The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP017124	Lactobacillus curvatus strain WiKim38 chromosome, complete genome	1940170	13151	20953	1940170	transposase	Leptospira_phage(33.33%)	7	NA	NA
WP_172821848.1|13151_14555_+	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	53.9	2.8e-131
WP_003592463.1|14874_15804_+|transposase	IS30-like element ISLpl1 family transposase	transposase	H7BW47	unidentified_phage	34.4	2.3e-25
WP_069467796.1|15975_17322_-	purine permease	NA	Q9KX94	Enterobacteria_phage	28.9	1.6e-38
WP_064776763.1|17689_18430_+	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
WP_004265810.1|18429_19308_+	nucleoid occlusion protein	NA	S5VTK0	Leptospira_phage	40.6	1.8e-19
WP_004265824.1|19320_20088_+	ParA family protein	NA	Q8JL10	Natrialba_phage	33.0	1.3e-29
WP_004265828.1|20077_20953_+	ParB/RepB/Spo0J family partition protein	NA	S5VSZ7	Leptospira_phage	41.2	2.9e-17
>prophage 2
NZ_CP017124	Lactobacillus curvatus strain WiKim38 chromosome, complete genome	1940170	35474	99145	1940170	transposase,tRNA,integrase,holin	Staphylococcus_phage(11.76%)	58	71644:71672	81355:81383
WP_065825101.1|35474_36635_-|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	G3M9Y6	Bacillus_virus	31.2	2.5e-21
WP_081326632.1|36783_37923_-	MFS transporter	NA	NA	NA	NA	NA
WP_039098416.1|37989_39147_-|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_065825099.1|39191_39980_-	tyrosine-protein phosphatase	NA	NA	NA	NA	NA
WP_069467803.1|40100_41045_+	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_004265855.1|41149_41638_+	universal stress protein	NA	NA	NA	NA	NA
WP_039098414.1|41713_42253_+	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_064776753.1|42342_42834_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069467804.1|42857_43694_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.2	1.1e-10
WP_039098410.1|43680_44415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039098409.1|44547_45483_+	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
WP_004265799.1|45500_45968_+	universal stress protein	NA	NA	NA	NA	NA
WP_069467805.1|45992_46721_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004265779.1|46804_47020_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039098407.1|47225_48413_-	class I SAM-dependent methyltransferase	NA	A0A2K9L4K8	Tupanvirus	37.8	1.5e-48
WP_069467806.1|48568_49609_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_064776747.1|49999_50197_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_069467807.1|50289_51342_-	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_039098402.1|51534_51975_+	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_069467808.1|52022_52478_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069467809.1|52716_53613_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	31.6	1.4e-24
WP_069467810.1|53605_54859_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_069467811.1|54939_56019_+	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_069467812.1|56123_58019_+	peptidase M13	NA	E3T4I7	Cafeteria_roenbergensis_virus	29.3	2.0e-71
WP_039099055.1|58098_58698_+	sugar O-acetyltransferase	NA	NA	NA	NA	NA
WP_039099056.1|58883_59555_-	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_069467813.1|59547_60360_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_069467814.1|60352_61162_-	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_069467815.1|61566_63585_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_004271031.1|63638_64586_-	DUF1002 domain-containing protein	NA	NA	NA	NA	NA
WP_004271030.1|64696_65830_-	VanZ family protein	NA	NA	NA	NA	NA
WP_069467816.1|66095_67376_+	adenylosuccinate synthase	NA	A0A285PX35	Cedratvirus	34.7	5.9e-64
WP_054644091.1|67545_68856_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	32.6	1.5e-49
WP_056966448.1|68999_69662_+	class A sortase	NA	NA	NA	NA	NA
WP_069467818.1|70115_70688_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_081326578.1|70861_71629_+	helix-turn-helix transcriptional regulator	NA	A0A0A7S0F1	Clostridium_phage	37.4	2.9e-05
71644:71672	attL	ATCATGTATACTTGATGGGTGGTCAGGGG	NA	NA	NA	NA
WP_081326579.1|71770_72373_-|integrase	site-specific integrase	integrase	J7KBT5	Streptococcus_phage	45.8	1.0e-37
WP_004271103.1|73913_75290_+	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
WP_069467819.1|75474_76746_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	31.0	3.3e-46
WP_003553069.1|77107_78277_-	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_064776730.1|78838_79072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069467820.1|79096_79360_+|transposase	IS3 family transposase	transposase	Q6J1X3	Lactobacillus_phage	92.0	7.9e-32
WP_064776728.1|79400_80243_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	98.2	6.3e-155
WP_004271125.1|81670_82384_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	40.6	6.1e-42
81355:81383	attR	ATCATGTATACTTGATGGGTGGTCAGGGG	NA	NA	NA	NA
WP_039099538.1|82393_84298_+	cell wall metabolism sensor histidine kinase WalK	NA	W8CYF6	Bacillus_phage	33.7	1.6e-33
WP_069467821.1|84287_85619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039099540.1|85623_86439_+	two-component system regulatory protein YycI	NA	NA	NA	NA	NA
WP_004271122.1|86475_87282_+	MBL fold metallo-hydrolase	NA	A0A2H4J3R0	uncultured_Caudovirales_phage	30.9	1.1e-31
WP_069467822.1|87451_88690_+	trypsin-like peptidase domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	27.1	5.3e-17
WP_064776725.1|89202_89682_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_081326580.1|89809_90343_+	HAD hydrolase family protein	NA	NA	NA	NA	NA
WP_069468528.1|91207_92674_+	MFS transporter	NA	NA	NA	NA	NA
WP_069467824.1|92823_94617_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_069467825.1|94642_96088_+	family 1 glycosylhydrolase	NA	NA	NA	NA	NA
WP_069467826.1|96173_97010_+	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_069467827.1|97183_97753_-	glycoside hydrolase family 92 protein	NA	NA	NA	NA	NA
WP_069467828.1|97788_98121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003592463.1|98215_99145_+|transposase	IS30-like element ISLpl1 family transposase	transposase	H7BW47	unidentified_phage	34.4	2.3e-25
>prophage 3
NZ_CP017124	Lactobacillus curvatus strain WiKim38 chromosome, complete genome	1940170	641261	696373	1940170	head,tail,tRNA,capsid,terminase,protease,portal	Oenococcus_phage(29.41%)	70	NA	NA
WP_069468018.1|641261_642191_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_069468019.1|642215_643472_+	methionine gamma-lyase family protein	NA	NA	NA	NA	NA
WP_069468021.1|644442_644988_+	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_069468022.1|645110_645482_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_039098814.1|645496_646840_+	type I glutamate--ammonia ligase	NA	A0A167RK87	Powai_lake_megavirus	27.8	1.7e-13
WP_039098816.1|646899_647595_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_004265345.1|647594_647762_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069468023.1|647820_648372_-	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	32.0	5.4e-14
WP_069468024.1|648577_649471_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_069468025.1|649489_650290_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_039099662.1|650337_651654_-	multidrug transporter MatE	NA	NA	NA	NA	NA
WP_039099661.1|651664_652492_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004265264.1|652600_653614_+	YeiH family putative sulfate export transporter	NA	NA	NA	NA	NA
WP_004270892.1|653704_653944_-	steroid-binding protein	NA	NA	NA	NA	NA
WP_052202779.1|654138_654474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069468026.1|654654_655032_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004270893.1|655134_655635_+	VanZ family protein	NA	NA	NA	NA	NA
WP_004270897.1|655724_656456_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_069468027.1|656559_657435_+	Flp pilus assembly complex ATPase component TadA	NA	NA	NA	NA	NA
WP_069468028.1|657424_658426_+	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_069468029.1|658478_659903_-	recombinase family protein	NA	A0A141E0M0	Streptococcus_phage	42.5	2.6e-100
WP_069468030.1|660011_660713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069468031.1|660705_661128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069468032.1|661120_662029_-	AAA family ATPase	NA	A0A1X9IGI7	Lactococcus_phage	36.8	3.3e-32
WP_069468033.1|662128_663115_-	DUF4236 domain-containing protein	NA	A0A2K9V2W7	Faecalibacterium_phage	63.1	5.9e-11
WP_143435696.1|663251_663881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069468034.1|663988_664834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069468035.1|664893_665295_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0M7RF74	Lactobacillus_phage	39.3	3.8e-17
WP_069468036.1|665294_665630_-	helix-turn-helix transcriptional regulator	NA	E9LUL4	Lactobacillus_phage	50.9	7.0e-25
WP_069468037.1|665778_666006_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_155760082.1|666024_666189_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069468537.1|666305_666800_+	helix-turn-helix transcriptional regulator	NA	O03909	Lactobacillus_phage	59.5	7.1e-50
WP_069468039.1|667240_667438_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069468040.1|667437_668205_+	phage recombination protein Bet	NA	A8ATK8	Listeria_phage	51.9	2.1e-56
WP_081326635.1|668227_668956_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	A0A1S5S9Y4	Streptococcus_phage	44.4	1.6e-45
WP_069468042.1|668967_669384_+	single-stranded DNA-binding protein	NA	G4KNN8	Staphylococcus_phage	46.1	1.3e-23
WP_069468043.1|669394_670360_+	DnaD domain protein	NA	A6M985	Geobacillus_virus	41.0	2.0e-40
WP_069468045.1|670559_671090_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_081303843.1|671061_671268_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155760086.1|671267_671429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069468046.1|671425_671884_+	class I SAM-dependent methyltransferase	NA	A8ATY8	Listeria_phage	70.7	1.9e-60
WP_069468047.1|671954_672242_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155760088.1|672255_672426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065825501.1|672459_672798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069468048.1|672808_673156_+	hypothetical protein	NA	A0A191ZDH8	Pseudoalteromonas_virus	37.5	4.6e-11
WP_039098605.1|673283_673748_+	DUF1064 domain-containing protein	NA	A0A1I9KKZ1	Lactobacillus_phage	50.3	1.2e-33
WP_065825503.1|673759_673963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065825504.1|673982_674165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039098607.1|674164_674401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065825505.1|674514_674940_+	hypothetical protein	NA	O03925	Lactobacillus_phage	48.6	5.2e-33
WP_069468049.1|675433_676339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155760091.1|676582_676753_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069468050.1|676752_677577_+|terminase	terminase small subunit	terminase	V9QKX0	Oenococcus_phage	49.6	6.3e-67
WP_069468051.1|677569_678844_+|terminase	PBSX family phage terminase large subunit	terminase	V5UQR5	Oenococcus_phage	71.6	3.6e-186
WP_081326598.1|678743_680303_+|portal	phage portal protein	portal	V9QKI8	Oenococcus_phage	53.5	3.1e-147
WP_069468053.1|680244_680559_+|protease	ribosomal-processing cysteine protease Prp	protease	D2J003	Enterococcus_phage	45.4	2.7e-10
WP_069468054.1|680561_681755_+|capsid	minor capsid protein	capsid	V5UTD3	Oenococcus_phage	46.4	3.1e-91
WP_069468055.1|681923_682568_+	DUF4355 domain-containing protein	NA	Q6SE80	Lactobacillus_prophage	34.6	6.7e-24
WP_069468056.1|682580_682937_+	hypothetical protein	NA	V5UQS0	Oenococcus_phage	53.4	1.6e-30
WP_039098617.1|682959_684021_+|capsid	major capsid protein	capsid	V9QKJ3	Oenococcus_phage	65.6	2.0e-126
WP_155760093.1|684035_684356_+|head,tail	phage head-tail connector protein	head,tail	V5UQW8	Oenococcus_phage	57.9	8.8e-17
WP_069468057.1|684352_684742_+	hypothetical protein	NA	D7RWJ2	Brochothrix_phage	55.9	1.6e-25
WP_069468058.1|684689_685235_+	hypothetical protein	NA	V5URV0	Oenococcus_phage	58.8	1.3e-52
WP_069468539.1|685236_685602_+	hypothetical protein	NA	Q6SE74	Lactobacillus_prophage	42.5	7.2e-23
WP_069468059.1|685614_686079_+|tail	phage tail protein	tail	V9QKJ6	Oenococcus_phage	59.3	1.7e-40
WP_069468060.1|686350_686755_+	hypothetical protein	NA	A0A182BQ86	Lactococcus_phage	58.5	4.5e-34
WP_081326601.1|686775_687156_+	hypothetical protein	NA	D7RWJ9	Brochothrix_phage	43.0	8.6e-19
WP_069468061.1|687167_691985_+	hypothetical protein	NA	D2J014	Enterococcus_phage	45.2	1.0e-172
WP_069468062.1|692000_692360_+	hypothetical protein	NA	V9QIZ3	Oenococcus_phage	52.6	5.0e-29
WP_069468063.1|692371_696373_+	hypothetical protein	NA	D7RWK2	Brochothrix_phage	35.9	9.0e-151
>prophage 4
NZ_CP017124	Lactobacillus curvatus strain WiKim38 chromosome, complete genome	1940170	717513	725747	1940170		Bacillus_phage(50.0%)	9	NA	NA
WP_039099495.1|717513_717840_-	heavy metal-binding domain-containing protein	NA	M4STD1	Rhodobacter_phage	35.6	2.4e-06
WP_004270080.1|717855_718221_-	DUF1304 domain-containing protein	NA	NA	NA	NA	NA
WP_064777296.1|718330_719326_-	UDP-glucose 4-epimerase GalE	NA	A0A1V0SG19	Hokovirus	35.3	2.2e-45
WP_039098727.1|719478_721773_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	31.4	2.3e-74
WP_004270038.1|721807_722326_+	adenine phosphoribosyltransferase	NA	A0A2K9L2N8	Tupanvirus	31.1	2.8e-12
WP_069468086.1|722544_723159_-	transcriptional repressor LexA	NA	A0A1B1P7Q3	Bacillus_phage	57.4	1.3e-16
WP_004270057.1|723294_723537_+	DUF896 domain-containing protein	NA	NA	NA	NA	NA
WP_004270078.1|723617_723845_+	YneF family protein	NA	NA	NA	NA	NA
WP_069468087.1|724001_725747_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	27.7	1.0e-45
>prophage 5
NZ_CP017124	Lactobacillus curvatus strain WiKim38 chromosome, complete genome	1940170	828321	836360	1940170		Acanthocystis_turfacea_Chlorella_virus(33.33%)	8	NA	NA
WP_004269980.1|828321_829041_+	aquaporin family protein	NA	M1HCP3	Acanthocystis_turfacea_Chlorella_virus	34.5	1.3e-28
WP_039098874.1|829428_830802_+	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	29.3	1.6e-43
WP_004270037.1|830845_831325_-	nucleoside 2-deoxyribosyltransferase	NA	A0A2P0ZL88	Lactobacillus_phage	37.5	6.5e-16
WP_004270002.1|831469_831637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069468129.1|831775_833821_+	KUP/HAK/KT family potassium transporter	NA	M1IAJ4	Acanthocystis_turfacea_Chlorella_virus	35.4	1.7e-68
WP_064777244.1|834046_834655_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A249XZV3	Enterococcus_phage	49.7	9.2e-23
WP_004270016.1|834793_835063_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052202731.1|835094_836360_+	Y-family DNA polymerase	NA	M1Q231	Streptococcus_phage	39.0	4.1e-81
>prophage 6
NZ_CP017124	Lactobacillus curvatus strain WiKim38 chromosome, complete genome	1940170	1084056	1091696	1940170	tRNA	Staphylococcus_phage(33.33%)	7	NA	NA
WP_004270297.1|1084056_1084899_-	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	41.9	2.9e-19
WP_004270296.1|1085099_1085594_-	dihydrofolate reductase	NA	G3MBI7	Bacillus_virus	38.6	3.2e-26
WP_069468226.1|1085609_1086560_-	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	66.2	1.4e-126
WP_069468227.1|1086940_1088824_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	29.9	3.2e-50
WP_004270303.1|1088966_1089428_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069468228.1|1089491_1090691_-|tRNA	CCA tRNA nucleotidyltransferase	tRNA	A0A1B0V011	Roseobacter_phage	40.6	4.3e-32
WP_069468229.1|1090838_1091696_+	YitT family protein	NA	M1Q1P6	Streptococcus_phage	41.5	8.6e-59
>prophage 7
NZ_CP017124	Lactobacillus curvatus strain WiKim38 chromosome, complete genome	1940170	1191457	1246948	1940170	transposase,lysis,tRNA	unidentified_phage(27.78%)	50	NA	NA
WP_107504406.1|1191457_1192597_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_004270492.1|1192778_1193126_-	DUF1831 domain-containing protein	NA	NA	NA	NA	NA
WP_069468263.1|1193183_1194347_-	cysteine desulfurase	NA	H7BUW1	unidentified_phage	35.7	4.8e-28
WP_064777087.1|1194486_1195323_-	ATP-dependent sacrificial sulfur transferase LarE	NA	NA	NA	NA	NA
WP_004270481.1|1195347_1195653_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004270477.1|1195673_1196387_-	aquaporin family protein	NA	A0A1J0F964	Only_Syngen_Nebraska_virus	31.2	1.1e-19
WP_069468264.1|1196450_1196885_-	DUF111 family protein	NA	NA	NA	NA	NA
WP_069468265.1|1196901_1197768_-	LarC family nickel insertion protein	NA	NA	NA	NA	NA
WP_064777085.1|1197764_1198547_-	nickel pincer cofactor biosynthesis protein LarB	NA	A0A288TYA6	Enterococcus_phage	41.5	1.3e-21
WP_039099459.1|1198558_1199833_-	nickel-dependent lactate racemase	NA	NA	NA	NA	NA
WP_039099460.1|1200065_1200731_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_065825739.1|1200828_1201836_+	cobalt transporter CbiM	NA	NA	NA	NA	NA
WP_039099462.1|1201912_1202629_+	cobalt ABC transporter permease	NA	NA	NA	NA	NA
WP_069468266.1|1202633_1203359_+	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	31.0	2.9e-15
WP_069468267.1|1203397_1204369_-	LD-carboxypeptidase	NA	NA	NA	NA	NA
WP_172821856.1|1204504_1204645_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069468268.1|1204653_1205298_-	DsbA family oxidoreductase	NA	NA	NA	NA	NA
WP_069468269.1|1205313_1206258_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	46.1	3.8e-76
WP_064777079.1|1206254_1206596_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_172821857.1|1207827_1208283_-	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_004271133.1|1208388_1208649_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069468270.1|1208784_1209693_-|transposase	IS30 family transposase	transposase	H7BW47	unidentified_phage	34.1	9.5e-24
WP_039099554.1|1210080_1210773_-	5'-methylthioadenosine/adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_004271135.1|1210814_1211105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039099553.1|1211116_1211659_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_004271132.1|1211835_1212516_+|lysis	5-bromo-4-chloroindolyl phosphate hydrolysis family protein	lysis	NA	NA	NA	NA
WP_069468271.1|1212515_1213709_+	toxic anion resistance protein	NA	A0A2K9VCT6	Lactobacillus_phage	31.0	9.2e-35
WP_064777074.1|1213764_1215198_-	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	25.5	3.6e-25
WP_069468272.1|1215377_1216298_+|transposase	IS30-like element ISLsa1 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	37.9	6.0e-50
WP_064777073.1|1216345_1217743_-	Na+/H+ antiporter NhaC	NA	NA	NA	NA	NA
WP_069468273.1|1219470_1220400_-|transposase	IS30-like element ISLpl1 family transposase	transposase	H7BVY4	unidentified_phage	30.1	3.9e-25
WP_069468275.1|1221769_1223032_-|tRNA	tyrosine--tRNA ligase	tRNA	A0A1L2CUL7	Pectobacterium_phage	42.3	2.3e-84
WP_004270977.1|1223434_1223635_-	cold shock domain-containing protein	NA	Q9AZD3	Lactococcus_phage	66.2	2.2e-18
WP_069468276.1|1223741_1224782_-	galactose mutarotase	NA	NA	NA	NA	NA
WP_069468277.1|1224801_1226283_-	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_069468278.1|1226293_1227286_-	UDP-glucose 4-epimerase GalE	NA	A0A1V0SG19	Hokovirus	35.3	1.6e-45
WP_039099501.1|1227314_1228481_-	galactokinase	NA	NA	NA	NA	NA
WP_069468279.1|1228619_1229612_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_003592463.1|1230156_1231086_-|transposase	IS30-like element ISLpl1 family transposase	transposase	H7BW47	unidentified_phage	34.4	2.3e-25
WP_069468280.1|1231642_1233718_-	DNA topoisomerase 3	NA	A0A0G2Y787	Acanthamoeba_polyphaga_mimivirus	23.1	3.6e-18
WP_069468281.1|1234912_1235134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016377101.1|1235213_1235678_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069468282.1|1235695_1237705_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_155737225.1|1237701_1237872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069468283.1|1237871_1239245_-	DEAD/DEAH box helicase family protein	NA	A0A1I9SEY1	Klebsiella_phage	23.9	4.1e-10
WP_069468284.1|1239241_1242490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069468285.1|1242601_1242982_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069468286.1|1243689_1245063_-	N-6 DNA methylase	NA	A0A2H4PQP4	Staphylococcus_phage	35.8	1.9e-55
WP_069468287.1|1245065_1245620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069468288.1|1246018_1246948_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	29.5	2.2e-23
>prophage 8
NZ_CP017124	Lactobacillus curvatus strain WiKim38 chromosome, complete genome	1940170	1340218	1348564	1940170		Synechococcus_phage(33.33%)	8	NA	NA
WP_069468318.1|1340218_1340836_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	33.9	1.7e-24
WP_069468319.1|1340840_1341863_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.0	1.1e-63
WP_069468320.1|1341859_1343302_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	33.7	5.0e-51
WP_155760107.1|1343286_1345509_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	41.3	1.5e-147
WP_069468322.1|1345505_1346180_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_069468323.1|1346176_1346437_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_035186097.1|1346429_1347155_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FUQ7	Synechococcus_phage	40.1	2.1e-37
WP_069468324.1|1347265_1348564_-	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	32.2	7.2e-17
>prophage 9
NZ_CP017124	Lactobacillus curvatus strain WiKim38 chromosome, complete genome	1940170	1397719	1443029	1940170	transposase,bacteriocin,protease,holin	Streptococcus_phage(21.43%)	44	NA	NA
WP_064776983.1|1397719_1397965_-|holin	holin	holin	A0A142F1N6	Bacillus_phage	43.4	2.0e-13
WP_064776982.1|1397961_1398321_-	hypothetical protein	NA	A0A0P0IZF9	Lactobacillus_phage	44.4	9.9e-09
WP_003592463.1|1398451_1399381_+|transposase	IS30-like element ISLpl1 family transposase	transposase	H7BW47	unidentified_phage	34.4	2.3e-25
WP_069468340.1|1399481_1401263_+	glycerophosphodiester phosphodiesterase	NA	I6XE30	Staphylococcus_phage	23.6	9.9e-09
WP_039098169.1|1401668_1403024_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_069468342.1|1403183_1403612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039098171.1|1403659_1404280_+	endonuclease III	NA	NA	NA	NA	NA
WP_069468343.1|1404317_1405358_-	bifunctional threonine ammonia-lyase/L-serine ammonia-lyase TdcB	NA	A0A1W6JHY1	Lactococcus_phage	30.8	4.7e-11
WP_069468344.1|1405763_1406249_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_064776976.1|1406381_1406669_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_039098174.1|1406791_1407139_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_039098175.1|1407244_1407535_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039098176.1|1407688_1408318_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_004265904.1|1408364_1408772_-	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
WP_069468345.1|1408933_1410565_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004265899.1|1410917_1411244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039098178.1|1411310_1411916_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_069468346.1|1411912_1413037_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_069468347.1|1413033_1413780_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_004265896.1|1413783_1414656_-	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	30.4	2.0e-18
WP_004265942.1|1414798_1415440_+	DNA-3-methyladenine glycosylase	NA	NA	NA	NA	NA
WP_069468348.1|1415526_1416645_+	NAD(P)-dependent alcohol dehydrogenase	NA	M1PHA2	Moumouvirus	30.7	2.2e-14
WP_004265902.1|1416679_1416847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069468349.1|1416920_1417163_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_069468350.1|1417217_1417784_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081326639.1|1417749_1418691_-	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_064776966.1|1418840_1419812_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_004265909.1|1424042_1424627_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	53.9	5.3e-52
WP_069468352.1|1424748_1425267_+	DsbA family protein	NA	NA	NA	NA	NA
WP_039098448.1|1425371_1425827_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004265894.1|1425917_1426862_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	38.7	1.1e-51
WP_069468353.1|1426864_1427899_-	YvcK family protein	NA	A1IMD5	Streptococcus_phage	54.8	1.2e-94
WP_069468354.1|1427895_1428780_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	31.0	4.9e-09
WP_004265944.1|1428980_1429517_-	DUF308 domain-containing protein	NA	NA	NA	NA	NA
WP_064776964.1|1429671_1432524_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	54.8	5.6e-304
WP_004265948.1|1432536_1434540_-	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_004265951.1|1434956_1435589_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_004265958.1|1435701_1437426_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	55.1	1.9e-182
WP_039099207.1|1437803_1438724_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	51.1	1.1e-83
WP_052202753.1|1438811_1439168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069468355.1|1439333_1440362_-	NAD(P)H-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_004265937.1|1440389_1441223_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_004265923.1|1441589_1442531_-	HPr kinase/phosphorylase	NA	NA	NA	NA	NA
WP_004265953.1|1442675_1443029_-|holin	phage holin family protein	holin	NA	NA	NA	NA
>prophage 10
NZ_CP017124	Lactobacillus curvatus strain WiKim38 chromosome, complete genome	1940170	1476697	1564679	1940170	integrase,head,tail,transposase,holin,tRNA,capsid,terminase,portal	Lactobacillus_phage(27.27%)	87	1487914:1487973	1552778:1552853
WP_004270256.1|1476697_1477207_-|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
WP_039099473.1|1477460_1478294_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_039099474.1|1478505_1479462_+	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_069468361.1|1479657_1480635_+	GMP reductase	NA	G3MBI2	Bacillus_virus	75.8	1.6e-141
WP_035186296.1|1480805_1481237_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_039099476.1|1481283_1482429_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_069468362.1|1482446_1482836_-	PTS sorbitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_069468363.1|1482984_1484010_+	lactonase family protein	NA	NA	NA	NA	NA
WP_064776947.1|1484044_1485514_-	MFS transporter	NA	NA	NA	NA	NA
WP_064776946.1|1485611_1486811_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	69.1	1.3e-148
WP_069468364.1|1486992_1487703_+	hypothetical protein	NA	NA	NA	NA	NA
1487914:1487973	attL	AATGACCCGTACGGGATTTGAACCCATGATACCGCCGTGAAAGGGCGGTGTCTTAACCAC	NA	NA	NA	NA
WP_069468365.1|1493455_1493893_-	transcriptional repressor	NA	NA	NA	NA	NA
WP_069468366.1|1494030_1496088_-	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	47.8	4.5e-154
WP_069468367.1|1496305_1496539_-	YkuJ family protein	NA	NA	NA	NA	NA
WP_069468368.1|1496610_1497489_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	29.0	1.0e-22
WP_004271175.1|1497501_1498518_-	flippase-like domain-containing protein	NA	NA	NA	NA	NA
WP_039099034.1|1498598_1499801_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_004271174.1|1500219_1500648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064776942.1|1501157_1501526_-	DUF1634 domain-containing protein	NA	NA	NA	NA	NA
WP_004270729.1|1501525_1502371_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_069468369.1|1502395_1503904_-	DUF438 domain-containing protein	NA	NA	NA	NA	NA
WP_069468370.1|1503896_1504130_-	DUF1858 domain-containing protein	NA	NA	NA	NA	NA
WP_069468371.1|1504150_1504894_-	3-oxoacyl-ACP reductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	32.2	6.8e-12
WP_039099039.1|1504893_1505118_-	DUF2829 domain-containing protein	NA	G3MBC9	Bacillus_virus	34.4	3.7e-06
WP_069468372.1|1505269_1505638_-	DUF956 family protein	NA	NA	NA	NA	NA
WP_004270733.1|1505858_1506770_-	PTS mannose/fructose/sorbose transporter family subunit IID	NA	NA	NA	NA	NA
WP_054644529.1|1506787_1507594_-	PTS mannose/fructose/sorbose transporter subunit IIC	NA	NA	NA	NA	NA
WP_039099045.1|1507623_1508604_-	PTS mannose transporter subunit IIAB	NA	NA	NA	NA	NA
WP_039099047.1|1508939_1510217_-	cation:dicarboxylase symporter family transporter	NA	NA	NA	NA	NA
WP_069468373.1|1510254_1510941_-	noncanonical pyrimidine nucleotidase, YjjG family	NA	NA	NA	NA	NA
WP_004270727.1|1510959_1511901_-	dihydroorotate oxidase	NA	A0A1V0SH91	Hokovirus	45.5	1.5e-64
WP_052202743.1|1512384_1513200_-	DUF916 and DUF3324 domain-containing protein	NA	NA	NA	NA	NA
WP_052202744.1|1513287_1514562_-	WxL domain-containing protein	NA	NA	NA	NA	NA
WP_004270734.1|1516126_1516495_-	reactive intermediate/imine deaminase	NA	NA	NA	NA	NA
WP_069468375.1|1516665_1517628_-	AEC family transporter	NA	NA	NA	NA	NA
WP_076786344.1|1517660_1519301_-	NAD-dependent malic enzyme	NA	NA	NA	NA	NA
WP_039099562.1|1519422_1520322_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_069468377.1|1521458_1522379_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	37.9	6.6e-49
WP_069468378.1|1522984_1523194_+	hypothetical protein	NA	R4IBK5	Listeria_phage	45.9	5.0e-05
WP_069468379.1|1523215_1524142_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0Y4R9	Lactobacillus_phage	44.5	1.6e-31
WP_069468380.1|1524128_1524512_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_081326612.1|1524575_1524707_-	XkdX family protein	NA	NA	NA	NA	NA
WP_069468381.1|1524708_1525023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069468382.1|1525036_1525480_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069468383.1|1525483_1525891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155760110.1|1525887_1526349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155760124.1|1526366_1527845_-|tail	phage tail protein	tail	A0A0M7RDS2	Lactobacillus_phage	49.2	5.6e-90
WP_069468386.1|1527837_1528692_-|tail	phage tail family protein	tail	A0A0M7RF73	Lactobacillus_phage	37.5	1.4e-45
WP_069468387.1|1528705_1532935_-	tape measure protein	NA	A0A2I6QR39	Streptococcus_phage	39.4	1.5e-103
WP_172821859.1|1532986_1533151_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069468388.1|1533183_1533603_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069468389.1|1533602_1534235_-|tail	phage tail protein	tail	O64291	Streptococcus_virus	55.2	7.2e-55
WP_069468390.1|1534247_1534616_-	DUF806 family protein	NA	Q38220	Leuconostoc_phage	35.0	1.2e-14
WP_069468391.1|1534615_1535029_-	HK97 gp10 family phage protein	NA	Q9MCK1	Streptococcus_virus	55.8	7.3e-32
WP_069468392.1|1535028_1535382_-|head	phage head closure protein	head	A0A286QPN9	Streptococcus_phage	38.9	1.2e-14
WP_069468393.1|1535365_1535650_-|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_069468394.1|1535713_1537396_-|capsid	phage major capsid protein	capsid	A0A2P0ZLF9	Lactobacillus_phage	40.6	2.3e-79
WP_069468395.1|1537395_1538484_-|portal	phage portal protein	portal	A0A0M9JJ63	Lactobacillus_phage	44.0	5.4e-74
WP_035147180.1|1538483_1538675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081326614.1|1538762_1540607_-|terminase	terminase large subunit	terminase	Q9AZM6	Lactococcus_phage	46.4	3.5e-150
WP_069468396.1|1540596_1541142_-|terminase	phage terminase small subunit P27 family	terminase	A0A0M7REI3	Lactobacillus_phage	42.0	5.5e-27
WP_069468397.1|1541263_1541539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069468398.1|1541538_1542027_-	hypothetical protein	NA	B8R694	Lactobacillus_phage	46.9	3.8e-27
WP_069468399.1|1542023_1542836_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069468400.1|1542840_1543068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069468401.1|1543301_1543619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155760112.1|1543620_1543797_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069468402.1|1543798_1544581_-	hypothetical protein	NA	I2E8X7	Clostridium_phage	42.4	6.0e-43
WP_035147163.1|1544802_1545054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035147161.1|1545053_1545461_-	ORF6C domain-containing protein	NA	S5MP04	Brevibacillus_phage	32.5	2.8e-07
WP_151388570.1|1545450_1546329_-	hypothetical protein	NA	A0A2P0VH66	Streptococcus_phage	30.4	6.6e-30
WP_035147158.1|1546285_1546489_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052039273.1|1546505_1546760_-	DUF771 domain-containing protein	NA	Q9T0Y9	Lactobacillus_phage	51.9	2.8e-18
WP_035147148.1|1547099_1547318_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035147145.1|1547343_1547553_-	DUF2829 domain-containing protein	NA	NA	NA	NA	NA
WP_155760113.1|1547616_1547787_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069468403.1|1547930_1548158_-	hypothetical protein	NA	B5WZL3	Staphylococcus_phage	41.3	3.1e-08
WP_155760114.1|1548310_1549021_+	helix-turn-helix domain-containing protein	NA	D7RWL5	Brochothrix_phage	45.8	3.0e-41
WP_069468405.1|1549020_1549584_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069468406.1|1549797_1550334_+	PH domain-containing protein	NA	Q4ZA70	Staphylococcus_virus	42.2	5.6e-32
WP_069468407.1|1550485_1551592_+|integrase	site-specific integrase	integrase	D6PSS4	Lactobacillus_phage	34.4	4.5e-60
WP_056966316.1|1559845_1560232_-	hypothetical protein	NA	NA	NA	NA	NA
1552778:1552853	attR	AATGACCCGTACGGGATTTGAACCCATGATACCGCCGTGAAAGGGCGGTGTCTTAACCACTTGACCAACGGGCCAT	NA	NA	NA	NA
WP_004270515.1|1560228_1560609_-	S1 RNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_069468408.1|1560750_1561614_-	ROK family protein	NA	NA	NA	NA	NA
WP_039099273.1|1561637_1562222_-	peptidylprolyl isomerase	NA	A0A1V0S9I2	Catovirus	42.8	1.3e-26
WP_039099272.1|1562365_1563352_+	NAD(P)/FAD-dependent oxidoreductase	NA	Q9JRK7	Streptococcus_phage	45.2	3.1e-20
WP_069468409.1|1563749_1564679_+|transposase	IS30-like element ISLpl1 family transposase	transposase	H7BW47	unidentified_phage	34.4	2.3e-25
>prophage 11
NZ_CP017124	Lactobacillus curvatus strain WiKim38 chromosome, complete genome	1940170	1691207	1763827	1940170	transposase,tRNA	Bacillus_phage(20.0%)	58	NA	NA
WP_069468443.1|1691207_1692980_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_080752751.1|1693638_1694877_-	NupC/NupG family nucleoside CNT transporter	NA	NA	NA	NA	NA
WP_081303817.1|1695055_1696264_-	LCP family protein	NA	NA	NA	NA	NA
WP_069468444.1|1696460_1698269_+	oligoendopeptidase F	NA	NA	NA	NA	NA
WP_039098355.1|1698309_1699086_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_004265149.1|1699120_1699801_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	28.5	1.2e-15
WP_039098315.1|1699797_1700685_-	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_039098314.1|1700958_1701537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065825206.1|1701642_1703184_-	UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2, 6-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_081326618.1|1703314_1704637_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	25.7	1.5e-17
WP_039098312.1|1704641_1705847_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	26.3	4.3e-24
WP_004265073.1|1705846_1706533_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	37.4	3.3e-37
WP_069468445.1|1706706_1708188_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	40.8	1.2e-95
WP_069468446.1|1708437_1709235_+	tyrosine-protein phosphatase	NA	NA	NA	NA	NA
WP_069468447.1|1709319_1710279_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_069468448.1|1710278_1711358_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_064776878.1|1711354_1712878_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.6	1.5e-13
WP_064776877.1|1712952_1713975_-	BMP family protein	NA	A0A0A7DN02	Lactobacillus_phage	40.5	6.2e-56
WP_069468449.1|1714149_1715091_+	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_069468450.1|1715305_1717357_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_069468451.1|1717408_1719202_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.0	2.3e-53
WP_069468452.1|1719205_1720918_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	25.1	2.3e-34
WP_039098300.1|1721059_1721728_+	TetR/AcrR family transcriptional regulator C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_039098299.1|1722310_1722580_-	30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_004270471.1|1722972_1723506_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_064776872.1|1723737_1725234_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	22.1	1.1e-05
WP_069468453.1|1725308_1725776_+	DUF2798 domain-containing protein	NA	NA	NA	NA	NA
WP_064776870.1|1726846_1727782_-	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_004270447.1|1727890_1728205_+	membrane protein	NA	NA	NA	NA	NA
WP_004270462.1|1728408_1728972_-	elongation factor P	NA	NA	NA	NA	NA
WP_069468454.1|1729059_1729851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069468455.1|1730011_1731076_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064776867.1|1731079_1731826_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_054644234.1|1732064_1732499_-	universal stress protein	NA	NA	NA	NA	NA
WP_065825195.1|1732514_1734083_-	Nramp family divalent metal transporter	NA	NA	NA	NA	NA
WP_039098996.1|1734262_1734835_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_064776865.1|1734909_1735521_-	LysE family transporter	NA	NA	NA	NA	NA
WP_069468456.1|1735567_1736239_-	DUF1275 domain-containing protein	NA	NA	NA	NA	NA
WP_069468457.1|1736499_1737420_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	37.6	1.1e-48
WP_069468458.1|1737587_1738790_-	CHAP domain-containing protein	NA	NA	NA	NA	NA
WP_069468273.1|1738913_1739843_-|transposase	IS30-like element ISLpl1 family transposase	transposase	H7BVY4	unidentified_phage	30.1	3.9e-25
WP_146955176.1|1740832_1741255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146955175.1|1741308_1742377_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	34.5	2.4e-26
WP_064776861.1|1743183_1743678_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107504430.1|1744442_1744511_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172821869.1|1747378_1747894_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_069468462.1|1748377_1749238_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	44.5	3.3e-58
WP_039098944.1|1749706_1751401_+	oleate hydratase	NA	NA	NA	NA	NA
WP_069468463.1|1751551_1751920_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069468464.1|1752969_1755501_-	M1 family metallopeptidase	NA	A0A0P0IY26	Acinetobacter_phage	25.5	1.7e-62
WP_004271050.1|1757225_1757972_-	SDR family oxidoreductase	NA	A0A2P0VP75	Tetraselmis_virus	28.2	9.9e-11
WP_081326619.1|1757973_1758156_-	maltose O-acetyltransferase	NA	NA	NA	NA	NA
WP_069468466.1|1758336_1759569_+	ArgE/DapE family deacylase	NA	NA	NA	NA	NA
WP_035186853.1|1759660_1759978_-	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	37.6	2.6e-13
WP_056967097.1|1760077_1760740_-	metalloregulator ArsR/SmtB family transcription factor	NA	NA	NA	NA	NA
WP_064776729.1|1761299_1761563_+|transposase	IS3 family transposase	transposase	Q6J1X3	Lactobacillus_phage	93.3	2.7e-32
WP_064776728.1|1761603_1762446_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	98.2	6.3e-155
WP_069468468.1|1762906_1763827_+|transposase	IS30-like element ISLsa1 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	37.5	1.7e-49
