The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP012579	Pseudomonas aeruginosa strain PA_D5, complete genome	6681992	633731	686396	6681992	tail,tRNA,holin,plate	uncultured_Caudovirales_phage(28.0%)	55	NA	NA
WP_003109020.1|633731_634757_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.1	3.7e-109
WP_003085061.1|634835_635405_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_003099587.1|635488_635842_+	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_023126993.1|635832_636375_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_003099584.1|636347_637580_-	multifunctional CCA addition/repair protein	NA	A0A076G5T8	Escherichia_phage	43.1	2.6e-77
WP_003085071.1|637623_638130_-	DUF4136 domain-containing protein	NA	NA	NA	NA	NA
WP_003085073.1|638224_639778_-	SpoVR family protein	NA	NA	NA	NA	NA
WP_003085075.1|639774_641046_-	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	37.2	4.2e-09
WP_003085078.1|641146_643069_-	PrkA family serine protein kinase	NA	NA	NA	NA	NA
WP_003099577.1|643347_643680_-	thiosulfate sulfurtransferase GlpE	NA	NA	NA	NA	NA
WP_003113213.1|643723_644575_-	symmetrical bis(5'-nucleosyl)-tetraphosphatase	NA	A0A2H4J0P0	uncultured_Caudovirales_phage	33.3	1.1e-08
WP_058165012.1|644574_644955_-	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
WP_003085087.1|644991_645798_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_003123920.1|645913_646900_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_003109024.1|646896_648189_-	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_003085092.1|648169_650971_-	LPS-assembly protein LptD	NA	NA	NA	NA	NA
WP_003137370.1|651097_652114_+	phosphotransferase	NA	NA	NA	NA	NA
WP_003085095.1|652110_652785_+	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_003085097.1|652786_653545_+	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_034075333.1|653545_654607_-	DUF3530 family protein	NA	NA	NA	NA	NA
WP_003129201.1|654758_657152_+	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_003085103.1|657197_657830_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_003085106.1|657958_658993_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_003085109.1|659226_660336_+	polyamine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.4	7.8e-28
WP_003109043.1|660391_661438_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_014604087.1|661552_662800_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003085119.1|662905_663736_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003085122.1|663859_664534_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_003099532.1|664533_665352_+	phosphoglycolate phosphatase	NA	NA	NA	NA	NA
WP_003085126.1|665424_666903_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_003085128.1|667088_667403_-	transcription regulatory protein PrtN	NA	NA	NA	NA	NA
WP_031686362.1|667502_668273_-	helix-turn-helix transcriptional regulator	NA	A0A1B0Z078	Pseudomonas_phage	58.6	1.0e-71
WP_003085132.1|668730_668931_+	repressor PtrB	NA	W6ATC1	Enterobacter_phage	58.3	3.7e-05
WP_003085135.1|668978_669338_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077563386.1|669700_670150_+|holin	holin	holin	B5TK61	Pseudomonas_phage	53.3	5.0e-26
WP_015502278.1|670171_670687_+	hypothetical protein	NA	A0A2H4J881	uncultured_Caudovirales_phage	43.4	1.1e-32
WP_003085141.1|670683_671241_+|plate	phage baseplate assembly protein V	plate	A0A2H4JG06	uncultured_Caudovirales_phage	71.1	4.6e-45
WP_003113199.1|671393_671720_+	bacteriophage protein	NA	A0A2H4JA09	uncultured_Caudovirales_phage	60.2	2.4e-30
WP_031686363.1|671716_672604_+|plate	baseplate assembly protein	plate	S4TNY7	Salmonella_phage	59.8	4.1e-88
WP_003137385.1|672596_673130_+|tail	phage tail protein I	tail	Q9ZXK7	Pseudomonas_virus	64.6	5.2e-62
WP_015502281.1|673131_675240_+|tail	tail fiber	tail	Q9ZXK6	Pseudomonas_virus	52.3	6.5e-225
WP_003085172.1|675248_675689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003109051.1|675731_676892_+|tail	phage tail sheath family protein	tail	Q38068	Phage_PS17	83.4	2.7e-188
WP_003129212.1|676904_677408_+|tail	phage major tail tube protein	tail	Q7M2A5	Pseudomonas_phage	73.5	6.1e-65
WP_003085178.1|677422_677767_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_031686365.1|677936_680174_+|tail	phage tail length tape measure protein	tail	NA	NA	NA	NA
WP_003085182.1|680183_681056_+|tail	phage tail protein	tail	A0A2H4J875	uncultured_Caudovirales_phage	51.7	3.9e-75
WP_003101635.1|681030_681237_+	hypothetical protein	NA	A0A2H4J9Z9	uncultured_Caudovirales_phage	64.2	2.3e-18
WP_031686366.1|681294_682284_+	phage late control D family protein	NA	A0A2H4JBF6	uncultured_Caudovirales_phage	55.8	2.2e-106
WP_031686367.1|682316_682946_+	glycoside hydrolase family 19 protein	NA	A0A125RNP1	Pseudomonas_phage	78.0	2.1e-86
WP_003117967.1|682942_683305_+	hypothetical protein	NA	H2BDA0	Pseudomonas_phage	47.9	4.2e-15
WP_003118919.1|683301_683559_+	hypothetical protein	NA	A0A125RNP3	Pseudomonas_phage	64.6	8.3e-18
WP_023092374.1|683906_684512_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	65.8	4.6e-75
WP_003085203.1|684513_685563_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	57.8	1.8e-111
WP_003085205.1|685559_686396_+	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	56.9	2.1e-70
>prophage 2
NZ_CP012579	Pseudomonas aeruginosa strain PA_D5, complete genome	6681992	1196586	1234031	6681992	integrase,protease,tRNA,portal,terminase,transposase,holin	uncultured_Caudovirales_phage(38.1%)	42	1206650:1206667	1231193:1231210
WP_009313444.1|1196586_1199439_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	37.0	1.3e-148
WP_003112023.1|1199559_1199928_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003100593.1|1199939_1200368_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_004351504.1|1200364_1201852_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	36.1	1.0e-51
WP_033994554.1|1202188_1203001_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003137845.1|1203084_1204008_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003092864.1|1204199_1205318_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_003092863.1|1205310_1206378_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_003092862.1|1206509_1207007_-	RDD family protein	NA	NA	NA	NA	NA
1206650:1206667	attL	AGCGCAGCAGCGCCTGGA	NA	NA	NA	NA
WP_003162594.1|1207136_1208717_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_079282768.1|1209213_1210215_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0A0YR56	Pseudomonas_phage	94.8	4.7e-149
WP_121379776.1|1210226_1210595_+	outer membrane protein assembly factor BamE	NA	J7HXI2	Pseudomonas_phage	88.2	1.4e-47
WP_025325127.1|1210783_1211497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033980357.1|1211499_1212021_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_025325125.1|1212068_1212368_-	hypothetical protein	NA	A0A0A0YRS6	Pseudomonas_phage	91.0	7.6e-47
WP_033980358.1|1212621_1214685_-	DNA methyltransferase	NA	Q5QF27	Pseudomonas_virus	98.0	0.0e+00
WP_058010781.1|1214681_1215227_-	hypothetical protein	NA	A0A2D1GNL9	Pseudomonas_phage	48.3	6.3e-31
WP_069376557.1|1215235_1215970_-	hypothetical protein	NA	NA	NA	NA	NA
WP_028680747.1|1216036_1216846_-	YfdQ family protein	NA	A0A2R2Z323	Escherichia_phage	42.0	6.9e-50
WP_031632202.1|1216891_1217239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019726652.1|1217456_1217693_-	hypothetical protein	NA	A0A2H4J8B4	uncultured_Caudovirales_phage	40.3	6.1e-07
WP_069376558.1|1217689_1218058_-	hypothetical protein	NA	NA	NA	NA	NA
WP_028680744.1|1218054_1218339_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069376559.1|1218350_1218920_-	deoxynucleotide monophosphate kinase	NA	A0A2H4J8A1	uncultured_Caudovirales_phage	49.5	8.0e-45
WP_028680742.1|1218916_1219225_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078451259.1|1219518_1220076_-	helix-turn-helix transcriptional regulator	NA	A0A1W6JNY2	Morganella_phage	44.0	2.9e-23
WP_028680740.1|1220307_1220538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154052173.1|1220564_1220714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154052175.1|1220763_1221925_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	52.9	1.0e-83
WP_019726644.1|1221967_1222171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033980361.1|1222377_1222878_+	hypothetical protein	NA	A0A2H4JFM0	uncultured_Caudovirales_phage	61.0	8.0e-33
WP_019726642.1|1222870_1223113_+	repressor, PtrB	NA	Q9ZXI6	Pseudomonas_virus	53.0	2.7e-10
WP_033980362.1|1223109_1225848_+	DNA primase	NA	A0A2H4JF22	uncultured_Caudovirales_phage	64.0	0.0e+00
WP_124182786.1|1226187_1226745_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004353017.1|1226943_1227309_+	hypothetical protein	NA	E5E3W4	Burkholderia_phage	48.2	1.0e-13
WP_025325111.1|1227313_1227592_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_069376561.1|1227594_1228332_+	hypothetical protein	NA	A0A1B0Z000	Pseudomonas_phage	47.1	8.8e-44
WP_069376562.1|1228585_1229161_+|terminase	terminase small subunit	terminase	A0A2H4JG15	uncultured_Caudovirales_phage	55.2	8.1e-45
WP_034066184.1|1229163_1231173_+|terminase	phage terminase large subunit family protein	terminase	A0A2H4J898	uncultured_Caudovirales_phage	68.1	3.3e-271
WP_004353026.1|1231184_1231409_+	hypothetical protein	NA	NA	NA	NA	NA
1231193:1231210	attR	AGCGCAGCAGCGCCTGGA	NA	NA	NA	NA
WP_069376563.1|1231408_1232875_+|portal	phage portal protein	portal	A0A2H4JFL5	uncultured_Caudovirales_phage	65.8	6.6e-176
WP_069376564.1|1232858_1234031_+|protease	Clp protease ClpP	protease	A0A2H4JDI2	uncultured_Caudovirales_phage	49.9	1.6e-87
>prophage 3
NZ_CP012579	Pseudomonas aeruginosa strain PA_D5, complete genome	6681992	1242107	1258400	6681992	tRNA	Pseudomonas_phage(30.0%)	15	NA	NA
WP_069376568.1|1242107_1245659_+	hypothetical protein	NA	A0A0M4U447	Ralstonia_phage	35.2	1.8e-179
WP_023087707.1|1245658_1246666_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069377023.1|1246653_1247523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069376569.1|1247519_1249280_+	hypothetical protein	NA	A0A2I7S8R8	Vibrio_phage	24.1	9.8e-25
WP_019682828.1|1249279_1249516_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069376570.1|1249761_1250391_+	glycoside hydrolase family 19 protein	NA	J7I4M6	Pseudomonas_phage	83.7	6.4e-96
WP_069376571.1|1250387_1250756_+	hypothetical protein	NA	A0A0S2SY58	Pseudomonas_phage	62.3	8.0e-30
WP_034068839.1|1250752_1251013_+	hypothetical protein	NA	B5WZU5	Pseudomonas_phage	76.7	1.1e-28
WP_034065785.1|1251157_1251961_+	DNA adenine methylase	NA	C7BGE1	Burkholderia_phage	65.0	1.4e-100
WP_034068840.1|1252277_1252961_-	DUF159 family protein	NA	Q5QF62	Pseudomonas_virus	71.2	4.5e-95
WP_034065780.1|1253050_1253482_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A2H4J538	uncultured_Caudovirales_phage	43.9	1.8e-20
WP_034068843.1|1253474_1254743_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	51.9	6.6e-116
WP_044059572.1|1255289_1255847_+	DUF4760 domain-containing protein	NA	NA	NA	NA	NA
WP_003113798.1|1256225_1257269_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_003100607.1|1257281_1258400_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	49.9	6.7e-96
>prophage 4
NZ_CP012579	Pseudomonas aeruginosa strain PA_D5, complete genome	6681992	1463739	1566780	6681992	tail,head,capsid,plate,tRNA,portal,terminase	uncultured_Caudovirales_phage(26.09%)	110	NA	NA
WP_003098572.1|1463739_1465068_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	M1IB95	Acanthocystis_turfacea_Chlorella_virus	24.1	5.9e-06
WP_003092366.1|1465238_1466867_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	53.1	4.0e-158
WP_003092365.1|1466869_1467715_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	40.3	1.4e-48
WP_003092364.1|1467760_1469050_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	61.5	2.5e-139
WP_003098569.1|1469114_1469399_+	cell division protein FtsB	NA	NA	NA	NA	NA
WP_003092359.1|1469418_1470123_+	2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_033938381.1|1470183_1470432_-	sulfurtransferase-like selenium metabolism protein YedF	NA	NA	NA	NA	NA
WP_069376587.1|1470397_1471624_-	selenium metabolism membrane protein YedE/FdhT	NA	NA	NA	NA	NA
WP_003092354.1|1471699_1472608_-	glutathione-dependent formaldehyde neutralization regulator	NA	NA	NA	NA	NA
WP_003092351.1|1472739_1473852_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.1	1.3e-35
WP_069376588.1|1473905_1474757_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_003092346.1|1474827_1475301_+	2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase	NA	NA	NA	NA	NA
WP_069376589.1|1475297_1476365_+|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
WP_003092341.1|1476352_1477102_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	53.0	6.8e-68
WP_003098558.1|1477134_1477770_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	52.3	1.0e-40
WP_069376590.1|1477815_1478709_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A0S2SXL7	Bacillus_phage	34.3	3.0e-06
WP_003113871.1|1478813_1479818_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.3	7.0e-36
WP_003092272.1|1480244_1480568_-	ferredoxin family protein	NA	NA	NA	NA	NA
WP_079858790.1|1480634_1483202_-	DNA mismatch repair protein MutS	NA	A0A1V0SGG8	Hokovirus	22.1	2.4e-24
WP_124074654.1|1483538_1484522_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_052150740.1|1484596_1484908_+	STAS-like domain-containing protein	NA	NA	NA	NA	NA
WP_015649074.1|1484951_1486211_-	DUF3596 domain-containing protein	NA	A0A1I9KF78	Aeromonas_phage	38.8	1.9e-67
WP_015649073.1|1486177_1486390_-	putative phage excisionase	NA	NA	NA	NA	NA
WP_034011743.1|1486944_1488780_-	DNA cytosine methyltransferase	NA	A0A1I9KFW0	Aeromonas_phage	38.0	1.4e-95
WP_034011745.1|1488776_1489256_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015649068.1|1489265_1489505_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034011746.1|1489501_1490128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031639816.1|1490178_1490496_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_031673600.1|1490492_1490801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014603908.1|1490954_1491248_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_023087724.1|1491257_1491569_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034011748.1|1491851_1492565_-	helix-turn-helix domain-containing protein	NA	F1C599	Cronobacter_phage	35.8	2.4e-22
WP_019726484.1|1492671_1492926_+	hypothetical protein	NA	A0A2H4JA29	uncultured_Caudovirales_phage	45.6	1.5e-06
WP_023087721.1|1493242_1493797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003130865.1|1493789_1493999_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034011750.1|1493995_1496209_+	toprim domain-containing protein	NA	A0A2D1GN57	Marinobacter_phage	47.0	1.7e-188
WP_019396873.1|1496205_1496577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014603903.1|1497148_1497511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023127296.1|1497625_1498150_+	hypothetical protein	NA	A0A2D1GMW4	Marinobacter_phage	37.2	1.5e-18
WP_052168560.1|1498193_1500080_+|terminase	phage terminase large subunit family protein	terminase	A0A2D1GMT1	Marinobacter_phage	50.0	4.5e-161
WP_014603900.1|1500092_1500308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031652606.1|1500310_1501924_+|portal	phage portal protein	portal	A0A067ZJA4	Vibrio_phage	39.6	5.5e-91
WP_033964211.1|1501926_1503147_+	S49 family peptidase	NA	A0A219YAK4	Aeromonas_phage	34.7	5.3e-46
WP_014603897.1|1503160_1503511_+|head	head decoration protein	head	A0A291AUM0	Sinorhizobium_phage	42.2	2.5e-12
WP_014603896.1|1503526_1504564_+|capsid	major capsid protein	capsid	A0A0C5ABI0	Bacteriophage	40.5	1.7e-69
WP_014603895.1|1504565_1504751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015649052.1|1504753_1505068_+	hypothetical protein	NA	A0A2H4J879	uncultured_Caudovirales_phage	45.8	2.1e-18
WP_014603894.1|1505067_1505736_+	hypothetical protein	NA	A0A2H4JBV1	uncultured_Caudovirales_phage	59.3	3.7e-65
WP_033964215.1|1505728_1506265_+	hypothetical protein	NA	A0A2H4J881	uncultured_Caudovirales_phage	44.5	7.8e-34
WP_034011753.1|1506261_1506819_+|plate	phage baseplate assembly protein V	plate	A0A2H4JG06	uncultured_Caudovirales_phage	66.5	7.5e-48
WP_069376591.1|1506876_1507098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014603890.1|1507107_1507434_+	hypothetical protein	NA	A0A2H4JA09	uncultured_Caudovirales_phage	65.7	2.3e-33
WP_033964218.1|1507430_1508315_+|plate	baseplate assembly protein	plate	A0A2H4JFK9	uncultured_Caudovirales_phage	73.3	1.6e-113
WP_033964219.1|1508311_1508842_+|tail	phage tail protein I	tail	A0A2H4JDH5	uncultured_Caudovirales_phage	57.5	1.2e-50
WP_033964221.1|1508838_1510920_+|tail	tail fiber	tail	Q9ZXK6	Pseudomonas_virus	50.3	1.2e-111
WP_079384501.1|1511198_1511381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023107128.1|1511424_1512585_+|tail	phage tail sheath family protein	tail	Q38068	Phage_PS17	98.2	2.3e-216
WP_033964226.1|1512597_1513107_+|tail	phage major tail tube protein	tail	Q7M2A5	Pseudomonas_phage	98.2	3.4e-87
WP_014603883.1|1513116_1513413_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_034012938.1|1513551_1516242_+|tail	tail protein	tail	A0A2H4JG00	uncultured_Caudovirales_phage	28.7	1.3e-41
WP_014603880.1|1516250_1517090_+|tail	phage tail protein	tail	A0A2H4J875	uncultured_Caudovirales_phage	54.3	6.0e-81
WP_015649042.1|1517064_1517271_+|tail	tail protein X	tail	A0A2H4J9Z9	uncultured_Caudovirales_phage	62.7	9.6e-17
WP_034012936.1|1517284_1518337_+	phage late control protein	NA	A0A2H4JBF6	uncultured_Caudovirales_phage	70.3	2.0e-134
WP_014603877.1|1518374_1518560_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034012935.1|1518671_1519301_+	glycoside hydrolase family 19 protein	NA	A0A125RNP1	Pseudomonas_phage	72.7	4.2e-79
WP_079392378.1|1519297_1519666_+	hypothetical protein	NA	H2BDD6	Pseudomonas_virus	80.3	4.1e-42
WP_060853382.1|1519662_1519923_+	hypothetical protein	NA	B5WZU5	Pseudomonas_phage	72.1	1.2e-27
WP_060853383.1|1520067_1520871_+	DNA adenine methylase	NA	C7BGE1	Burkholderia_phage	63.9	1.1e-100
WP_034011836.1|1521128_1522934_+	N-6 DNA methylase	NA	NA	NA	NA	NA
WP_034011833.1|1522933_1524010_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_003098486.1|1524451_1525459_-	TolB family protein	NA	NA	NA	NA	NA
WP_003129950.1|1525606_1526113_+	CinA family protein	NA	B5TK85	Pseudomonas_phage	76.0	1.8e-56
WP_003092260.1|1526246_1527287_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	59.5	1.5e-113
WP_003098485.1|1527292_1527754_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_003092255.1|1527775_1528846_-	LOG family protein	NA	NA	NA	NA	NA
WP_003129952.1|1528928_1530332_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_003092251.1|1530511_1532917_+	D-xylulose 5-phosphate/D-fructose 6-phosphate phosphoketolase	NA	NA	NA	NA	NA
WP_069376592.1|1533040_1533262_-	DUF3820 family protein	NA	NA	NA	NA	NA
WP_003109703.1|1533280_1533691_-	quorum-sensing-regulated virulence factor family protein	NA	NA	NA	NA	NA
WP_003129956.1|1533865_1534930_-	spermidine/putrescine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003092244.1|1535018_1535789_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003092241.1|1535781_1536675_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003119359.1|1536679_1537771_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.6	1.3e-30
WP_023111461.1|1538029_1538746_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_003119360.1|1538749_1539676_-	DMT family transporter	NA	NA	NA	NA	NA
WP_003092229.1|1539808_1540462_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_003092226.1|1540533_1540905_+	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_003092223.1|1540974_1542585_-	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_003092213.1|1542828_1543092_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_003092209.1|1543091_1543244_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_003092207.1|1543271_1544057_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_069376593.1|1544184_1545000_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_003138044.1|1545199_1546522_+	APC family permease	NA	NA	NA	NA	NA
WP_069376594.1|1546611_1547685_+	bifunctional transcriptional activator/DNA repair protein Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	45.6	3.9e-16
WP_003109708.1|1547681_1549091_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_069376595.1|1549309_1550197_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_069376596.1|1550310_1552038_+	DNA alkylation response protein	NA	NA	NA	NA	NA
WP_023099305.1|1552076_1553264_+	CoA transferase	NA	NA	NA	NA	NA
WP_021265152.1|1553323_1554121_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_069376597.1|1554117_1555650_+	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_069376598.1|1555672_1556878_+	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_003138051.1|1556930_1558181_+	OprD family porin	NA	NA	NA	NA	NA
WP_003109716.1|1558186_1559107_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003098462.1|1559405_1560392_+	alpha/beta hydrolase	NA	A0A249XTE1	Mycobacterium_phage	29.3	3.0e-07
WP_003119370.1|1560408_1560738_-	GlpM family protein	NA	NA	NA	NA	NA
WP_003098460.1|1560870_1562409_-	glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_069376599.1|1562687_1563443_-	DeoR/GlpR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.7	1.2e-24
WP_003092168.1|1563648_1565166_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_003092166.1|1565205_1566045_-	aquaporin	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	30.4	5.2e-16
WP_003092163.1|1566309_1566780_+|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
>prophage 5
NZ_CP012579	Pseudomonas aeruginosa strain PA_D5, complete genome	6681992	2424705	2457768	6681992	tail,integrase,tRNA,terminase,transposase,holin	Pseudomonas_phage(64.52%)	45	2425023:2425038	2437843:2437858
WP_016562059.1|2424705_2425686_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
2425023:2425038	attL	GCAGATGCTCGCGGCA	NA	NA	NA	NA
WP_034008354.1|2425868_2426984_+|integrase	site-specific integrase	integrase	A0A2K8I325	Pseudomonas_phage	60.0	6.2e-118
WP_003130859.1|2426957_2427233_-	hypothetical protein	NA	A0A2K8HN48	Pseudomonas_phage	65.5	3.4e-25
WP_003130860.1|2427336_2427549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003130861.1|2427545_2429426_-	DNA cytosine methyltransferase	NA	Q5QF27	Pseudomonas_virus	43.2	1.2e-132
WP_023094641.1|2429422_2429902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003130862.1|2429911_2430151_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003126620.1|2430147_2430774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019396880.1|2430823_2431141_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_003126630.1|2431137_2431368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003130863.1|2431518_2431812_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_087920907.1|2432072_2433235_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	53.2	9.5e-85
WP_003130870.1|2433560_2433920_-	DUF4440 domain-containing protein	NA	NA	NA	NA	NA
WP_031637682.1|2434637_2435288_-	hypothetical protein	NA	A0A0U4J8W4	Pseudomonas_phage	97.2	1.6e-121
WP_023088260.1|2435421_2435994_-	S24 family peptidase	NA	H2BD63	Pseudomonas_phage	91.7	1.9e-86
WP_003451709.1|2436370_2436589_+	helix-turn-helix domain-containing protein	NA	A0A2D1GND2	Pseudomonas_phage	64.7	2.9e-19
WP_033990714.1|2436620_2437193_+	hypothetical protein	NA	H2BD67	Pseudomonas_phage	98.4	1.3e-100
WP_034008244.1|2437195_2438080_+	hypothetical protein	NA	NA	NA	NA	NA
2437843:2437858	attR	GCAGATGCTCGCGGCA	NA	NA	NA	NA
WP_003103373.1|2438129_2438738_+	hypothetical protein	NA	A0A2H4J6S4	uncultured_Caudovirales_phage	43.9	3.4e-41
WP_023083722.1|2438730_2439174_+	RusA family crossover junction endodeoxyribonuclease	NA	H2BD71	Pseudomonas_phage	69.2	1.4e-52
WP_034008243.1|2439202_2440072_+	hypothetical protein	NA	J7HXH6	Pseudomonas_phage	84.4	4.1e-141
WP_069376653.1|2440131_2440440_-	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_023101093.1|2440414_2440690_-	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	A0A0A1IU40	Pseudomonas_phage	64.9	2.7e-06
WP_069376654.1|2440990_2441290_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003103377.1|2441397_2441778_+	hypothetical protein	NA	H2BDJ3	Pseudomonas_virus	67.5	4.8e-38
WP_003103378.1|2441752_2442100_+|holin	phage holin family protein	holin	Q9MC42	Pseudomonas_phage	61.3	1.9e-25
WP_003103379.1|2442166_2442622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023101096.1|2442679_2443276_+|terminase	terminase small subunit	terminase	H2BD75	Pseudomonas_phage	61.9	3.3e-49
WP_023115880.1|2443262_2444558_+	hypothetical protein	NA	A0A1B1P9C9	Acinetobacter_phage	58.5	1.4e-145
WP_069376655.1|2444560_2445916_+	DUF4055 domain-containing protein	NA	A0A0H5AWC7	Pseudomonas_phage	45.4	5.3e-95
WP_046638885.1|2445912_2446992_+	hypothetical protein	NA	A0A0S2SY77	Pseudomonas_phage	97.8	4.4e-201
WP_034028840.1|2447115_2447859_+	hypothetical protein	NA	A0A0H5AWD1	Pseudomonas_phage	75.5	2.2e-87
WP_010793134.1|2447868_2448840_+	hypothetical protein	NA	A0A0M3LQL5	Mannheimia_phage	64.7	5.4e-110
WP_010793133.1|2448881_2449367_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069376656.1|2449350_2449815_+	hypothetical protein	NA	H9EB35	Vibrio_phage	38.0	1.2e-09
WP_003103397.1|2449814_2450204_+	hypothetical protein	NA	A0A2H4JAS3	uncultured_Caudovirales_phage	55.0	2.8e-33
WP_061195337.1|2450207_2450882_+	hypothetical protein	NA	A0A0S2SY81	Pseudomonas_phage	96.4	6.0e-116
WP_012075336.1|2450878_2451289_+	hypothetical protein	NA	A0A1B0VMI0	Pseudomonas_phage	43.4	1.9e-24
WP_019396741.1|2451356_2452010_+|tail	phage tail protein	tail	A0A2H4IZV5	uncultured_Caudovirales_phage	52.8	1.0e-59
WP_023115887.1|2452019_2452400_+	hypothetical protein	NA	A0A1B0VMH4	Pseudomonas_phage	44.9	4.8e-22
WP_049246843.1|2452462_2452726_+	phage protein	NA	A0A2R3UAE2	Siphoviridae_environmental_samples	46.0	2.7e-16
WP_069376657.1|2452722_2455914_+|tail	phage tail tape measure protein	tail	A0A2H4J9A1	uncultured_Caudovirales_phage	40.8	5.1e-157
WP_024928576.1|2455919_2456258_+|tail	phage tail protein	tail	A0A0S2SYI2	Pseudomonas_phage	98.2	1.2e-59
WP_069376658.1|2456254_2457004_+|tail	phage minor tail protein L	tail	A0A0S2SY57	Pseudomonas_phage	98.4	1.6e-146
WP_003160548.1|2457006_2457768_+	C40 family peptidase	NA	A0A0S2SY75	Pseudomonas_phage	93.9	1.4e-140
>prophage 6
NZ_CP012579	Pseudomonas aeruginosa strain PA_D5, complete genome	6681992	2677994	2684888	6681992	tRNA	uncultured_Caudovirales_phage(83.33%)	9	NA	NA
WP_069376677.1|2677994_2679275_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	45.4	6.3e-98
WP_003131135.1|2679276_2680674_+	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_003097628.1|2680678_2681653_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_009314043.1|2681740_2682724_-	glycosyl transferase family protein	NA	A0A2H4JBY5	uncultured_Caudovirales_phage	74.0	1.2e-141
WP_003090393.1|2682720_2683056_-	TusE/DsrC/DsvC family sulfur relay protein	NA	A0A2H4J8B6	uncultured_Caudovirales_phage	69.4	3.3e-38
WP_003090391.1|2683052_2683358_-	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_003090389.1|2683357_2683717_-	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	61.7	1.4e-34
WP_003090387.1|2683713_2684109_-	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	72.1	2.7e-47
WP_003090386.1|2684219_2684888_-	Bax inhibitor-1/YccA family protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	82.1	1.5e-90
>prophage 7
NZ_CP012579	Pseudomonas aeruginosa strain PA_D5, complete genome	6681992	4377318	4493548	6681992	tRNA,transposase,integrase,protease	Escherichia_phage(16.67%)	106	4471403:4471420	4504063:4504080
WP_003082462.1|4377318_4378143_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	73.7	1.4e-106
WP_003082458.1|4378245_4378839_+	molecular chaperone DnaJ	NA	NA	NA	NA	NA
WP_003082455.1|4378997_4379597_+	YIP1 family protein	NA	NA	NA	NA	NA
WP_003082453.1|4379764_4380262_+|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_034074728.1|4380263_4381445_-	CoA transferase	NA	NA	NA	NA	NA
WP_003082447.1|4381533_4382673_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_031636425.1|4382774_4383794_-	LLM class oxidoreductase	NA	NA	NA	NA	NA
WP_003140525.1|4383790_4384420_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_003140526.1|4384621_4385512_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003133810.1|4385586_4386897_-	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_003133812.1|4387232_4388234_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_003086577.1|4388237_4391600_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	33.1	7.9e-15
WP_003082438.1|4391701_4393048_-	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_003082436.1|4393044_4393722_-	response regulator	NA	NA	NA	NA	NA
WP_003082431.1|4393801_4394404_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_003082429.1|4394625_4394793_+	periplasmic nitrate reductase, NapE protein	NA	NA	NA	NA	NA
WP_009315481.1|4394801_4395293_+	ferredoxin-type protein NapF	NA	NA	NA	NA	NA
WP_009315480.1|4395285_4395615_+	chaperone NapD	NA	NA	NA	NA	NA
WP_003107632.1|4395595_4398100_+	nitrate reductase catalytic subunit NapA	NA	NA	NA	NA	NA
WP_003082414.1|4398110_4398602_+	cytochrome C protein NapB	NA	NA	NA	NA	NA
WP_003082412.1|4398612_4399209_+	cytochrome c3 family protein	NA	NA	NA	NA	NA
WP_069376804.1|4399240_4400437_-	lytic murein transglycosylase	NA	NA	NA	NA	NA
WP_009315477.1|4400893_4401628_+	TerC family protein	NA	A0A0S4KZH7	Pseudomonas_phage	41.2	1.7e-31
WP_023099838.1|4401671_4403729_-	oleic acid lipoxygenase	NA	NA	NA	NA	NA
WP_003082401.1|4403806_4404127_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019486594.1|4404626_4405298_-	polysaccharide lyase family 7 protein	NA	NA	NA	NA	NA
WP_019486595.1|4405473_4406262_+	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_003449100.1|4406489_4407218_+	4'-phosphopantetheinyl transferase superfamily protein	NA	NA	NA	NA	NA
WP_003086553.1|4407218_4408031_-|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	29.3	1.4e-13
WP_003140539.1|4408242_4410852_+	glycosyltransferase	NA	M1I277	Paramecium_bursaria_Chlorella_virus	26.8	1.1e-16
WP_069376805.1|4410966_4412118_+	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_003140543.1|4412117_4412921_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_003082373.1|4412938_4413322_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003082372.1|4413426_4413636_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	58.1	2.0e-14
WP_003140545.1|4413955_4415314_-	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	26.0	2.3e-13
WP_003082360.1|4415655_4416366_-	response regulator	NA	W8CYM9	Bacillus_phage	33.5	3.3e-32
WP_003082358.1|4417098_4419990_+	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2H4P767	Pseudomonas_phage	46.3	9.9e-184
WP_015648380.1|4420182_4421388_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_069376806.1|4421380_4422838_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_015648377.1|4424942_4425353_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154052184.1|4425990_4426371_-	mCpol domain-containing protein	NA	NA	NA	NA	NA
WP_069376834.1|4426757_4428740_+	SAM-dependent DNA methyltransferase	NA	A0A220A2U5	Liberibacter_phage	24.9	1.6e-31
WP_015648374.1|4428736_4430110_+	type I restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_069376833.1|4430110_4433314_+	type I restriction endonuclease subunit R	NA	NA	NA	NA	NA
WP_003105872.1|4433332_4433554_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_015648372.1|4433656_4434247_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031757590.1|4434243_4435644_+	AAA family ATPase	NA	I4AZM6	Saccharomonospora_phage	32.5	5.0e-40
WP_015648370.1|4435734_4436037_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075116582.1|4436435_4437038_+	type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein	NA	NA	NA	NA	NA
WP_049339758.1|4437232_4440151_-|transposase	Tn3-like element ISPa38 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.4	0.0e+00
WP_001389365.1|4440175_4440940_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_000376623.1|4441446_4441947_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000259031.1|4442074_4442914_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000679427.1|4442907_4443255_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000777554.1|4443958_4444432_-	trimethoprim-resistant dihydrofolate reductase DfrA1	NA	A0A140HLG8	Bacillus_phage	34.4	1.6e-19
WP_001261740.1|4444507_4445299_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_001256776.1|4445391_4446651_-	chloramphenicol efflux MFS transporter CmlA1	NA	S4TR35	Salmonella_phage	31.7	1.7e-26
WP_003159191.1|4446917_4447472_-	aminoglycoside N-acetyltransferase AAC(6')-Ib4	NA	NA	NA	NA	NA
WP_015057121.1|4447632_4448592_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	40.5	1.7e-47
WP_001067855.1|4448482_4449187_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001038045.1|4450019_4450679_-	tetracycline resistance transcriptional repressor TetR(C)	NA	NA	NA	NA	NA
WP_001297013.1|4450771_4451962_+	tetracycline efflux MFS transporter Tet(C)	NA	A0A2H4UVM2	Bodo_saltans_virus	24.0	8.1e-07
WP_002310911.1|4451865_4452204_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079858798.1|4452200_4452386_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000015696.1|4452411_4452690_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001067855.1|4453047_4453752_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000018326.1|4453881_4454697_+	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	98.5	4.3e-161
WP_000902128.1|4454850_4455030_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|4455121_4455826_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_023910379.1|4456676_4457306_+	HIT domain-containing protein	NA	NA	NA	NA	NA
WP_003086099.1|4457306_4457516_+	protein SlyX	NA	NA	NA	NA	NA
WP_003106665.1|4457564_4458179_-	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	46.8	1.4e-10
WP_003086103.1|4458392_4458863_-	DNA starvation/stationary phase protection protein	NA	A0A2H4N7L5	Lake_Baikal_phage	36.4	6.6e-21
WP_069376817.1|4459302_4461078_+|tRNA	aspartate--tRNA ligase	tRNA	A0A1V0SIS0	Klosneuvirus	27.8	1.5e-12
WP_003086107.1|4461144_4461891_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_003112575.1|4461975_4462500_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	24.4	2.6e-05
WP_003086122.1|4462516_4463122_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_003086123.1|4463132_4464191_+	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	26.8	4.0e-05
WP_003086124.1|4464243_4464690_+	tol-pal system-associated acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_003086125.1|4464691_4465387_+	protein TolQ	NA	NA	NA	NA	NA
WP_003086126.1|4465409_4465850_+	protein TolR	NA	NA	NA	NA	NA
WP_003086127.1|4465852_4466896_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_003086128.1|4466892_4468191_+	Tol-Pal system protein TolB	NA	NA	NA	NA	NA
WP_003111417.1|4468243_4468750_+	peptidoglycan-associated lipoprotein Pal	NA	NA	NA	NA	NA
WP_003120698.1|4468759_4469584_+	tol-pal system protein YbgF	NA	NA	NA	NA	NA
WP_023657672.1|4469656_4470451_+	7-carboxy-7-deazaguanine synthase QueE	NA	NA	NA	NA	NA
WP_003086132.1|4470466_4471141_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	39.3	2.3e-30
4471403:4471420	attL	GTGGGCTTTTCTGTTTCT	NA	NA	NA	NA
WP_034005563.1|4471644_4472928_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_077563447.1|4472924_4474856_-	DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_023124020.1|4475291_4476521_-	3-hydroxybenzoate 6-monooxygenase	NA	NA	NA	NA	NA
WP_023124019.1|4476836_4477880_-	gentisate 1,2-dioxygenase	NA	NA	NA	NA	NA
WP_023124018.1|4477920_4478865_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_023124017.1|4478861_4480556_-	hypothetical protein	NA	A0A1V0SI18	Klosneuvirus	31.4	1.5e-54
WP_023124016.1|4480744_4481671_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_031636513.1|4481808_4482612_+	class II aldolase/adducin family protein	NA	NA	NA	NA	NA
WP_023124014.1|4482633_4484085_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_023124013.1|4484234_4484972_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_023124012.1|4485002_4485902_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_031636511.1|4485955_4486729_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_023124010.1|4486821_4488597_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031636509.1|4488593_4489136_+	DUF924 family protein	NA	E3T4R4	Cafeteria_roenbergensis_virus	31.7	4.8e-15
WP_031686420.1|4489432_4489783_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_003123374.1|4489786_4490059_-	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_071534421.1|4490177_4490525_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031686419.1|4490573_4492100_-	conjugal transfer protein TraG	NA	NA	NA	NA	NA
WP_087920907.1|4492386_4493548_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	53.2	9.5e-85
4504063:4504080	attR	GTGGGCTTTTCTGTTTCT	NA	NA	NA	NA
>prophage 8
NZ_CP012579	Pseudomonas aeruginosa strain PA_D5, complete genome	6681992	4683696	4701305	6681992	bacteriocin,transposase,integrase	Escherichia_phage(50.0%)	21	4693899:4693958	4700538:4701357
WP_003112475.1|4683696_4683960_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_003082347.1|4684475_4684820_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079858776.1|4684836_4685109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021264452.1|4685524_4685758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019725959.1|4685963_4686518_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069376832.1|4687050_4687584_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_003086547.1|4687943_4689191_-	ribonucleotide-diphosphate reductase subunit beta	NA	K4K678	Caulobacter_phage	29.0	7.6e-32
WP_015648365.1|4689651_4690350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019396235.1|4690431_4691604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075116584.1|4691607_4693272_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075116583.1|4693253_4693718_+	hypothetical protein	NA	NA	NA	NA	NA
4693899:4693958	attL	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTG	NA	NA	NA	NA
WP_001067855.1|4693961_4694666_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000902128.1|4694757_4694937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000018326.1|4695090_4695906_-	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	98.5	4.3e-161
WP_001067855.1|4696035_4696740_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000015696.1|4697097_4697376_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_079858798.1|4697401_4697587_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002310911.1|4697583_4697922_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001297013.1|4697825_4699016_-	tetracycline efflux MFS transporter Tet(C)	NA	A0A2H4UVM2	Bodo_saltans_virus	24.0	8.1e-07
WP_001038045.1|4699108_4699768_+	tetracycline resistance transcriptional repressor TetR(C)	NA	NA	NA	NA	NA
WP_001067855.1|4700600_4701305_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
4700538:4701357	attR	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTGCACATGAACCCATTCAAAGGCCGGCATTTTCAGCGTGACATCATTCTGTGGGCCGTACGCTGGTACTGCAAATACGGCATCAGTTACCGTGAGCTGCAGGAGATGCTGGCTGAACGCGGAGTGAATGTCGATCACTCCACGATTTACCGCTGGGTTCAGCGTTATGCGCCTGAAATGGAAAAACGGCTGCGCTGGTACTGGCGTAACCCTTCCGATCTTTGCCCGTGGCACATGGATGAAACCTACGTGAAGGTCAATGGCCGCTGGGCGTATCTGTACCGGGCCGTCGACAGCCGGGGCCGCACTGTCGATTTTTATCTCTCCTCCCGTCGTAACAGCAAAGCTGCATACCGGTTTCTGGGTAAAATCCTCAACAACGTGAAGAAGTGGCAGATCCCGCGATTCATCAACACGGATAAAGCGCCCGCCTATGGTCGCGCGCTTGCTCTGCTCAAACGCGAAGGCCGGTGCCCGTCTGACGTTGAACACCGACAGATTAAGTACCGGAACAACGTGATTGAATGCGATCATGGCAAACTGAAACGGATAATCGGCGCCACGCTGGGATTTAAATCCATGAAGACGGCTTACGCCACCATCAAAGGTATTGAGGTGATGCGTGCACTACGCAAAGGCCAGGCCTCAGCATTTTATTATGGTGATCCCCTGGGCGAAATGCGCCTGGTAAGCAGAGTTTTTGAAATGTAAGGCCTTTGAATAAGACAAAAGGCTGCCTCATCGCTAACTTTGCAACAGTGCC	NA	NA	NA	NA
>prophage 9
NZ_CP012579	Pseudomonas aeruginosa strain PA_D5, complete genome	6681992	6121534	6186371	6681992	tail,head,protease,capsid,portal,terminase	Acidithiobacillus_phage(37.84%)	75	NA	NA
WP_023098208.1|6121534_6122353_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_023876105.1|6122502_6123789_+	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	39.8	2.9e-10
WP_003096067.1|6123817_6125128_+	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	29.0	3.9e-26
WP_003096069.1|6125127_6125901_+	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_033876922.1|6125969_6127451_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003096075.1|6127488_6128244_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003106330.1|6128393_6129146_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003111636.1|6129236_6129983_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003106334.1|6130154_6130925_-	imidazole glycerol phosphate synthase subunit HisF	NA	NA	NA	NA	NA
WP_003106336.1|6130935_6131673_-	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino]imidazole-4- carboxamide isomerase	NA	NA	NA	NA	NA
WP_034075387.1|6131721_6131982_-	DUF2164 domain-containing protein	NA	NA	NA	NA	NA
WP_003096087.1|6131985_6132624_-	imidazole glycerol phosphate synthase subunit HisH	NA	NA	NA	NA	NA
WP_003096088.1|6132623_6133217_-	imidazoleglycerol-phosphate dehydratase HisB	NA	NA	NA	NA	NA
WP_003118016.1|6133377_6133776_+	acetyl-CoA sensor PanZ family protein	NA	NA	NA	NA	NA
WP_009314450.1|6133812_6134049_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069376948.1|6134045_6135152_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_034019954.1|6135245_6137498_+	AsmA family protein	NA	NA	NA	NA	NA
WP_069376949.1|6137494_6138562_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_003096100.1|6138605_6138878_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_034019955.1|6138905_6139988_+	oxidoreductase	NA	NA	NA	NA	NA
WP_069376950.1|6140471_6140702_-	DUF2188 domain-containing protein	NA	A0A142KA22	Gordonia_phage	37.1	9.4e-05
WP_069376951.1|6140773_6141739_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069376952.1|6141742_6142978_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069376953.1|6143222_6143552_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_069377030.1|6143646_6144495_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A0A7RTT7	Clostridium_phage	33.3	4.1e-05
WP_154052191.1|6144520_6145342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_055451266.1|6145664_6146138_+	DUF2924 domain-containing protein	NA	K4I3X1	Acidithiobacillus_phage	51.4	1.4e-34
WP_069376955.1|6146134_6147547_+	recombinase family protein	NA	K4ICM1	Acidithiobacillus_phage	58.4	2.0e-137
WP_069376956.1|6147543_6148008_+	hypothetical protein	NA	K4HZX2	Acidithiobacillus_phage	37.3	1.4e-15
WP_020200569.1|6148182_6148446_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_069376957.1|6148457_6148934_+	hypothetical protein	NA	K4HZ96	Acidithiobacillus_phage	65.2	4.6e-54
WP_069377031.1|6148939_6149221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069376958.1|6149223_6149982_+	antirepressor	NA	K4I1D2	Acidithiobacillus_phage	68.5	1.7e-87
WP_069376959.1|6149981_6150842_+	ATP-binding protein	NA	K4HZX9	Acidithiobacillus_phage	70.9	2.4e-109
WP_069376960.1|6150847_6151477_+	hypothetical protein	NA	K4ICM8	Acidithiobacillus_phage	68.8	5.1e-77
WP_055451273.1|6151486_6151975_+	hypothetical protein	NA	K4I3X7	Acidithiobacillus_phage	80.5	2.0e-73
WP_069376961.1|6151971_6152709_+	hypothetical protein	NA	K4HZA0	Acidithiobacillus_phage	75.4	2.7e-109
WP_024541980.1|6152705_6152933_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_069376962.1|6152925_6155217_+	hypothetical protein	NA	K4HZY1	Acidithiobacillus_phage	64.6	7.9e-293
WP_024541982.1|6155342_6155819_+	hypothetical protein	NA	K4ICN3	Acidithiobacillus_phage	73.5	1.3e-59
WP_024541983.1|6155820_6156030_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069376963.1|6156022_6156421_+	RNA polymerase subunit sigma	NA	NA	NA	NA	NA
WP_069376964.1|6156779_6158195_+	site-specific DNA-methyltransferase	NA	K4I3Y2	Acidithiobacillus_phage	61.1	3.9e-165
WP_069376965.1|6158191_6159454_+	site-specific DNA-methyltransferase	NA	A0A2H4JGF1	uncultured_Caudovirales_phage	89.7	1.2e-223
WP_069376966.1|6159417_6159786_-	hypothetical protein	NA	A0A2H4JI44	uncultured_Caudovirales_phage	85.8	1.5e-57
WP_069376967.1|6159883_6160447_-	DUF3489 domain-containing protein	NA	A0A2H4JE21	uncultured_Caudovirales_phage	80.9	1.1e-33
WP_069376968.1|6160542_6160749_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069376969.1|6160855_6161401_+	elements of external origin	NA	A0A2H4JCL4	uncultured_Caudovirales_phage	65.7	2.6e-53
WP_069376970.1|6161400_6163359_+|terminase	phage terminase large subunit family protein	terminase	A0A2H4JIC6	uncultured_Caudovirales_phage	88.4	0.0e+00
WP_069376971.1|6163389_6163881_+	hypothetical protein	NA	A0A0F6WCR7	Sinorhizobium_phage	49.1	9.3e-26
WP_069376972.1|6163880_6164273_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069376973.1|6164272_6164494_+	hypothetical protein	NA	A0A2H4JCJ9	uncultured_Caudovirales_phage	58.9	1.7e-11
WP_069376974.1|6164495_6166010_+|portal	phage portal protein	portal	A0A1B2LRR5	Wolbachia_phage	56.0	5.8e-151
WP_069376975.1|6166043_6167285_+|protease	Clp protease ClpP	protease	K4HZZ6	Acidithiobacillus_phage	41.7	3.7e-63
WP_004629291.1|6167286_6167664_+|head	head decoration protein	head	A0A1B2LRT0	Wolbachia_phage	53.9	1.8e-16
WP_024541998.1|6167666_6168671_+|capsid	major capsid protein	capsid	Q9JMM2	Wolbachia_phage	67.1	2.4e-124
WP_069376976.1|6168670_6168973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069376977.1|6168977_6169424_+	hypothetical protein	NA	A0A2I5ARB4	Synechococcus_phage	29.8	2.1e-08
WP_069376978.1|6169429_6169651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054286366.1|6169647_6170400_+	hypothetical protein	NA	A0A2D2W2E0	Stenotrophomonas_phage	44.6	3.3e-46
WP_054286367.1|6170411_6170810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054286368.1|6170806_6171016_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069376979.1|6170990_6171635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069376980.1|6171636_6175674_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	29.2	4.7e-30
WP_069376981.1|6175710_6176121_+	hypothetical protein	NA	A0A0M4UTA7	Ralstonia_phage	48.5	3.1e-30
WP_069376982.1|6176120_6179729_+	hypothetical protein	NA	A0A0M4U447	Ralstonia_phage	41.1	3.2e-240
WP_069376983.1|6179776_6181042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069376984.1|6181045_6182131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069376985.1|6182127_6182523_+	hypothetical protein	NA	Q6VSZ7	Vibrio_phage	34.1	1.5e-05
WP_069376986.1|6182526_6184554_+	hypothetical protein	NA	A0A0M4UKC5	Ralstonia_phage	36.1	7.2e-56
WP_069376987.1|6184546_6184768_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069376988.1|6184847_6185153_+	hypothetical protein	NA	K4I011	Acidithiobacillus_phage	62.6	1.6e-23
WP_045667467.1|6185149_6185377_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069376989.1|6185373_6185874_+	lysozyme	NA	A0A1S6L191	Ralstonia_phage	39.8	1.9e-18
WP_069376990.1|6185870_6186371_+	hypothetical protein	NA	A0A077K9R7	Ralstonia_phage	50.0	8.6e-27
