACCTCAGTGGCCTGGGCGTAAAACGCAGAAGACGTCGTAAAGGGCTGGCAACAGAACGTCTGCCGCTGCTCCGTCCGGCGGCGCCCAATCTGACCTGGTCGATGGATTTCGTCATGGACGCACTTTCCACCGGTCGCAGGATCAAGTGTCTTACCTGCGTCGATGATTTCACAAAGGAATGCCTGACGGTCACTGTTGCCTTTGGGATTTCAGGCGTTCAGGTCACGCGTATTCTGGACAGCATTGCACTGTTTCGAGGCTATCCGGCGACGATAAGAACTGACCAGGGGCCGGAGTTCACTTGCCGTGCACTGGATCAATGGGCCTTTGAGCATGGTGTTGAGTTGCGCTTAATCCAGCCGGGCAAGCCAACGCAGAACGGATTTATTGAGAGCTTTAACGGACGATTTCGCGATGAATGTTTGAATGAGCACTGGTTCAGCGATATCGTTCATGCCAGGAAAATTATTAATGACTGGCGGCAGGATTATAACGAATGCCGCCCGCACTCCACGCTGAATTATCAGACACCGTCTGAATTTGCAGCGGGCTGGAGAAAGGGTCGTTCTGAGAATGAAGATTCCGACGTTACTAACTGAGTGTTGTATCTAATCGTGGGGGCAGGTCA	NA	NA	NA	NA
>prophage 1
NZ_CP015837	Escherichia coli strain MS6198 plasmid pMS6198C, complete sequence	98242	107	97452	98242	transposase,holin,tail,terminase,head,portal,integrase	Escherichia_phage(64.36%)	107	26450:26466	75926:75942
WP_000047923.1|107_1541_-	bleomycin hydrolase	NA	A0A1B0VAD6	Salmonella_phage	100.0	3.7e-272
WP_000002800.1|1537_1894_-	hypothetical protein	NA	Q71TP1	Escherichia_phage	100.0	1.0e-61
WP_033560574.1|1893_5619_-	transglycosylase SLT domain-containing protein	NA	A0A1B0VDM8	Salmonella_phage	85.8	0.0e+00
WP_000926342.1|5700_6582_-	hypothetical protein	NA	Q71TC9	Escherichia_phage	98.6	2.7e-172
WP_000523980.1|6596_7208_-	hypothetical protein	NA	Q71TN8	Escherichia_phage	99.5	2.9e-109
WP_023153778.1|7218_7785_-	hypothetical protein	NA	Q1MVL0	Enterobacteria_phage	99.5	1.1e-99
WP_032192786.1|8015_8909_+	DUF4760 domain-containing protein	NA	A0A1B5FPC5	Escherichia_phage	30.3	3.4e-26
WP_001057312.1|8960_9437_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000093548.1|9459_9810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001396852.1|10168_10288_+	ash family protein	NA	NA	NA	NA	NA
WP_071550046.1|10306_10528_+	host cell division inhibitor Icd-like protein	NA	Q38557	Escherichia_phage	80.3	9.3e-26
WP_033560573.1|10524_11616_+	phage antirepressor KilAC domain-containing protein	NA	A0A077SLR9	Escherichia_phage	79.8	7.1e-159
WP_001187875.1|11780_12581_+	phage antirepressor KilAC domain-containing protein	NA	Q1MVK4	Enterobacteria_phage	100.0	1.9e-148
WP_062914760.1|12610_13456_+	hypothetical protein	NA	Q1MVK3	Enterobacteria_phage	97.5	1.8e-149
WP_052761440.1|13720_14776_+	ParA family protein	NA	H2BD62	Pseudomonas_phage	70.8	9.0e-143
WP_001561122.1|14845_15133_-	DUF3892 domain-containing protein	NA	NA	NA	NA	NA
WP_061327236.1|15421_16018_-	hypothetical protein	NA	A0A1B0VBK8	Salmonella_phage	99.5	6.3e-109
WP_001615627.1|16189_16699_-	hypothetical protein	NA	A0A077SK14	Escherichia_phage	100.0	1.7e-91
WP_000035302.1|16710_17292_-	hypothetical protein	NA	A0A077SL48	Escherichia_phage	100.0	4.5e-104
WP_000041756.1|17327_18143_-	hypothetical protein	NA	A0A1B0V835	Salmonella_phage	99.6	1.2e-113
WP_000085137.1|18152_19742_-	hypothetical protein	NA	Q71TB2	Escherichia_phage	98.9	2.9e-302
WP_069383073.1|19802_21509_-	hypothetical protein	NA	Q1MVJ5	Enterobacteria_phage	94.2	1.8e-310
WP_000038866.1|21734_22736_-	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	100.0	1.7e-178
WP_001285362.1|22752_23949_-	AAA family ATPase	NA	A0A077SL49	Escherichia_phage	100.0	1.6e-225
WP_032247076.1|24117_24927_-	GIY-YIG nuclease family protein	NA	A0A077SK46	Escherichia_phage	98.1	3.2e-156
WP_001113742.1|25219_26104_-	RepB family plasmid replication initiator protein	NA	A0A077SLP3	Escherichia_phage	100.0	2.1e-161
WP_029401364.1|26439_26832_-	hypothetical protein	NA	Q1MVJ1	Enterobacteria_phage	98.5	2.0e-71
26450:26466	attL	CTTTCGATAAGAAGACC	NA	NA	NA	NA
WP_032333495.1|27009_27432_-	hypothetical protein	NA	Q71TL5	Escherichia_phage	90.7	1.2e-58
WP_069383074.1|27471_28260_-	hypothetical protein	NA	A0A077SK48	Escherichia_phage	95.0	3.0e-114
WP_001177862.1|28721_29006_+	hypothetical protein	NA	Q71TA2	Escherichia_phage	97.9	2.5e-47
WP_000472529.1|28998_29904_+	recombination-associated protein RdgC	NA	A0A077SK17	Escherichia_phage	99.7	1.6e-159
WP_000660970.1|29900_31919_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	Q1MVI4	Enterobacteria_phage	96.6	0.0e+00
WP_000751808.1|33893_34721_+	hypothetical protein	NA	A0A077SLJ6	Escherichia_phage	100.0	1.6e-131
WP_001276602.1|35110_36475_+	replicative DNA helicase	NA	O80281	Escherichia_phage	99.6	3.6e-253
WP_001569381.1|36474_36777_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069383075.1|36773_37748_+	hypothetical protein	NA	Q71TK3	Escherichia_phage	98.8	4.2e-187
WP_000535205.1|37794_38427_-	hypothetical protein	NA	A0A1B0V872	Salmonella_phage	100.0	6.9e-90
WP_000212027.1|38419_39436_-	hypothetical protein	NA	A0A077SLQ1	Escherichia_phage	99.1	6.6e-191
WP_015974270.1|39437_40223_-	hypothetical protein	NA	Q71T90	Escherichia_phage	100.0	9.4e-145
WP_000896796.1|40209_40938_-	hypothetical protein	NA	A0A077SK19	Escherichia_phage	99.6	2.7e-138
WP_001141908.1|40941_42159_-	hypothetical protein	NA	A0A077SL53	Escherichia_phage	100.0	1.1e-224
WP_000235786.1|42168_42546_-	hypothetical protein	NA	Q38620	Escherichia_phage	100.0	2.2e-67
WP_000840931.1|42692_42938_+	hypothetical protein	NA	Q71T86	Escherichia_phage	100.0	5.7e-40
WP_069383076.1|42940_43519_+	VRR-NUC domain-containing protein	NA	Q71T85	Escherichia_phage	92.2	3.4e-99
WP_000096174.1|43585_43741_+	hypothetical protein	NA	Q71TJ4	Escherichia_phage	100.0	7.0e-20
WP_000484110.1|44242_44869_+	norphogenetic protein	NA	Q71T82	Escherichia_phage	100.0	6.1e-123
WP_023352819.1|44865_45543_+	metallophosphoesterase	NA	Q71TJ1	Escherichia_phage	99.6	1.1e-133
WP_000684845.1|45539_46241_+	hypothetical protein	NA	Q1MVG6	Enterobacteria_phage	100.0	4.2e-144
WP_000107689.1|46542_47805_+	hypothetical protein	NA	A0A1B0V7L1	Salmonella_phage	100.0	5.4e-235
WP_069383077.1|47877_48384_+	3'-phosphatase	NA	A0A1B0VAK0	Salmonella_phage	98.8	1.2e-92
WP_000675639.1|48578_49307_+	hypothetical protein	NA	Q71T76	Escherichia_phage	99.1	4.9e-140
WP_072650063.1|49310_50189_+	phosphoadenosine phosphosulfate reductase family protein	NA	A0A2R2Z314	Escherichia_phage	95.5	1.3e-171
WP_000158002.1|50185_50389_+	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	94.0	1.5e-30
WP_023352820.1|50381_50621_+	hypothetical protein	NA	S5MQM0	Escherichia_phage	97.5	1.3e-36
WP_063816970.1|50617_51265_+	ead/Ea22-like family protein	NA	K7P881	Enterobacteria_phage	60.2	1.7e-54
WP_000797276.1|51437_51626_+	hypothetical protein	NA	A0A1I9LJM4	Stx_converting_phage	96.8	5.3e-30
WP_000951710.1|51627_51837_+	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	94.2	8.8e-34
WP_068880404.1|51833_53111_+	DUF551 domain-containing protein	NA	Q1MVF7	Enterobacteria_phage	59.1	4.1e-81
WP_000516537.1|53193_53427_+	hypothetical protein	NA	A0A1B0V7L5	Salmonella_phage	97.4	1.6e-36
WP_000269004.1|53605_53899_+	hypothetical protein	NA	A0A077SK23	Escherichia_phage	92.8	3.1e-45
WP_068880407.1|53905_54280_+	hypothetical protein	NA	A0A1B0VBU7	Salmonella_phage	96.0	5.4e-66
WP_000057451.1|54261_54912_+	hypothetical protein	NA	A0A077SK55	Escherichia_phage	96.7	4.9e-99
WP_001142394.1|54895_55180_+	hypothetical protein	NA	A0A222YXZ5	Escherichia_phage	100.0	2.4e-05
WP_001344848.1|55164_55374_-	hypothetical protein	NA	A0A222YY00	Escherichia_phage	98.6	1.1e-31
WP_001283837.1|55547_55799_+	DNA polymerase III subunit theta	NA	A0A077SLL5	Escherichia_phage	100.0	1.4e-38
WP_000506726.1|55922_56312_+	DNA repair protein	NA	Q1MVE7	Enterobacteria_phage	99.2	1.4e-69
WP_001190712.1|56384_56606_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
WP_001216047.1|56605_56986_+	type II toxin-antitoxin system death-on-curing family toxin	NA	Q71T66	Escherichia_phage	99.2	2.5e-63
WP_000113019.1|56990_57170_+	hypothetical protein	NA	Q71TH5	Escherichia_phage	98.3	2.7e-23
WP_000644102.1|57197_58241_+	DUF968 domain-containing protein	NA	A0A1B0VBU2	Salmonella_phage	99.4	3.0e-207
WP_001312282.1|58329_58782_+	late promoter-activating protein (Gp10)	NA	Q71T63	Escherichia_phage	99.3	6.7e-79
WP_032335092.1|58868_60062_+	hypothetical protein	NA	Q5QBP3	Enterobacteria_phage	96.7	7.4e-202
WP_000124150.1|60061_61546_+|terminase	terminase	terminase	Q71T61	Escherichia_phage	100.0	1.5e-292
WP_000611656.1|61570_62422_-	hypothetical protein	NA	A0A077SLM8	Escherichia_phage	99.6	6.1e-158
WP_000874154.1|62532_62742_-	hypothetical protein	NA	Q5XLQ8	Enterobacteria_phage	100.0	4.8e-32
WP_000542332.1|63346_63568_+	hypothetical protein	NA	A0A077SLI9	Escherichia_phage	100.0	3.4e-36
WP_000067530.1|63575_64607_+|integrase	tyrosine-type recombinase/integrase	integrase	Q71TG5	Escherichia_phage	100.0	9.9e-195
WP_001224236.1|64657_64969_+	hypothetical protein	NA	A0A077SK03	Escherichia_phage	99.0	2.3e-46
WP_000848375.1|65215_65776_+	Ref family protein	NA	A0A077SL37	Escherichia_phage	100.0	5.0e-100
WP_071961621.1|65965_66607_+	maturation control protein	NA	A0A077SK30	Escherichia_phage	98.6	5.3e-114
WP_023156640.1|66663_67971_+	SIR2 family protein	NA	NA	NA	NA	NA
WP_000747846.1|68017_68266_-	hypothetical protein	NA	Q71TG0	Escherichia_phage	100.0	1.8e-41
WP_000224043.1|68262_68703_-	hypothetical protein	NA	A0A077SLF0	Escherichia_phage	100.0	1.7e-79
WP_069383079.1|68736_75504_-	N-6 DNA methylase	NA	Q1MVN7	Enterobacteria_phage	98.8	0.0e+00
WP_069383080.1|75579_77301_+|portal	phage portal protein	portal	A0A077SL38	Escherichia_phage	99.5	0.0e+00
75926:75942	attR	CTTTCGATAAGAAGACC	NA	NA	NA	NA
WP_001312284.1|77333_78464_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q9G0F2	Phage_Gifsy-1	84.5	9.2e-186
WP_000132937.1|78576_79596_+|head	head processing protein	head	Q71TR6	Escherichia_phage	96.8	4.4e-179
WP_024187336.1|79640_79889_-	hypothetical protein	NA	Q71TF4	Escherichia_phage	100.0	1.0e-36
WP_001345478.1|79881_80439_-	lysozyme	NA	Q71TF3	Escherichia_phage	100.0	4.2e-107
WP_000068865.1|80608_81097_+	single-stranded DNA-binding protein	NA	A0A1B0VAF5	Salmonella_phage	100.0	5.0e-88
WP_001376650.1|81294_81972_+	DUF2829 domain-containing protein	NA	A0A1B0VBT1	Salmonella_phage	99.6	1.2e-127
WP_024946700.1|81978_82761_+	hypothetical protein	NA	A0A1B0VDP8	Salmonella_phage	99.6	7.1e-145
WP_001165936.1|82790_83099_-	hypothetical protein	NA	O21974	Escherichia_phage	97.1	5.4e-48
WP_033559806.1|83088_86076_-	hypothetical protein	NA	A0A1B0VFX4	Salmonella_phage	99.6	0.0e+00
WP_000175491.1|86088_86454_-	hypothetical protein	NA	A0A1B0V846	Salmonella_phage	98.3	9.3e-47
WP_032333432.1|86450_88370_-	phage protein DarA	NA	A0A1B0V7H1	Salmonella_phage	98.6	0.0e+00
WP_032333430.1|88371_88974_-	hypothetical protein	NA	Q1MVM6	Enterobacteria_phage	99.5	1.2e-99
WP_000580776.1|88960_89404_-	hypothetical protein	NA	A0A077SK09	Escherichia_phage	100.0	1.3e-82
WP_000887652.1|89400_89730_-|holin	holin	holin	Q37876	Escherichia_phage	100.0	1.3e-52
WP_000145199.1|89804_90068_-	hypothetical protein	NA	Q71TD9	Escherichia_phage	67.1	1.1e-22
WP_001165547.1|90503_91076_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	85.0	4.4e-83
WP_071961622.1|91633_92131_+|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	60.1	1.9e-50
WP_023156927.1|92141_92570_+|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	54.9	1.3e-39
WP_000503756.1|92580_93078_+|tail	tail fiber protein	tail	K7P7Q7	Enterobacteria_phage	59.1	9.1e-45
WP_000367942.1|93083_93695_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	78.6	3.6e-83
WP_071961623.1|93694_94153_-|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	57.4	1.4e-44
WP_001286325.1|97017_97452_-	hypothetical protein	NA	A0A077SLL3	Escherichia_phage	99.3	7.4e-75
