The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP014618	Pasteurella multocida strain Pm-3, complete genome	2415558	542	10643	2415558	transposase,integrase	Mannheimia_phage(12.5%)	10	1207:1220	12594:12607
WP_064775646.1|542_1031_+	DUF551 domain-containing protein	NA	A0A0M3LS47	Mannheimia_phage	51.2	3.2e-34
WP_015691048.1|1134_2043_+	hypothetical protein	NA	A0A0M4S6X1	Salmonella_phage	36.1	2.5e-40
1207:1220	attL	GATGATGGCACTCG	NA	NA	NA	NA
WP_064775645.1|2287_2509_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014391442.1|2519_3242_+	DNA-binding protein	NA	G0ZND1	Cronobacter_phage	52.5	3.3e-35
WP_075271365.1|3425_3728_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_014391441.1|3631_4687_+|integrase	site-specific integrase	integrase	A0A077KGX2	Edwardsiella_phage	37.9	1.6e-62
WP_005725034.1|5061_5916_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	40.3	5.8e-31
WP_014325726.1|6492_6957_-|transposase	IS200/IS605 family transposase	transposase	A0A0A8WIU6	Clostridium_phage	36.1	2.3e-13
WP_005719438.1|7139_7640_-	single-stranded DNA-binding protein	NA	I3PUY5	Vibrio_phage	55.6	4.0e-40
WP_014326374.1|7811_10643_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	57.3	0.0e+00
12594:12607	attR	CGAGTGCCATCATC	NA	NA	NA	NA
>prophage 2
NZ_CP014618	Pasteurella multocida strain Pm-3, complete genome	2415558	185777	192976	2415558	plate,tail	Burkholderia_phage(40.0%)	8	NA	NA
WP_064775698.1|185777_186344_-|tail	phage tail protein	tail	Q6QI98	Burkholderia_phage	46.4	5.3e-41
WP_064775699.1|186336_187449_-|plate	baseplate J/gp47 family protein	plate	A4JWL6	Burkholderia_virus	35.6	3.6e-57
WP_064775741.1|187438_187804_-|plate	phage baseplate protein	plate	NA	NA	NA	NA
WP_064775700.1|187856_188438_-|plate	phage baseplate assembly protein V	plate	NA	NA	NA	NA
WP_064775701.1|188452_189505_-	hypothetical protein	NA	A4JWL3	Burkholderia_virus	40.3	2.1e-59
WP_064775702.1|189504_189726_-	hypothetical protein	NA	Q6QIA3	Burkholderia_phage	43.3	8.5e-11
WP_064775703.1|189713_190664_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_064775704.1|190672_192976_-|tail	phage tail tape measure protein	tail	K4ICR4	Acidithiobacillus_phage	38.1	4.2e-68
>prophage 3
NZ_CP014618	Pasteurella multocida strain Pm-3, complete genome	2415558	203016	214776	2415558	transposase	Vibrio_phage(38.46%)	21	NA	NA
WP_064775743.1|203016_204489_-	hypothetical protein	NA	M1NVQ0	Vibrio_phage	62.1	6.0e-161
WP_064775717.1|204575_205157_-	DUF3486 family protein	NA	A0A2I7S9D1	Vibrio_phage	44.5	2.4e-36
WP_064775718.1|205179_205482_-	hypothetical protein	NA	A0A0C4UR00	Shigella_phage	60.4	2.2e-25
WP_064775719.1|205478_205808_-	DUF2730 family protein	NA	NA	NA	NA	NA
WP_064775721.1|205925_206186_-	DUF2681 domain-containing protein	NA	NA	NA	NA	NA
WP_064775722.1|206182_206410_-	DUF2644 domain-containing protein	NA	F6MIK0	Haemophilus_phage	72.4	6.0e-20
WP_064775723.1|206420_206957_-	N-acetylmuramoyl-L-alanine amidase	NA	F6MIJ9	Haemophilus_phage	69.1	1.1e-72
WP_064775724.1|207034_207397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064775725.1|207471_207846_-	transcriptional regulator	NA	Q6QIE8	Burkholderia_phage	46.2	3.3e-23
WP_064775726.1|207845_208391_-	hypothetical protein	NA	A0A0M3LPP6	Mannheimia_phage	44.1	1.8e-38
WP_064775727.1|208387_208894_-	regulatory protein GemA	NA	A0A0C4UQU3	Shigella_phage	32.7	5.0e-14
WP_064775728.1|208967_209669_-	DUF2786 domain-containing protein	NA	L7P7W8	Pseudomonas_phage	30.6	3.9e-17
WP_061406041.1|209677_209893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061406042.1|209910_210102_-	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_061406043.1|210179_210698_-	host-nuclease inhibitor protein Gam	NA	C9DGL8	Escherichia_phage	64.3	2.3e-54
WP_046339044.1|210690_210930_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064775729.1|211139_211385_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064775730.1|211405_211609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016533375.1|211608_212526_-	AAA family ATPase	NA	A0A2I7S9C3	Vibrio_phage	43.4	2.3e-62
WP_064775731.1|212552_214556_-|transposase	transposase	transposase	M4M9R2	Vibrio_phage	35.2	1.0e-94
WP_064775732.1|214539_214776_-	transcriptional regulator	NA	M1PVU4	Vibrio_phage	57.1	3.7e-12
>prophage 4
NZ_CP014618	Pasteurella multocida strain Pm-3, complete genome	2415558	988253	997611	2415558		Tupanvirus(33.33%)	9	NA	NA
WP_014326205.1|988253_989528_+	multifunctional CCA addition/repair protein	NA	A0A0F6YPT7	Sinorhizobium_phage	49.5	1.8e-92
WP_005753554.1|989568_990186_+	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_014326206.1|990185_991073_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_064775639.1|991142_992090_+	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	38.7	1.9e-43
WP_005753553.1|992165_993719_-	murein DD-endopeptidase MepM	NA	A0A2K9VGT1	Pontimonas_phage	49.6	8.4e-20
WP_010906540.1|993953_994745_+	zinc ABC transporter ATP-binding protein ZnuC	NA	A0A2K9L3Z8	Tupanvirus	32.8	3.7e-16
WP_005724066.1|994753_995539_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_005724065.1|995615_996596_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.4	1.3e-15
WP_014326208.1|996612_997611_-	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.4	2.3e-15
>prophage 5
NZ_CP014618	Pasteurella multocida strain Pm-3, complete genome	2415558	1167894	1264423	2415558	tRNA,head,tail,transposase,plate	Vibrio_phage(19.44%)	93	NA	NA
WP_016504277.1|1167894_1168395_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_005751070.1|1168611_1169352_-	pyruvate formate lyase 1-activating protein	NA	E5DI79	Enterobacter_phage	37.1	8.6e-07
WP_014326306.1|1169515_1171555_-	autotransporter domain-containing protein	NA	NA	NA	NA	NA
WP_005722327.1|1171728_1174053_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.7e-157
WP_005755854.1|1174138_1174990_-	formate transporter FocA	NA	NA	NA	NA	NA
WP_005727186.1|1175377_1175728_+	purine nucleoside phosphoramidase	NA	NA	NA	NA	NA
WP_005751066.1|1175727_1176078_+	YcfL family protein	NA	NA	NA	NA	NA
WP_081273992.1|1176771_1177245_-	ci repressor-like protein	NA	NA	NA	NA	NA
WP_064775732.1|1177484_1177721_+	transcriptional regulator	NA	M1PVU4	Vibrio_phage	57.1	3.7e-12
WP_064775731.1|1177704_1179708_+|transposase	transposase	transposase	M4M9R2	Vibrio_phage	35.2	1.0e-94
WP_016533375.1|1179734_1180652_+	AAA family ATPase	NA	A0A2I7S9C3	Vibrio_phage	43.4	2.3e-62
WP_064775730.1|1180651_1180855_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064775729.1|1180875_1181121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046339044.1|1181330_1181570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061406043.1|1181562_1182081_+	host-nuclease inhibitor protein Gam	NA	C9DGL8	Escherichia_phage	64.3	2.3e-54
WP_061406042.1|1182158_1182350_+	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_061406041.1|1182367_1182583_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064775728.1|1182591_1183293_+	DUF2786 domain-containing protein	NA	L7P7W8	Pseudomonas_phage	30.6	3.9e-17
WP_064775727.1|1183366_1183873_+	regulatory protein GemA	NA	A0A0C4UQU3	Shigella_phage	32.7	5.0e-14
WP_064775726.1|1183869_1184415_+	hypothetical protein	NA	A0A0M3LPP6	Mannheimia_phage	44.1	1.8e-38
WP_064775725.1|1184414_1184789_+	transcriptional regulator	NA	Q6QIE8	Burkholderia_phage	46.2	3.3e-23
WP_064775724.1|1184863_1185226_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064775723.1|1185303_1185840_+	N-acetylmuramoyl-L-alanine amidase	NA	F6MIJ9	Haemophilus_phage	69.1	1.1e-72
WP_064775722.1|1185850_1186078_+	DUF2644 domain-containing protein	NA	F6MIK0	Haemophilus_phage	72.4	6.0e-20
WP_064775721.1|1186074_1186335_+	DUF2681 domain-containing protein	NA	NA	NA	NA	NA
WP_064775719.1|1186452_1186782_+	DUF2730 family protein	NA	NA	NA	NA	NA
WP_064775718.1|1186778_1187081_+	hypothetical protein	NA	A0A0C4UR00	Shigella_phage	60.4	2.2e-25
WP_064775717.1|1187103_1187685_+	DUF3486 family protein	NA	A0A2I7S9D1	Vibrio_phage	44.5	2.4e-36
WP_064775743.1|1187771_1189244_+	hypothetical protein	NA	M1NVQ0	Vibrio_phage	62.1	6.0e-161
WP_151202333.1|1189239_1190682_+	DUF935 family protein	NA	Q6QIC0	Burkholderia_phage	53.5	2.6e-116
WP_064775742.1|1190683_1191949_+|head	phage head morphogenesis protein	head	J9STS2	Pseudomonas_phage	44.4	3.1e-65
WP_064775715.1|1192085_1192274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064775714.1|1192475_1192931_+	phage virion morphogenesis protein	NA	NA	NA	NA	NA
WP_064775713.1|1193167_1194271_+	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	41.8	3.3e-71
WP_064775712.1|1194280_1195207_+	hypothetical protein	NA	A4JWK0	Burkholderia_virus	49.3	1.7e-76
WP_064775711.1|1195259_1195718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064775710.1|1195717_1196167_+	DUF1320 domain-containing protein	NA	NA	NA	NA	NA
WP_064775709.1|1196166_1196634_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101766767.1|1196640_1198035_+|tail	phage tail protein	tail	A4JWK5	Burkholderia_virus	47.3	5.1e-109
WP_064775707.1|1198034_1198550_+|tail	phage major tail tube protein	tail	NA	NA	NA	NA
WP_064775706.1|1198632_1198911_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_075284997.1|1198937_1199060_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_064775705.1|1199056_1199248_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064775704.1|1199287_1201591_+|tail	phage tail tape measure protein	tail	K4ICR4	Acidithiobacillus_phage	38.1	4.2e-68
WP_064775703.1|1201599_1202550_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_064775702.1|1202537_1202759_+	hypothetical protein	NA	Q6QIA3	Burkholderia_phage	43.3	8.5e-11
WP_064775701.1|1202758_1203811_+	hypothetical protein	NA	A4JWL3	Burkholderia_virus	40.3	2.1e-59
WP_064775700.1|1203825_1204407_+|plate	phage baseplate assembly protein V	plate	NA	NA	NA	NA
WP_064775741.1|1204459_1204825_+|plate	phage baseplate protein	plate	NA	NA	NA	NA
WP_064775699.1|1204814_1205927_+|plate	baseplate J/gp47 family protein	plate	A4JWL6	Burkholderia_virus	35.6	3.6e-57
WP_064775698.1|1205919_1206486_+|tail	phage tail protein	tail	Q6QI98	Burkholderia_phage	46.4	5.3e-41
WP_016570130.1|1209017_1209197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016504384.1|1209902_1210886_-	type I-F CRISPR-associated protein Csy2	NA	NA	NA	NA	NA
WP_016504385.1|1210895_1212230_-	type I-F CRISPR-associated protein Csy1	NA	NA	NA	NA	NA
WP_014325843.1|1212460_1214620_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_014325842.1|1214753_1216802_-|tRNA	methionine--tRNA ligase	tRNA	H2EDI7	Moumouvirus	30.1	2.5e-48
WP_014325841.1|1216983_1218096_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_005721273.1|1218234_1218504_-	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_014325840.1|1218670_1221574_-	TonB-dependent hemoglobin/transferrin/lactoferrin family receptor	NA	NA	NA	NA	NA
WP_005751227.1|1221615_1222131_-	heme utilization protein HutZ	NA	NA	NA	NA	NA
WP_014325839.1|1222146_1222638_-	heme utilization cystosolic carrier protein HutX	NA	NA	NA	NA	NA
WP_005751354.1|1223702_1223966_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014325820.1|1229815_1230625_-	glutamate racemase	NA	NA	NA	NA	NA
WP_005757018.1|1230621_1231134_-	chorismate lyase	NA	NA	NA	NA	NA
WP_005751676.1|1231126_1233208_-	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_005722820.1|1233204_1235328_-	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A1B1IUF0	uncultured_Mediterranean_phage	38.9	2.6e-11
WP_005717016.1|1235388_1235658_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_014325819.1|1235724_1236351_-	guanylate kinase	NA	A0A223FN12	Murmansk_poxvirus	32.4	3.8e-16
WP_014325818.1|1236448_1236841_-	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_014325817.1|1237088_1238093_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_005717037.1|1238271_1238403_-	entericidin A/B family lipoprotein	NA	NA	NA	NA	NA
WP_014325816.1|1238655_1240476_+	long-chain fatty acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	25.7	2.5e-47
WP_014325815.1|1240540_1241629_-	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_014325814.1|1241775_1242537_-|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	32.2	2.0e-14
WP_016504673.1|1242536_1243634_-	murein transglycosylase A	NA	NA	NA	NA	NA
WP_014325812.1|1244102_1245476_-	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_005717048.1|1245621_1246623_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	44.5	1.9e-73
WP_005722854.1|1246758_1247250_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014325811.1|1247531_1248671_+	M20 family metallopeptidase	NA	NA	NA	NA	NA
WP_005754391.1|1248664_1250053_+	anaerobic C4-dicarboxylate transporter DcuC	NA	NA	NA	NA	NA
WP_016504367.1|1250137_1250953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005717062.1|1251084_1251765_+	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_016504366.1|1251778_1253041_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.3	4.9e-95
WP_064775618.1|1253175_1254528_+	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_014325808.1|1254707_1256006_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	36.5	1.1e-70
WP_005722865.1|1256195_1257602_+	c-type cytochrome	NA	NA	NA	NA	NA
WP_014325807.1|1257904_1260046_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	62.1	2.2e-257
WP_010906934.1|1260117_1260594_+	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	H6WXC9	Vibrio_phage	61.7	2.5e-52
WP_005722869.1|1260618_1260861_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005751698.1|1260899_1261691_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_014325805.1|1261797_1262349_-	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_005717092.1|1262397_1262907_-	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_014325804.1|1263043_1264423_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.6	2.5e-44
>prophage 6
NZ_CP014618	Pasteurella multocida strain Pm-3, complete genome	2415558	1404393	1511055	2415558	tRNA,tail,transposase,integrase,terminase	Mannheimia_phage(42.37%)	112	1463323:1463368	1509449:1509494
WP_014325726.1|1404393_1404858_-|transposase	IS200/IS605 family transposase	transposase	A0A0A8WIU6	Clostridium_phage	36.1	2.3e-13
WP_005717387.1|1405039_1405768_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	38.1	4.9e-31
WP_014325725.1|1405833_1406502_-	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
WP_014325724.1|1406511_1407054_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	45.7	4.8e-23
WP_014325723.1|1407116_1408427_-	porin	NA	NA	NA	NA	NA
WP_005723236.1|1408671_1408962_+	DUF406 family protein	NA	NA	NA	NA	NA
WP_064775613.1|1409009_1410671_-	putative transporter	NA	NA	NA	NA	NA
WP_005723242.1|1412760_1413315_+	DUF5358 domain-containing protein	NA	NA	NA	NA	NA
WP_010907004.1|1413532_1415188_+	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	34.9	7.4e-83
WP_014325722.1|1415277_1416357_-	endonuclease	NA	NA	NA	NA	NA
WP_014325721.1|1416837_1417392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005717426.1|1417699_1418488_+	hemin ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_014325720.1|1418500_1419445_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_005723258.1|1419456_1420194_+	ABC transporter ATP-binding protein	NA	M1HP82	Acanthocystis_turfacea_Chlorella_virus	32.5	1.5e-14
WP_016504262.1|1420339_1422769_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_064775610.1|1424207_1425344_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1B0VCD8	Salmonella_phage	58.0	3.8e-123
WP_005720092.1|1425390_1425807_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	63.5	3.3e-48
WP_014325717.1|1427095_1428334_+	DUF262 domain-containing protein	NA	A0A0R6PKN1	Moraxella_phage	25.6	1.0e-12
WP_014325716.1|1428347_1428920_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014325715.1|1429335_1433229_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	53.4	1.7e-114
WP_005723276.1|1433453_1433753_-	DNA-binding transcriptional regulator Fis	NA	NA	NA	NA	NA
WP_005723278.1|1433733_1434738_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_005717441.1|1435014_1435896_-	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_014325712.1|1436038_1437472_-	sodium/pantothenate symporter	NA	NA	NA	NA	NA
WP_005723282.1|1437461_1437713_-	YhdT family protein	NA	NA	NA	NA	NA
WP_005723284.1|1437795_1439142_-	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_005717446.1|1439243_1439705_-	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_005717447.1|1439859_1440306_-	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_005717448.1|1440376_1441390_-	o-succinylbenzoate synthase	NA	NA	NA	NA	NA
WP_005723289.1|1441642_1442500_-	1,4-dihydroxy-2-naphthoyl-CoA synthase	NA	NA	NA	NA	NA
WP_016504292.1|1442610_1443864_-	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_095177582.1|1444142_1445048_+|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_014325708.1|1445078_1445342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014325707.1|1445359_1445983_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_005751822.1|1446113_1446494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014325706.1|1446523_1448593_+|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_014325705.1|1448728_1450147_-	aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_005723307.1|1450475_1452047_+	AbgT family transporter	NA	NA	NA	NA	NA
WP_005717460.1|1452177_1452648_+	membrane protein FxsA	NA	NA	NA	NA	NA
WP_005717461.1|1452736_1453027_+	co-chaperone GroES	NA	A0A221S322	uncultured_virus	40.0	4.5e-12
WP_014325704.1|1453122_1454757_+	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.6	1.7e-188
WP_016504294.1|1455609_1456407_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_014325702.1|1456408_1457008_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	33.5	9.7e-17
WP_014325701.1|1457025_1457874_+	ModD protein	NA	NA	NA	NA	NA
WP_005754621.1|1457973_1459806_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.7	1.8e-53
WP_005723318.1|1459913_1460810_-	lipoprotein NlpI	NA	NA	NA	NA	NA
WP_005723319.1|1460893_1463038_-	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
1463323:1463368	attL	TGGTGGAGATAATCGGGATCGAACCGACGACCTCTTGCATGCCATG	NA	NA	NA	NA
WP_005720092.1|1463789_1464206_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	63.5	3.3e-48
WP_064775610.1|1464252_1465389_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1B0VCD8	Salmonella_phage	58.0	3.8e-123
WP_064775609.1|1465528_1465855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069359803.1|1465902_1470906_-	DUF1983 domain-containing protein	NA	A0A0M3LQ61	Mannheimia_phage	38.8	6.2e-250
WP_014667799.1|1470909_1471530_-|tail	tail assembly protein	tail	A0A0M3LQC4	Mannheimia_phage	57.4	1.1e-52
WP_064775607.1|1471472_1472216_-	C40 family peptidase	NA	A0A0M3LQI5	Mannheimia_phage	60.0	1.1e-83
WP_023430089.1|1472220_1472934_-|tail	phage minor tail protein L	tail	A0A0M3LPR8	Mannheimia_phage	63.9	2.1e-82
WP_014390756.1|1473023_1473353_-	Gifsy-1 prophage VmtM	NA	S5MW28	Escherichia_phage	37.1	3.2e-14
WP_042743193.1|1473355_1475800_-|tail	tail length tape measure protein	tail	A0A0M3LSE2	Mannheimia_phage	57.0	1.6e-150
WP_016533322.1|1475858_1476254_-	hypothetical protein	NA	A0A0M3LR23	Mannheimia_phage	83.2	7.7e-55
WP_016533321.1|1476321_1476786_-	hypothetical protein	NA	A0A0M3LR40	Mannheimia_phage	50.0	5.2e-34
WP_016533320.1|1476816_1477488_-	hypothetical protein	NA	A0A0M3LPR4	Mannheimia_phage	42.9	1.5e-42
WP_014390749.1|1477541_1478024_-|tail	phage tail protein	tail	A0A0M3LPR0	Mannheimia_phage	62.0	2.0e-44
WP_016533319.1|1478035_1478407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014390747.1|1478403_1478775_-	hypothetical protein	NA	F1C5E3	Cronobacter_phage	51.2	1.3e-24
WP_014390746.1|1478779_1479124_-	hypothetical protein	NA	A0A0M3LSC9	Mannheimia_phage	57.9	3.0e-31
WP_042743192.1|1479126_1479495_-	hypothetical protein	NA	A0A0M3LQS8	Mannheimia_phage	42.1	4.7e-22
WP_081317748.1|1479475_1479889_-	hypothetical protein	NA	A0A0M3LR32	Mannheimia_phage	73.9	4.5e-13
WP_016533288.1|1479899_1480898_-	hypothetical protein	NA	A0A0M3LQZ1	Mannheimia_phage	74.7	9.1e-145
WP_016533289.1|1480909_1481344_-	hypothetical protein	NA	A0A0M3LPQ2	Mannheimia_phage	75.7	1.1e-54
WP_016533290.1|1481343_1482690_-	hypothetical protein	NA	A0A0M3LQ78	Mannheimia_phage	55.3	4.0e-127
WP_014390740.1|1482704_1483676_-	hypothetical protein	NA	F1C5D8	Cronobacter_phage	41.0	1.6e-53
WP_016533291.1|1483629_1485075_-	DUF1073 domain-containing protein	NA	A0A0M3LPQ5	Mannheimia_phage	58.6	2.4e-146
WP_016533292.1|1485089_1486316_-|terminase	PBSX family phage terminase large subunit	terminase	A0A0M3LTA2	Mannheimia_phage	77.0	9.4e-192
WP_014390737.1|1486299_1486797_-|terminase	terminase	terminase	C7U0W1	Enterobacteria_phage	70.7	7.4e-47
WP_016533497.1|1486879_1487062_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0D4DC32	Acinetobacter_phage	54.2	3.8e-09
WP_014390736.1|1487090_1487525_+	CopG family transcriptional regulator	NA	A0A0R6PJ17	Moraxella_phage	38.0	1.0e-20
WP_064775606.1|1487559_1487841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014667795.1|1487746_1488070_-	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
WP_014667794.1|1488042_1488573_-	lysozyme	NA	A0A0M3LPQ1	Mannheimia_phage	50.9	9.7e-45
WP_014391475.1|1488569_1488830_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143930513.1|1489043_1489229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016533470.1|1489418_1489784_-	hypothetical protein	NA	A0A0M3LR87	Mannheimia_phage	27.3	3.5e-09
WP_064775605.1|1489783_1490386_-	recombinase NinG	NA	H6WRY9	Salmonella_phage	38.2	6.3e-32
WP_016533468.1|1490473_1490686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016569985.1|1490759_1491218_-	recombination protein NinB	NA	Q7Y5V7	Haemophilus_phage	53.4	5.8e-38
WP_041423202.1|1491207_1491738_-	phage N-6-adenine-methyltransferase	NA	A0A0M3LNW2	Mannheimia_phage	58.9	1.0e-54
WP_016533441.1|1491747_1492437_-	replication protein P	NA	D0UIL4	Aggregatibacter_phage	34.1	1.4e-32
WP_016533442.1|1492436_1493339_-	hypothetical protein	NA	A0A0U4JX08	Bacillus_phage	37.7	5.5e-32
WP_014390722.1|1493340_1493694_-	HNH endonuclease	NA	A0A1C9LVX4	Vibrio_phage	33.6	1.3e-08
WP_064775604.1|1493690_1494392_-	DNA-binding protein	NA	A0A2I7RHG4	Vibrio_phage	55.8	7.1e-35
WP_014391093.1|1494449_1494677_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005720263.1|1494745_1494955_-	helix-turn-helix transcriptional regulator	NA	A0A077K9X2	Edwardsiella_phage	52.3	5.5e-12
WP_064775603.1|1495082_1495772_+	helix-turn-helix transcriptional regulator	NA	Q7Y5W5	Haemophilus_phage	58.2	1.7e-73
WP_016533478.1|1495917_1496181_+	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_016533477.1|1496183_1496663_+	type II toxin-antitoxin system HicB family antitoxin	NA	K7PJX6	Enterobacterial_phage	47.1	8.3e-19
WP_016533476.1|1496659_1497043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016533507.1|1497661_1497892_+	hypothetical protein	NA	A0A0M3LNV4	Mannheimia_phage	52.8	3.4e-10
WP_014391456.1|1498116_1498380_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014391102.1|1498467_1499001_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016569990.1|1499462_1500098_+	antirepressor	NA	A6XMM0	Bacillus_virus	53.3	2.1e-22
WP_014390710.1|1500159_1500471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064775602.1|1500537_1500822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016570068.1|1500808_1501045_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016570067.1|1501222_1502209_+	hypothetical protein	NA	A0A0M3LR66	Mannheimia_phage	39.9	5.8e-51
WP_016533454.1|1502212_1503064_+	phage recombination protein Bet	NA	A0A2H4JAQ4	uncultured_Caudovirales_phage	63.9	4.8e-62
WP_064775601.1|1503056_1503668_+	YqaJ viral recombinase family protein	NA	A0A0M3LPU0	Mannheimia_phage	76.4	6.3e-88
WP_016533530.1|1504147_1504339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069359804.1|1505647_1506073_+	hypothetical protein	NA	A0A218KC93	Bacillus_phage	34.3	9.0e-17
WP_155762681.1|1506077_1506248_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016570062.1|1506382_1506916_+	DUF551 domain-containing protein	NA	A0A0M3LS47	Mannheimia_phage	36.6	1.3e-20
WP_016533427.1|1506925_1507225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051127937.1|1507523_1507796_+	hypothetical protein	NA	A0A0M3LQA6	Mannheimia_phage	41.1	4.9e-08
WP_064775600.1|1508171_1509344_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A059VF45	Pseudomonas_phage	52.9	5.9e-111
WP_014325699.1|1509612_1511055_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
1509449:1509494	attR	TGGTGGAGATAATCGGGATCGAACCGACGACCTCTTGCATGCCATG	NA	NA	NA	NA
>prophage 7
NZ_CP014618	Pasteurella multocida strain Pm-3, complete genome	2415558	2368142	2393912	2415558	terminase,head,tail,transposase	Mannheimia_phage(61.11%)	24	NA	NA
WP_005720092.1|2368142_2368559_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	63.5	3.3e-48
WP_064775610.1|2368605_2369742_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1B0VCD8	Salmonella_phage	58.0	3.8e-123
WP_064775609.1|2369881_2370208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081317749.1|2370255_2376150_-	DUF1983 domain-containing protein	NA	A0A0M3LQG1	Mannheimia_phage	36.1	1.6e-257
WP_042743292.1|2376153_2376744_-|tail	tail assembly protein	tail	A0A0M3LQC4	Mannheimia_phage	57.1	3.1e-52
WP_064775658.1|2376686_2377427_-	C40 family peptidase	NA	A0A0M3LQI5	Mannheimia_phage	60.0	1.3e-84
WP_064775657.1|2377429_2378134_-|tail	phage minor tail protein L	tail	A0A0M3LPR8	Mannheimia_phage	64.1	1.6e-82
WP_064775655.1|2380967_2381663_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016533102.1|2381967_2382297_-|tail	phage tail protein	tail	A0A0M3LQW6	Mannheimia_phage	49.1	4.8e-26
WP_016533103.1|2382666_2383083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016533104.1|2383155_2384172_-	hypothetical protein	NA	A0A0M3LQ19	Mannheimia_phage	69.9	7.6e-131
WP_015691079.1|2384184_2384577_-	hypothetical protein	NA	A0A0M3LQB6	Mannheimia_phage	46.2	5.5e-29
WP_015691078.1|2384576_2384978_-	HK97 gp10 family phage protein	NA	A0A0M3LPJ5	Mannheimia_phage	61.4	2.1e-39
WP_015691077.1|2384979_2385354_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015691076.1|2385355_2385823_-	hypothetical protein	NA	A0A0M3LSP7	Mannheimia_phage	55.7	1.4e-34
WP_015691075.1|2385839_2386076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015691074.1|2386132_2387290_-	hypothetical protein	NA	G8C7P7	Escherichia_phage	43.3	8.3e-81
WP_015691073.1|2387307_2388078_-	hypothetical protein	NA	A0A1V0DY60	Dinoroseobacter_phage	36.2	1.5e-25
WP_015691071.1|2388413_2388848_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	D0UIJ3	Aggregatibacter_phage	61.2	3.1e-41
WP_015691070.1|2388822_2389041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064775738.1|2389043_2390645_-|head	phage head morphogenesis protein	head	A0A0M3LQ07	Mannheimia_phage	52.1	3.3e-152
WP_064775653.1|2390634_2392038_-	DUF4055 domain-containing protein	NA	A0A0M3LQA1	Mannheimia_phage	59.6	4.4e-153
WP_064775652.1|2392047_2393319_-|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	61.7	8.6e-148
WP_081273988.1|2393321_2393912_-	hypothetical protein	NA	A0A2H4J1J5	uncultured_Caudovirales_phage	39.5	4.9e-21
>prophage 8
NZ_CP014618	Pasteurella multocida strain Pm-3, complete genome	2415558	2397195	2409384	2415558	holin	Haemophilus_phage(21.43%)	22	NA	NA
WP_016533462.1|2397195_2397780_-	glycoside hydrolase family 19 protein	NA	Q7Y5V0	Haemophilus_phage	55.3	6.5e-58
WP_016533461.1|2397751_2398117_-|holin	phage holin, lambda family	holin	NA	NA	NA	NA
WP_143930513.1|2398330_2398516_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016533470.1|2398705_2399071_-	hypothetical protein	NA	A0A0M3LR87	Mannheimia_phage	27.3	3.5e-09
WP_064775605.1|2399070_2399673_-	recombinase NinG	NA	H6WRY9	Salmonella_phage	38.2	6.3e-32
WP_016533468.1|2399760_2399973_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016569985.1|2400046_2400505_-	recombination protein NinB	NA	Q7Y5V7	Haemophilus_phage	53.4	5.8e-38
WP_041423202.1|2400494_2401025_-	phage N-6-adenine-methyltransferase	NA	A0A0M3LNW2	Mannheimia_phage	58.9	1.0e-54
WP_016533441.1|2401034_2401724_-	replication protein P	NA	D0UIL4	Aggregatibacter_phage	34.1	1.4e-32
WP_016533442.1|2401723_2402626_-	hypothetical protein	NA	A0A0U4JX08	Bacillus_phage	37.7	5.5e-32
WP_014390722.1|2402627_2402981_-	HNH endonuclease	NA	A0A1C9LVX4	Vibrio_phage	33.6	1.3e-08
WP_064775604.1|2402977_2403679_-	DNA-binding protein	NA	A0A2I7RHG4	Vibrio_phage	55.8	7.1e-35
WP_014391093.1|2403736_2403964_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005720263.1|2404032_2404242_-	helix-turn-helix transcriptional regulator	NA	A0A077K9X2	Edwardsiella_phage	52.3	5.5e-12
WP_064775603.1|2404369_2405059_+	helix-turn-helix transcriptional regulator	NA	Q7Y5W5	Haemophilus_phage	58.2	1.7e-73
WP_016533478.1|2405204_2405468_+	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_016533477.1|2405470_2405950_+	type II toxin-antitoxin system HicB family antitoxin	NA	K7PJX6	Enterobacterial_phage	47.1	8.3e-19
WP_016533476.1|2405946_2406330_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016533507.1|2406948_2407179_+	hypothetical protein	NA	A0A0M3LNV4	Mannheimia_phage	52.8	3.4e-10
WP_014391456.1|2407403_2407667_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014391102.1|2407754_2408288_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016569990.1|2408748_2409384_+	antirepressor	NA	A6XMM0	Bacillus_virus	53.3	2.1e-22
