The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP017247	Bacillus licheniformis strain BL1202, complete genome	4422181	633304	684568	4422181	integrase,transposase,protease,holin,portal,tail,terminase,head,capsid,tRNA	Bacillus_phage(32.5%)	69	643554:643571	681008:681025
WP_003179225.1|633304_633781_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_003179227.1|633761_634451_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_003179229.1|634463_634922_+	ribosomal-protein-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_003179232.1|634911_635937_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	42.5	2.1e-67
WP_003179233.1|636176_638102_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	32.3	4.2e-61
WP_069500255.1|638248_638755_+	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_003179237.1|638758_639406_+	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_003179239.1|639448_639628_+	twin-arginine translocase TatA/TatE family subunit	NA	NA	NA	NA	NA
WP_011201569.1|639634_640411_+	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	28.7	5.3e-15
WP_003179243.1|640456_640651_-	YdiK family protein	NA	NA	NA	NA	NA
WP_003179245.1|640647_641382_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003179248.1|641607_641892_+	co-chaperone GroES	NA	A0A221S3C8	uncultured_virus	52.7	2.9e-19
WP_003179250.1|641936_643571_+	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	57.7	2.1e-159
643554:643571	attL	ATGGGCGGCATGATGTAA	NA	NA	NA	NA
WP_009330104.1|643652_644870_-|integrase	site-specific integrase	integrase	A0A0C5AN64	Paenibacillus_phage	64.9	3.0e-142
WP_017475026.1|644883_645513_-	helix-turn-helix domain-containing protein	NA	A0A1B2APZ3	Phage_Wrath	52.9	1.1e-60
WP_017475025.1|645657_645849_+	helix-turn-helix transcriptional regulator	NA	A0A2H4JBA4	uncultured_Caudovirales_phage	48.3	4.0e-09
WP_017475024.1|645893_646085_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_017475023.1|646107_646317_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017475022.1|646293_646536_-	hypothetical protein	NA	A7TWL9	Staphylococcus_phage	48.0	3.6e-15
WP_069500256.1|646606_647311_+	Rha family transcriptional regulator	NA	A0A0S2MVD8	Bacillus_phage	67.5	1.6e-82
WP_069500902.1|647401_647629_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081329446.1|647625_648036_-	DUF2513 domain-containing protein	NA	A0A2I7SCV0	Paenibacillus_phage	36.2	3.5e-18
WP_069500258.1|648060_648642_+	hypothetical protein	NA	A0A2H4J8I5	uncultured_Caudovirales_phage	43.9	2.2e-29
WP_069500259.1|648638_648914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069500260.1|648900_649299_-	hypothetical protein	NA	R9VW35	Paenibacillus_phage	34.6	7.4e-05
WP_025807801.1|649350_649569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017475008.1|649670_649889_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069500261.1|649881_650757_+	replication protein	NA	V9QKF6	Oenococcus_phage	43.8	1.2e-47
WP_048350368.1|650740_651574_+	ATP-binding protein	NA	Q2I8C8	Bacillus_phage	37.4	8.4e-35
WP_069500262.1|651897_652446_+	hypothetical protein	NA	A0A0K2CNP4	Brevibacillus_phage	43.3	3.1e-09
WP_113742868.1|652550_652700_+	BH0509 family protein	NA	NA	NA	NA	NA
WP_043054206.1|652771_652972_+	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	50.0	3.6e-08
WP_050821106.1|653007_653241_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069500263.1|653389_653638_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069500264.1|653920_654361_+	ArpU family transcriptional regulator	NA	S6AVV9	Thermus_phage	51.8	8.1e-37
WP_043054216.1|654360_654903_+|integrase	site-specific integrase	integrase	D2XR58	Bacillus_phage	60.6	4.3e-56
WP_069500265.1|655383_656244_+	hypothetical protein	NA	A0A0S2GLF7	Bacillus_phage	33.3	4.7e-41
WP_069500266.1|656326_656509_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069500267.1|656779_657010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081329447.1|656999_657284_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069500268.1|657286_657490_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069500269.1|657486_657858_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_145644039.1|657935_658340_+|terminase	P27 family phage terminase small subunit	terminase	A0A1C8E969	Bacillus_phage	44.9	9.4e-24
WP_069500904.1|658384_660091_+|terminase	terminase large subunit	terminase	A0A1B0T685	Bacillus_phage	56.9	1.2e-189
WP_081329448.1|660103_661282_+|portal	phage portal protein	portal	A0A1B2APW5	Phage_Wrath	53.2	8.9e-107
WP_043054112.1|661274_661865_+|head,protease	HK97 family phage prohead protease	head,protease	A0A1B2APW1	Phage_Wrath	56.9	4.8e-53
WP_069500272.1|661861_663160_+|capsid	phage major capsid protein	capsid	A0A1C8E976	Bacillus_phage	54.8	1.1e-89
WP_069500273.1|663137_663428_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1C8E967	Bacillus_phage	43.7	1.2e-15
WP_145644033.1|663384_663747_+|head	phage head closure protein	head	A0A1W6JP44	Morganella_phage	32.7	2.3e-05
WP_069500275.1|663724_664138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046129167.1|664134_664515_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_043054117.1|664514_665147_+	hypothetical protein	NA	A0A2H4J8F3	uncultured_Caudovirales_phage	31.5	4.9e-19
WP_043054118.1|665146_665509_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069500276.1|665712_666672_+	hypothetical protein	NA	Q6VY42	Streptomyces_phage	29.9	1.5e-11
WP_069500277.1|666668_670031_+	transglycosylase SLT domain-containing protein	NA	A0A1L2JY60	Aeribacillus_phage	44.1	6.8e-67
WP_069500278.1|670027_670855_+|tail	phage tail family protein	tail	M4ZS20	Bacillus_phage	37.8	7.8e-41
WP_069500279.1|670868_672755_+	autolysin	NA	D6R400	Bacillus_phage	31.2	3.8e-67
WP_073358672.1|674265_674820_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069500281.1|674840_676280_+	DUF2479 domain-containing protein	NA	M4ZRP1	Bacillus_phage	58.5	7.8e-97
WP_069500282.1|676292_676616_+	bZIP transcription factor	NA	M4ZR44	Bacillus_phage	47.4	2.0e-13
WP_003185324.1|676612_676798_+	XkdX family protein	NA	NA	NA	NA	NA
WP_009329192.1|676860_677130_+	protein xhlA	NA	A0A2H4JD40	uncultured_Caudovirales_phage	58.4	1.4e-20
WP_009329191.1|677145_677409_+|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	74.7	1.5e-30
WP_069500283.1|677461_678541_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1P8CWN6	Bacillus_phage	53.3	1.0e-45
WP_016886588.1|678574_678910_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069500284.1|678927_680451_-|transposase	transposase	transposase	A0A1L2JY53	Aeribacillus_phage	36.6	1.2e-07
WP_016886315.1|681171_682602_+|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	49.7	5.9e-121
681008:681025	attR	ATGGGCGGCATGATGTAA	NA	NA	NA	NA
WP_016886221.1|682646_682787_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085959889.1|683405_684568_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	44.2	1.5e-34
>prophage 2
NZ_CP017247	Bacillus licheniformis strain BL1202, complete genome	4422181	755738	765662	4422181		Synechococcus_phage(50.0%)	9	NA	NA
WP_017474622.1|755738_757034_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	27.1	4.5e-19
WP_003179531.1|757108_757825_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3G7P8	Synechococcus_phage	42.4	2.4e-46
WP_003179532.1|757826_758081_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	M4QPE7	Synechococcus_phage	33.3	8.0e-05
WP_003179533.1|758077_758761_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_009329142.1|758744_760973_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	41.5	3.2e-158
WP_003179536.1|760948_762379_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.9	4.5e-52
WP_011197613.1|762502_763543_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	46.3	2.7e-62
WP_003179538.1|763539_764127_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	41.1	1.4e-28
WP_003179539.1|764123_765662_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	52.0	4.3e-77
>prophage 3
NZ_CP017247	Bacillus licheniformis strain BL1202, complete genome	4422181	974816	1012523	4422181	integrase	Bacillus_phage(50.0%)	54	960185:960199	993933:993947
960185:960199	attL	TCAAAGCGGAAATCG	NA	NA	NA	NA
WP_069500314.1|974816_975776_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A142F1N9	Bacillus_phage	50.3	3.3e-83
WP_069500315.1|975993_976848_+	hypothetical protein	NA	A0A1P8CWU6	Bacillus_phage	41.4	1.1e-42
WP_046132612.1|976861_977353_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069500316.1|977349_977784_+	helix-turn-helix domain-containing protein	NA	A0A2H4IZR0	uncultured_Caudovirales_phage	61.1	1.4e-36
WP_155759041.1|978197_978341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069500318.1|978327_978657_+	hypothetical protein	NA	A0A0N9SHL8	Paenibacillus_phage	35.7	1.9e-06
WP_069500320.1|978852_979188_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069500321.1|979184_979433_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155759044.1|979429_979603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069500322.1|979603_979930_+	hypothetical protein	NA	R4JGJ3	Bacillus_phage	38.5	9.0e-09
WP_069500323.1|979929_980334_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069500324.1|980323_980752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069500325.1|980735_981119_+	hypothetical protein	NA	A0A2H4J134	uncultured_Caudovirales_phage	40.7	3.5e-20
WP_026699286.1|981135_981513_+	hypothetical protein	NA	R4JDR8	Bacillus_phage	96.0	2.0e-68
WP_026699287.1|981505_982618_+	hypothetical protein	NA	R4JEY6	Bacillus_phage	58.4	2.2e-107
WP_069500326.1|982779_983607_+	DNA replication protein	NA	A0A0N7GFF0	Paenibacillus_phage	53.8	1.1e-74
WP_029326999.1|983606_983975_+	DUF2493 domain-containing protein	NA	F1D2S8	Vibrio_phage	59.1	8.2e-35
WP_069500327.1|983971_984472_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069500329.1|984671_986021_+	AAA family ATPase	NA	A0A2H4IZL9	uncultured_Caudovirales_phage	52.9	9.8e-126
WP_069500330.1|986042_987056_+	DNA primase	NA	A0A2H4J6E6	uncultured_Caudovirales_phage	46.9	1.6e-75
WP_046132596.1|987150_987618_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2I7SC21	Paenibacillus_phage	56.8	3.0e-42
WP_046132595.1|987623_987953_-	helix-turn-helix transcriptional regulator	NA	Q8W5Y0	Listeria_phage	61.7	3.9e-28
WP_046132594.1|988292_988820_+	hypothetical protein	NA	A0A2H4J6V7	uncultured_Caudovirales_phage	30.9	1.5e-13
WP_069500331.1|989110_989635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017474282.1|989883_990639_+	hypothetical protein	NA	A0A0N9SJW5	Paenibacillus_phage	49.8	1.1e-52
WP_016885241.1|990662_991097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069500332.1|992893_995152_+	DNA polymerase I	NA	A0A2H4J6W7	uncultured_Caudovirales_phage	49.3	9.5e-174
993933:993947	attR	TCAAAGCGGAAATCG	NA	NA	NA	NA
WP_065643764.1|995152_995449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069500333.1|995445_996489_+	hypothetical protein	NA	A0A0N9SHN6	Paenibacillus_phage	54.8	2.1e-83
WP_069500334.1|996481_997039_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069500335.1|997044_997410_+	hypothetical protein	NA	A0A218KDD8	Bacillus_phage	39.3	3.9e-13
WP_069500336.1|997413_997644_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069500337.1|997636_997906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069500338.1|997902_998103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025810942.1|998242_998605_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	54.9	1.8e-26
WP_069500339.1|998611_999334_+	ribonucleotide-diphosphate reductase subunit alpha	NA	S6B1K0	Bacillus_phage	79.6	1.4e-107
WP_069500340.1|999431_1000115_+	HNH endonuclease	NA	L0LCB9	Bacillus_phage	60.5	1.2e-50
WP_069500341.1|1001668_1002637_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	F8WQ21	Bacillus_phage	80.3	1.6e-149
WP_069500342.1|1002687_1003242_+	deoxyuridine 5'-triphosphate nucleotidohydrolase	NA	D2XR49	Bacillus_phage	55.8	2.5e-43
WP_048354323.1|1003241_1003469_+	hypothetical protein	NA	A0A1P8CX04	Bacillus_phage	78.2	6.0e-20
WP_069500343.1|1003469_1004294_+	FAD-dependent thymidylate synthase	NA	A0A142F1S2	Bacillus_phage	67.3	2.1e-86
WP_069500344.1|1004263_1004842_+	hypothetical protein	NA	A0A127AW72	Bacillus_phage	49.5	1.1e-12
WP_081329452.1|1004765_1005593_+	hypothetical protein	NA	A0A2H4J6F5	uncultured_Caudovirales_phage	39.6	1.7e-19
WP_069500346.1|1005594_1006464_+	hypothetical protein	NA	A0A1P8CWY7	Bacillus_phage	40.1	8.0e-20
WP_069500908.1|1006472_1007024_+	hypothetical protein	NA	J9Q953	Bacillus_phage	36.0	2.9e-23
WP_069500347.1|1007012_1007399_-	hypothetical protein	NA	A0A0N9SHP7	Paenibacillus_phage	37.0	2.0e-07
WP_035333890.1|1007474_1007903_+	DUF134 domain-containing protein	NA	A0A0N9RZI0	Paenibacillus_phage	42.5	5.3e-17
WP_069500348.1|1007895_1008384_+	hypothetical protein	NA	A0A2H4J2L4	uncultured_Caudovirales_phage	40.1	2.9e-19
WP_069500349.1|1008472_1009273_+	hypothetical protein	NA	A0A0N9S810	Paenibacillus_phage	54.4	1.1e-71
WP_011197895.1|1009306_1009639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003181116.1|1009650_1011090_-	lipase	NA	NA	NA	NA	NA
WP_003181118.1|1011147_1011462_+	DUF1433 domain-containing protein	NA	NA	NA	NA	NA
WP_003181120.1|1011493_1011667_-	hypothetical protein	NA	A0A1P8CWV7	Bacillus_phage	89.1	4.0e-24
WP_016885211.1|1011713_1012523_-	ATP-dependent DNA ligase	NA	O64130	Bacillus_phage	61.3	2.6e-97
>prophage 4
NZ_CP017247	Bacillus licheniformis strain BL1202, complete genome	4422181	1017747	1075110	4422181	plate,transposase,protease,holin,portal,tail,terminase,head,capsid,tRNA	Bacillus_phage(50.0%)	60	NA	NA
WP_026699326.1|1017747_1018086_+	HNH endonuclease	NA	A0A0K2CZH3	Paenibacillus_phage	57.8	1.3e-13
WP_011197905.1|1018205_1018529_+|terminase	P27 family phage terminase small subunit	terminase	A0A0K2CZN8	Paenibacillus_phage	69.8	6.8e-33
WP_069500354.1|1018503_1020285_+|terminase	terminase large subunit	terminase	A0A1B1P7R3	Bacillus_phage	67.3	1.1e-246
WP_069500355.1|1020296_1021595_+|portal	phage portal protein	portal	A0A0U3SQF0	Bacillus_phage	44.2	5.6e-86
WP_069500356.1|1021548_1022295_+|protease	Clp protease ClpP	protease	A0A0K2CYC6	Paenibacillus_phage	49.6	2.4e-57
WP_017474201.1|1022294_1023449_+|capsid	phage major capsid protein	capsid	A0A1B1P7R4	Bacillus_phage	61.6	4.9e-126
WP_069500357.1|1023489_1023987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011197911.1|1023989_1024229_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0C5ABB4	Paenibacillus_phage	43.8	7.8e-10
WP_011197912.1|1024233_1024569_+|head	phage head closure protein	head	A0A2I7SC03	Paenibacillus_phage	50.5	3.3e-22
WP_069500358.1|1024565_1024988_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011197913.1|1024984_1025329_+	hypothetical protein	NA	A0A0S2SY15	Bacillus_phage	40.9	1.0e-15
WP_011197914.1|1025337_1025919_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_075876042.1|1025869_1026184_+	fibronectin type III domain-containing protein	NA	Q0PDK9	Bacillus_phage	64.6	2.1e-23
WP_011197916.1|1026235_1026571_+	hypothetical protein	NA	H0USX2	Bacillus_phage	40.7	1.2e-11
WP_069500359.1|1026813_1032114_+|tail	phage tail tape measure protein	tail	A0A288WG88	Bacillus_phage	42.6	8.1e-99
WP_069500360.1|1032114_1032936_+|tail	phage tail family protein	tail	A6M962	Geobacillus_virus	48.5	1.5e-65
WP_069500361.1|1032945_1034472_+	hypothetical protein	NA	A6M966	Geobacillus_virus	36.3	8.4e-49
WP_075876117.1|1035990_1036563_+	hypothetical protein	NA	A0A2I7S7J8	Vibrio_phage	47.0	1.5e-06
WP_081329468.1|1036619_1037807_+|plate	phage baseplate upper protein	plate	M4ZRP1	Bacillus_phage	73.7	1.6e-159
WP_054287416.1|1037822_1038116_+	hypothetical protein	NA	M4ZR44	Bacillus_phage	76.0	7.5e-39
WP_003181188.1|1038116_1038311_+	XkdX family protein	NA	NA	NA	NA	NA
WP_011197923.1|1038314_1038518_+	hypothetical protein	NA	A0A290GDY2	Caldibacillus_phage	47.9	1.1e-09
WP_069500363.1|1038587_1039580_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A218KC88	Bacillus_phage	72.4	4.8e-69
WP_003181194.1|1039600_1039831_+|holin	phage holin	holin	A0A1D6Z272	Staphylococcus_phage	59.2	1.1e-18
WP_021837437.1|1040073_1040343_+	hypothetical protein	NA	U5PSW1	Bacillus_phage	72.5	4.3e-09
WP_080666355.1|1040332_1040911_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016885193.1|1041560_1041827_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069500364.1|1041847_1043362_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_016885191.1|1043425_1043641_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_069500365.1|1043800_1044619_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_069500366.1|1044691_1045021_+	YolD-like family protein	NA	O64030	Bacillus_phage	34.6	2.2e-07
WP_009329010.1|1045736_1046777_+	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	27.1	1.3e-37
WP_003179971.1|1047897_1048107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003179974.1|1049310_1049526_+	hypothetical protein	NA	D6R3Y4	Bacillus_phage	73.5	7.9e-22
WP_011201594.1|1049519_1049870_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A2H4J4U2	uncultured_Caudovirales_phage	57.1	4.8e-08
WP_069500368.1|1049928_1050267_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003179977.1|1050292_1052017_-|transposase	transposase	transposase	A0A1L2JY53	Aeribacillus_phage	33.6	8.4e-05
WP_100224395.1|1052291_1052579_+	DUF3800 domain-containing protein	NA	Q71TB8	Escherichia_phage	47.8	6.4e-19
WP_009329006.1|1052809_1053250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003179978.1|1055150_1056269_+	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	33.0	3.1e-48
WP_069500369.1|1057061_1058387_+	TGS domain-containing protein	NA	NA	NA	NA	NA
WP_003179982.1|1058633_1058852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003179983.1|1059239_1060004_+	type I 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_069500370.1|1060409_1062185_+	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_025807987.1|1062387_1063155_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.6	1.5e-30
WP_016886186.1|1063151_1064165_+	aliphatic sulfonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003179993.1|1064161_1064998_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003179995.1|1065011_1066142_+	FMNH2-dependent alkanesulfonate monooxygenase	NA	NA	NA	NA	NA
WP_003179997.1|1066172_1066631_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003179999.1|1066627_1066834_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003180000.1|1067383_1067596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003180002.1|1067703_1068450_+	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	23.8	3.2e-09
WP_011201596.1|1068415_1069885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009328999.1|1069874_1070783_+	PqqD family protein	NA	NA	NA	NA	NA
WP_011197680.1|1070779_1071064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003180010.1|1071171_1071441_+	30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_009328997.1|1071765_1072395_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003180014.1|1072475_1073624_+|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_009328996.1|1073687_1074593_+	amidase domain-containing protein	NA	NA	NA	NA	NA
WP_085960399.1|1074627_1075110_+|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
>prophage 5
NZ_CP017247	Bacillus licheniformis strain BL1202, complete genome	4422181	1400479	1488205	4422181	plate,transposase,coat,holin,portal,tail,terminase	Bacillus_phage(26.32%)	100	NA	NA
WP_009328811.1|1400479_1400929_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_011197778.1|1401079_1401568_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_009328809.1|1401699_1402212_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_009328808.1|1402282_1402681_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009328807.1|1402729_1403116_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_011197779.1|1403262_1403619_+	DUF1360 domain-containing protein	NA	NA	NA	NA	NA
WP_009328806.1|1403905_1404115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011197781.1|1404194_1404326_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_009328805.1|1404455_1404713_+	sporulation protein	NA	NA	NA	NA	NA
WP_069500403.1|1404751_1407034_-	ATP-dependent helicase	NA	A0A068EQC7	Bacillus_phage	35.6	7.8e-91
WP_016885900.1|1407155_1407413_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009328801.1|1407452_1408040_-	DedA family protein	NA	NA	NA	NA	NA
WP_061576213.1|1408135_1409122_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	38.4	2.1e-53
WP_009328799.1|1409118_1410009_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	55.6	1.2e-84
WP_011197785.1|1410031_1410427_-	GtrA family protein	NA	NA	NA	NA	NA
WP_009328797.1|1410591_1411011_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_009328796.1|1411020_1411530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069500404.1|1411560_1412316_-	esterase family protein	NA	NA	NA	NA	NA
WP_011197786.1|1412306_1412639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011197787.1|1412832_1413321_-	DNA damage-inducible protein DinB	NA	NA	NA	NA	NA
WP_009328787.1|1413401_1414349_-	YafY family transcriptional regulator	NA	NA	NA	NA	NA
WP_009328785.1|1414657_1415782_+	methionine biosynthesis PLP-dependent protein	NA	A0A0B5JD48	Pandoravirus	25.6	5.3e-16
WP_009328782.1|1415771_1416947_+	cystathionine beta-lyase	NA	A0A0B5JD48	Pandoravirus	29.3	6.7e-22
WP_011197789.1|1416992_1418183_-	DUF819 domain-containing protein	NA	NA	NA	NA	NA
WP_009328776.1|1418355_1418925_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_009328774.1|1418914_1419199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155266214.1|1420796_1420958_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025808333.1|1421039_1422026_-	family 43 glycosylhydrolase	NA	NA	NA	NA	NA
WP_016885898.1|1422628_1422712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003180752.1|1423150_1423330_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069500405.1|1423363_1423942_+	acetyltransferase	NA	NA	NA	NA	NA
WP_069500909.1|1424033_1424321_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003180759.1|1424528_1425419_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_069500406.1|1425739_1427569_+	assimilatory sulfite reductase (NADPH) flavoprotein subunit	NA	NA	NA	NA	NA
WP_003180762.1|1427596_1429315_+	assimilatory sulfite reductase (NADPH) hemoprotein subunit	NA	NA	NA	NA	NA
WP_003180765.1|1429372_1430260_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003180767.1|1430352_1431225_+	DMT family transporter	NA	NA	NA	NA	NA
WP_003180768.1|1431272_1431650_+	glyoxalase	NA	NA	NA	NA	NA
WP_003180770.1|1431693_1432242_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003180772.1|1432694_1433429_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A217ER34	Bacillus_phage	60.8	4.2e-30
WP_069500407.1|1433484_1434909_-	DHA2 family efflux MFS transporter permease subunit	NA	A0A0M3UL24	Mycobacterium_phage	24.6	5.1e-16
WP_003180775.1|1434924_1435503_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003180778.1|1435515_1435851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003180779.1|1435879_1436293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003180781.1|1436667_1437150_-	DUF600 family protein	NA	NA	NA	NA	NA
WP_003180784.1|1439423_1440071_+	poly-gamma-glutamate hydrolase family protein	NA	A0A0Y0AJU6	Bacillus_phage	47.5	4.1e-45
WP_016885893.1|1440084_1440741_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	49.7	3.1e-40
WP_003180787.1|1440929_1441283_-	helix-turn-helix transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	49.6	2.7e-19
WP_021837294.1|1441455_1441716_+	helix-turn-helix transcriptional regulator	NA	S5MA07	Brevibacillus_phage	41.2	2.3e-07
WP_003180790.1|1441705_1442002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003180792.1|1442002_1442833_+	hypothetical protein	NA	S6BFM4	Thermus_phage	31.0	1.3e-27
WP_011197802.1|1442732_1443533_+	ATP-binding protein	NA	A6XMI1	Bacillus_virus	48.1	3.6e-59
WP_003180798.1|1443803_1444145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003180800.1|1444141_1444345_+	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	54.7	1.9e-12
WP_003180803.1|1444465_1444969_+	sigma-70 family RNA polymerase sigma factor	NA	A0A0K2CNQ1	Brevibacillus_phage	38.7	1.4e-21
WP_003180804.1|1445111_1445912_+|terminase	terminase	terminase	A0A0S2MVB6	Bacillus_phage	51.4	5.7e-65
WP_009328741.1|1445908_1447207_+|terminase	PBSX family phage terminase large subunit	terminase	M4ZRM5	Bacillus_phage	60.2	7.2e-150
WP_069500408.1|1447210_1448725_+|portal	phage portal protein	portal	A0A1B1P7C8	Bacillus_phage	55.5	4.5e-143
WP_009328740.1|1448732_1449581_+|portal	phage portal protein	portal	A0A1B1P7E4	Bacillus_phage	62.8	2.1e-57
WP_009328739.1|1449598_1450534_+|portal	phage portal protein	portal	A0A1B1P7E3	Bacillus_phage	64.1	1.1e-102
WP_129093899.1|1450621_1451002_+	DUF3199 family protein	NA	NA	NA	NA	NA
WP_069500410.1|1450998_1451355_+	DUF3599 family protein	NA	NA	NA	NA	NA
WP_003180822.1|1451351_1451840_+	HK97 gp10 family phage protein	NA	A0A249XXA4	Clostridium_phage	44.6	1.9e-34
WP_003180824.1|1451852_1452293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003180826.1|1452293_1452518_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011197804.1|1452517_1453864_+|portal	phage portal protein	portal	S5MNC1	Brevibacillus_phage	40.2	1.5e-78
WP_003180830.1|1453865_1454309_+|tail	phage tail tube protein	tail	A0A0K2CNG3	Brevibacillus_phage	44.7	2.1e-24
WP_003180832.1|1454491_1454941_+|portal	phage portal protein	portal	A0A0A7RTY8	Clostridium_phage	38.7	4.1e-12
WP_003180833.1|1454982_1455120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011197805.1|1455123_1458906_+	transglycosylase SLT domain-containing protein	NA	A0A1L2JY60	Aeribacillus_phage	45.3	1.7e-42
WP_003180838.1|1458898_1459555_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A090DBR9	Clostridium_phage	32.6	4.0e-24
WP_009328734.1|1459611_1460592_+	hypothetical protein	NA	H7BV96	unidentified_phage	32.3	9.2e-41
WP_003180843.1|1460588_1460897_+	DUF2577 domain-containing protein	NA	S6C459	Thermus_phage	37.3	1.0e-06
WP_003180844.1|1460915_1461341_+	DUF2634 domain-containing protein	NA	A0A2H4J6K5	uncultured_Caudovirales_phage	39.0	5.4e-14
WP_009328732.1|1461333_1462377_+|plate	baseplate J/gp47 family protein	plate	S6AVU3	Thermus_phage	44.3	9.7e-73
WP_009328731.1|1462363_1463284_+	YmfQ family protein	NA	A0A0A7RTT8	Clostridium_phage	28.3	5.0e-12
WP_003180850.1|1463297_1463684_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003180851.1|1463699_1464905_+	hypothetical protein	NA	A0A2H4J4R1	uncultured_Caudovirales_phage	48.3	9.3e-27
WP_003180853.1|1464942_1465974_+	hypothetical protein	NA	A0A1P8CWR7	Bacillus_phage	48.2	1.0e-18
WP_003180856.1|1466076_1466346_+	protein xhlA	NA	A0A2H4JD40	uncultured_Caudovirales_phage	64.0	1.6e-24
WP_003180859.1|1466360_1466624_+|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	67.8	5.3e-28
WP_003180863.1|1467840_1468518_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003180865.1|1468540_1469557_+	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_003180867.1|1469577_1470675_+	mannonate dehydratase	NA	NA	NA	NA	NA
WP_069500910.1|1470650_1471499_+	SDR family oxidoreductase	NA	M1NMS3	Moumouvirus	33.3	5.6e-10
WP_011197810.1|1471525_1472539_+	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_009328725.1|1472591_1473863_+	MFS transporter	NA	NA	NA	NA	NA
WP_003180877.1|1474152_1474326_-	type II toxin-antitoxin system SpoIISB family antitoxin	NA	NA	NA	NA	NA
WP_003180879.1|1474325_1475072_-	type II toxin-antitoxin system SpoIISA family toxin	NA	NA	NA	NA	NA
WP_009328723.1|1475182_1476181_-	inorganic phosphate transporter	NA	NA	NA	NA	NA
WP_003180884.1|1476193_1476811_-	DUF47 domain-containing protein	NA	NA	NA	NA	NA
WP_011197813.1|1477142_1478900_+	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_044790118.1|1479028_1479673_+	YesL family protein	NA	NA	NA	NA	NA
WP_044790117.1|1479686_1481423_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	26.7	1.4e-20
WP_016886672.1|1481422_1482592_+	response regulator	NA	NA	NA	NA	NA
WP_080624214.1|1482732_1484034_+	carbohydrate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_011197817.1|1484086_1484986_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_085959531.1|1485007_1485883_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_069500411.1|1485900_1486935_+	glycoside hydrolase family 105 protein	NA	NA	NA	NA	NA
WP_085959889.1|1487042_1488205_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	44.2	1.5e-34
>prophage 6
NZ_CP017247	Bacillus licheniformis strain BL1202, complete genome	4422181	1544354	1573510	4422181	integrase,portal,tail,terminase,head,capsid	Bacillus_phage(24.24%)	49	1538790:1538804	1579866:1579880
1538790:1538804	attL	TTGGATGGCCGCTTT	NA	NA	NA	NA
WP_069500419.1|1544354_1545494_-|integrase	site-specific integrase	integrase	S6C485	Thermus_phage	39.4	5.1e-67
WP_069500420.1|1545525_1546005_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	41.9	2.3e-29
WP_025805709.1|1546115_1546766_-	DUF4352 domain-containing protein	NA	A0A2H4PQN2	Staphylococcus_phage	48.9	1.7e-30
WP_069500421.1|1546845_1547112_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041817016.1|1547363_1547612_-	helix-turn-helix transcriptional regulator	NA	A0A0A7RTK4	Clostridium_phage	47.6	9.8e-08
WP_009328681.1|1547656_1548019_-	helix-turn-helix transcriptional regulator	NA	A0A0A7RTK4	Clostridium_phage	43.0	2.8e-11
WP_069500422.1|1548172_1548397_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_009328676.1|1548826_1549153_+	hypothetical protein	NA	S6C476	Thermus_phage	54.4	2.8e-18
WP_129093903.1|1549153_1549924_+	phage antirepressor Ant	NA	A0A290FZK7	Caldibacillus_phage	75.8	6.9e-108
WP_009328672.1|1549998_1550517_+	helix-turn-helix transcriptional regulator	NA	A0A290FZK9	Caldibacillus_phage	46.4	9.8e-34
WP_009328671.1|1550513_1550792_+	hypothetical protein	NA	Q9ZXC9	Bacillus_phage	51.7	5.1e-21
WP_069500423.1|1551164_1552103_+	hypothetical protein	NA	A6XMH8	Bacillus_virus	48.6	9.3e-83
WP_069500912.1|1552120_1552942_+	recombination protein RecT	NA	Q0H279	Geobacillus_phage	57.5	1.7e-80
WP_011197850.1|1553071_1553779_+	DnaD domain protein	NA	A0A1L2JY26	Aeribacillus_phage	36.8	2.8e-07
WP_011197851.1|1553648_1554629_+	ATP-binding protein	NA	A6XMI1	Bacillus_virus	50.6	2.6e-59
WP_069500424.1|1554723_1554927_+	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	57.6	1.7e-13
WP_069500425.1|1555104_1555323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081329469.1|1555396_1555606_+	IDEAL domain-containing protein	NA	NA	NA	NA	NA
WP_016885851.1|1555602_1555815_+	hypothetical protein	NA	U5PTT2	Bacillus_phage	60.0	3.6e-11
WP_061576061.1|1555989_1556445_+	hypothetical protein	NA	A0A1B1P7W5	Bacillus_phage	36.6	4.9e-05
WP_009328659.1|1556441_1556864_+	RusA family crossover junction endodeoxyribonuclease	NA	M4ZS69	Bacillus_phage	56.5	2.5e-35
WP_025807748.1|1556842_1557049_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025807746.1|1557106_1557418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069500426.1|1557421_1557850_+	single-stranded DNA-binding protein	NA	A8ATZ7	Listeria_phage	60.0	2.5e-43
WP_069500427.1|1557862_1558096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044790080.1|1558428_1558794_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021837344.1|1558796_1559315_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009328652.1|1559250_1559478_+	hypothetical protein	NA	A0A2H4JDM6	uncultured_Caudovirales_phage	66.7	4.0e-16
WP_069500429.1|1559641_1559959_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011197860.1|1559991_1560429_+	hypothetical protein	NA	A0A2H4J8A0	uncultured_Caudovirales_phage	75.0	1.3e-55
WP_069500430.1|1560464_1560881_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009328648.1|1561093_1561549_+	hypothetical protein	NA	A0A290FZR5	Caldibacillus_phage	60.4	5.6e-41
WP_009328647.1|1562595_1563303_+	hypothetical protein	NA	A0A2P1JTW4	Anoxybacillus_phage	64.3	2.3e-70
WP_069500431.1|1563299_1564577_+|terminase	PBSX family phage terminase large subunit	terminase	A0A2P1JTW5	Anoxybacillus_phage	69.8	8.9e-153
WP_061576058.1|1564573_1565989_+|portal	phage portal protein	portal	A0A2H4J4Q7	uncultured_Caudovirales_phage	60.3	3.2e-151
WP_025805727.1|1565972_1566890_+	hypothetical protein	NA	A0A1Q1PVS0	Bacillus_phage	54.7	1.5e-88
WP_069500432.1|1566891_1567215_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069500433.1|1567346_1568279_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009328641.1|1568518_1569100_+	DUF4355 domain-containing protein	NA	A0A2H4J4P4	uncultured_Caudovirales_phage	52.8	2.4e-49
WP_009328640.1|1569114_1570035_+|capsid	phage major capsid protein	capsid	A0A2H4JCG0	uncultured_Caudovirales_phage	64.6	2.0e-106
WP_069500434.1|1570038_1570377_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069500435.1|1570378_1570648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044822455.1|1570661_1570970_+	protein Gp15 of bacteriophage Spp1	NA	A0A1W6JQJ1	Staphylococcus_phage	40.2	6.7e-14
WP_069500436.1|1570969_1571311_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_011197875.1|1571310_1571715_+	HK97 gp10 family phage protein	NA	O48447	Bacillus_phage	61.7	2.7e-39
WP_009328634.1|1571711_1572125_+	DUF3168 domain-containing protein	NA	A0A0C5AEH4	Paenibacillus_phage	39.3	5.5e-11
WP_061576051.1|1572137_1572683_+|tail	phage major tail protein, TP901-1 family	tail	Q597U9	Lactobacillus_virus	32.0	2.7e-18
WP_075218724.1|1572573_1572945_+	fibronectin type III domain-containing protein	NA	Q0PDK9	Bacillus_phage	64.4	6.2e-22
WP_069500437.1|1573012_1573510_+	hypothetical protein	NA	O48453	Bacillus_phage	29.8	1.4e-05
1579866:1579880	attR	AAAGCGGCCATCCAA	NA	NA	NA	NA
>prophage 7
NZ_CP017247	Bacillus licheniformis strain BL1202, complete genome	4422181	2002980	2074981	4422181	transposase,coat,protease,holin,portal,tail,terminase,head,capsid,tRNA	Bacillus_phage(50.0%)	76	NA	NA
WP_003182046.1|2002980_2003925_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_003182047.1|2003966_2004188_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_073411143.1|2004214_2004424_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003182049.1|2004478_2004691_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011197997.1|2004940_2005336_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	G3MBF1	Bacillus_virus	55.7	2.5e-29
WP_003182052.1|2005292_2007395_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	U5PY35	Bacillus_phage	83.7	0.0e+00
WP_009328440.1|2007415_2008393_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	F8WQ21	Bacillus_phage	83.5	9.5e-155
WP_003182056.1|2008506_2009124_+	hypothetical protein	NA	A0A127AYS1	Bacillus_phage	45.1	7.3e-44
WP_003182059.1|2009141_2009942_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_021837478.1|2010137_2010569_+	SUF system NifU family Fe-S cluster assembly protein	NA	A0A218MKD1	uncultured_virus	40.5	1.5e-06
WP_080666359.1|2011133_2011838_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_021837480.1|2011845_2012814_+	multidrug resistance efflux transporter family protein	NA	NA	NA	NA	NA
WP_085959889.1|2012872_2014035_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	44.2	1.5e-34
WP_003182101.1|2014156_2014918_-	N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	50.4	1.9e-54
WP_003182102.1|2015450_2015933_-	DMT family transporter	NA	NA	NA	NA	NA
WP_003182104.1|2015955_2016408_-	DMT family transporter	NA	NA	NA	NA	NA
WP_069500483.1|2016507_2016747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003182112.1|2016935_2017139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009328434.1|2017351_2017975_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_009328433.1|2017977_2018364_+	OsmC family protein	NA	NA	NA	NA	NA
WP_021837481.1|2018396_2019746_+	cytosine permease	NA	NA	NA	NA	NA
WP_044789998.1|2019770_2021876_+	hydantoinase/oxoprolinase family protein	NA	NA	NA	NA	NA
WP_069500484.1|2021872_2023351_+	methylhydantoinase	NA	NA	NA	NA	NA
WP_021837484.1|2023347_2025087_+	hydantoinase B/oxoprolinase family protein	NA	NA	NA	NA	NA
WP_021837485.1|2025258_2025693_+	DUF2243 domain-containing protein	NA	NA	NA	NA	NA
WP_003182130.1|2026763_2027105_+	DUF4274 domain-containing protein	NA	NA	NA	NA	NA
WP_016885451.1|2027623_2027815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003182134.1|2028384_2029083_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003182136.1|2029497_2030463_+	stage V sporulation protein K	NA	G3MAX6	Bacillus_virus	43.3	4.2e-54
WP_069500485.1|2030560_2031823_+	GTPase HflX	NA	NA	NA	NA	NA
WP_003182139.1|2031841_2033107_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_003182143.1|2033209_2033617_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003182145.1|2033673_2035008_+	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_026587141.1|2036323_2036746_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0S2SXM3	Bacillus_phage	62.6	1.8e-46
WP_026587142.1|2036754_2037183_-	helix-turn-helix transcriptional regulator	NA	Q5YAA4	Bacillus_phage	66.7	3.2e-46
WP_026587143.1|2037451_2037637_+	helix-turn-helix transcriptional regulator	NA	A0A1C8E998	Bacillus_phage	70.5	1.5e-16
WP_061578517.1|2037642_2037912_+	group-specific protein	NA	A0A0S2SXU9	Bacillus_phage	56.2	1.1e-23
WP_009330095.1|2038035_2038302_+	hypothetical protein	NA	Q9ZXC9	Bacillus_phage	54.7	2.7e-19
WP_011198322.1|2038389_2038632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069500487.1|2038725_2039172_+	hypothetical protein	NA	S5M5X1	Brevibacillus_phage	39.9	6.1e-08
WP_069500490.1|2039171_2040344_+	DUF2800 domain-containing protein	NA	S5MUB5	Brevibacillus_phage	64.9	2.5e-141
WP_048355997.1|2040375_2040942_+	DUF2815 family protein	NA	S5MC21	Brevibacillus_phage	74.9	1.3e-74
WP_069500491.1|2041003_2041249_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069500492.1|2041254_2043198_+	DNA polymerase	NA	S5M5X4	Brevibacillus_phage	68.6	2.3e-261
WP_081329458.1|2043313_2045725_+	hypothetical protein	NA	A0A0A7RTG3	Clostridium_phage	57.9	9.8e-286
WP_069500915.1|2046013_2046298_+	VRR-NUC domain-containing protein	NA	S5MUC8	Brevibacillus_phage	57.8	2.9e-19
WP_069500496.1|2046287_2047643_+	DEAD/DEAH box helicase	NA	S5MA26	Brevibacillus_phage	65.9	5.5e-177
WP_069500497.1|2047639_2048020_+	ArpU family transcriptional regulator	NA	Q9ZXB9	Bacillus_phage	77.2	1.4e-45
WP_006637235.1|2048758_2048983_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_043054218.1|2049234_2049903_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080624192.1|2049978_2050287_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043054219.1|2050313_2050688_+	HNH endonuclease	NA	A0A1U7Q1S7	Geobacillus_virus	51.7	6.9e-29
WP_043054221.1|2051431_2053141_+|terminase	terminase large subunit	terminase	W8CZ43	Bacillus_phage	64.1	2.5e-211
WP_035316082.1|2053153_2053345_+	DUF1056 family protein	NA	NA	NA	NA	NA
WP_043054222.1|2053345_2054656_+|portal	phage portal protein	portal	D6R3Y6	Bacillus_phage	46.1	2.4e-105
WP_035338281.1|2054600_2055332_+|protease	Clp protease ClpP	protease	A0A0B5A796	Paenibacillus_phage	56.9	2.4e-57
WP_069500498.1|2055371_2056652_+|capsid	phage major capsid protein	capsid	A0A288WGE9	Bacillus_phage	43.5	8.3e-74
WP_052500260.1|2056675_2057119_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043054224.1|2057133_2057436_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0S2GLH6	Bacillus_phage	46.3	7.3e-13
WP_043054225.1|2057425_2057734_+|head	phage head closure protein	head	A0A2H4JCB1	uncultured_Caudovirales_phage	38.6	9.7e-13
WP_043054226.1|2057733_2058132_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069500499.1|2058128_2058512_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_043054228.1|2058526_2059144_+|tail	tail protein	tail	NA	NA	NA	NA
WP_043054229.1|2059197_2059563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069500501.1|2059771_2064241_+|tail	phage tail tape measure protein	tail	A6M961	Geobacillus_virus	42.4	1.8e-70
WP_069500502.1|2064240_2065077_+|tail	phage tail family protein	tail	D6R3Z9	Bacillus_phage	68.2	5.2e-109
WP_069500503.1|2065089_2066802_+	alkaline phosphatase	NA	D6R400	Bacillus_phage	66.1	4.3e-219
WP_069500504.1|2066838_2069484_+	peptidase G2	NA	D6R401	Bacillus_phage	56.7	9.1e-293
WP_095346019.1|2069500_2070847_+	DUF2479 domain-containing protein	NA	D6R402	Bacillus_phage	42.3	7.9e-67
WP_069500506.1|2070859_2071183_+	hypothetical protein	NA	Q9ZXE0	Bacillus_phage	37.9	5.8e-08
WP_039072971.1|2071179_2071362_+	XkdX family protein	NA	A0EWM9	Staphylococcus_virus	47.9	1.8e-06
WP_069500916.1|2071425_2071695_+	protein xhlA	NA	A0A2H4JD40	uncultured_Caudovirales_phage	61.8	9.6e-25
WP_069500507.1|2071710_2071974_+|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	77.0	7.9e-32
WP_069500508.1|2072021_2072975_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A141HSE6	Bacillus_phage	42.0	6.0e-61
WP_069500509.1|2073097_2073436_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069500511.1|2073451_2074981_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP017247	Bacillus licheniformis strain BL1202, complete genome	4422181	2533431	2545611	4422181		Staphylococcus_phage(55.56%)	15	NA	NA
WP_003183104.1|2533431_2534025_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	37.6	3.4e-14
WP_009327962.1|2534014_2534770_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	23.6	1.4e-07
WP_081329461.1|2534952_2535048_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_003183111.1|2535168_2535690_+	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_003183113.1|2535700_2536075_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003183115.1|2536176_2536641_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	70.7	1.7e-45
WP_025808100.1|2536675_2537872_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	53.9	3.7e-116
WP_003183118.1|2537893_2538541_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	41.5	7.4e-39
WP_011198083.1|2538552_2539641_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	38.1	5.1e-64
WP_003183123.1|2540001_2540346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069500591.1|2540608_2542795_-	AAA family ATPase	NA	A0A220BYT7	Staphylococcus_phage	41.2	7.1e-150
WP_003183127.1|2542921_2543359_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_003183128.1|2543517_2543823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026699173.1|2543812_2544943_-	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	44.4	6.2e-81
WP_003183133.1|2545173_2545611_-	peptidylprolyl isomerase	NA	A0A2H4UTF4	Bodo_saltans_virus	44.6	5.4e-17
>prophage 9
NZ_CP017247	Bacillus licheniformis strain BL1202, complete genome	4422181	2940253	3031539	4422181	plate,coat,protease,holin,portal,tail,terminase,head,capsid,tRNA	Bacillus_phage(79.59%)	101	NA	NA
WP_069500658.1|2940253_2941399_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	43.5	4.2e-85
WP_069500660.1|2941427_2942456_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_003183984.1|2942496_2942697_-	DUF2905 domain-containing protein	NA	NA	NA	NA	NA
WP_003183985.1|2942689_2943694_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	30.3	1.2e-06
WP_003183986.1|2943703_2944309_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_003183987.1|2944431_2944953_-	intercompartmental signaling factor BofC	NA	NA	NA	NA	NA
WP_003183988.1|2945195_2945846_+	serine/threonine protein kinase	NA	NA	NA	NA	NA
WP_003183990.1|2946123_2946303_-	small acid-soluble spore protein H	NA	NA	NA	NA	NA
WP_003183991.1|2946398_2946863_-	DNA damage-inducible protein DinB	NA	NA	NA	NA	NA
WP_003183992.1|2946923_2947634_-	poly-gamma-glutamate hydrolase family protein	NA	F8WQ53	Bacillus_phage	55.9	3.0e-49
WP_003183993.1|2948047_2948227_+	hypothetical protein	NA	A0A1P8CWV7	Bacillus_phage	76.3	1.5e-21
WP_003183994.1|2948318_2948645_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003183995.1|2948792_2949515_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_009327770.1|2949641_2950277_-	spore cortex protein	NA	NA	NA	NA	NA
WP_003184005.1|2950449_2951502_-|coat	SafA/ExsA family spore coat assembly protein	coat	NA	NA	NA	NA
WP_017474369.1|2951617_2952727_-	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_009327769.1|2952748_2953588_-	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_017474370.1|2953568_2955143_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_017474371.1|2955243_2956422_+	aminotransferase class V-fold PLP-dependent enzyme	NA	A0A1X7QGF3	Faustovirus	25.1	6.1e-31
WP_003184015.1|2956390_2956933_+	transcription repressor NadR	NA	NA	NA	NA	NA
WP_069500662.1|2956976_2957846_-	prephenate dehydratase	NA	NA	NA	NA	NA
WP_003184018.1|2957854_2958298_-	ACT domain-containing protein	NA	NA	NA	NA	NA
WP_003184021.1|2958411_2959698_-	GTPase ObgE	NA	NA	NA	NA	NA
WP_003184022.1|2959730_2960309_-	sporulation protein	NA	NA	NA	NA	NA
WP_003184023.1|2960534_2960816_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_003184025.1|2960828_2961170_-|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_003184027.1|2961182_2961491_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_003184028.1|2961647_2962514_-	stage IV sporulation protein FB	NA	NA	NA	NA	NA
WP_003184030.1|2962506_2963298_-	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_069500665.1|2963443_2963872_+	SRPBCC domain-containing protein	NA	NA	NA	NA	NA
WP_003184034.1|2963871_2964192_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003184035.1|2964236_2965043_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_011198163.1|2965045_2965726_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_003184039.1|2965780_2966299_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_017474373.1|2966295_2967204_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_003184042.1|2967234_2968245_-	rod shape-determining protein	NA	NA	NA	NA	NA
WP_017474921.1|2968847_2969459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081112712.1|2969552_2969921_+	YolD-like family protein	NA	O64030	Bacillus_phage	40.4	2.7e-17
WP_069500921.1|2970143_2971265_-	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	35.6	7.1e-53
WP_069500666.1|2971514_2973131_+	ribonuclease YeeF family protein	NA	NA	NA	NA	NA
WP_006637262.1|2973143_2973560_+	hypothetical protein	NA	A0A2H4J4V0	uncultured_Caudovirales_phage	44.1	3.6e-26
WP_069500668.1|2973590_2974544_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A141HSE6	Bacillus_phage	42.0	5.1e-60
WP_069500669.1|2974591_2974855_-|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	75.9	1.3e-29
WP_069500916.1|2974870_2975140_-	protein xhlA	NA	A0A2H4JD40	uncultured_Caudovirales_phage	61.8	9.6e-25
WP_069500670.1|2975202_2975388_-	XkdX family protein	NA	NA	NA	NA	NA
WP_069500671.1|2975384_2975708_-	bZIP transcription factor	NA	M4ZR44	Bacillus_phage	46.4	7.8e-13
WP_069500672.1|2975720_2977067_-|plate	phage baseplate upper protein	plate	M4ZRP1	Bacillus_phage	86.3	9.9e-86
WP_069500673.1|2977103_2978678_-	hypothetical protein	NA	M4ZSB3	Bacillus_phage	86.6	1.1e-261
WP_069500674.1|2978714_2980424_-	alkaline phosphatase	NA	D6R400	Bacillus_phage	69.4	6.6e-220
WP_009330398.1|2980436_2981273_-|tail	phage tail family protein	tail	D6R3Z9	Bacillus_phage	71.8	2.0e-113
WP_025807965.1|2981272_2985163_-|tail	phage tail tape measure protein	tail	D6R3Z8	Bacillus_phage	62.7	0.0e+00
WP_009329202.1|2985360_2985696_-	hypothetical protein	NA	Q9ZXE8	Bacillus_phage	58.9	5.0e-31
WP_009329203.1|2985755_2986364_-|tail	major tail protein	tail	Q9ZXE9	Bacillus_phage	54.6	8.2e-56
WP_069500675.1|2986363_2986744_-	DUF3168 domain-containing protein	NA	Q9ZXF0	Bacillus_phage	54.8	1.8e-32
WP_069500676.1|2986740_2987124_-	HK97 gp10 family phage protein	NA	Q9ZXF1	Bacillus_phage	69.3	5.9e-44
WP_069500677.1|2987116_2987491_-|head	phage head closure protein	head	Q9ZXF2	Bacillus_phage	65.6	2.4e-37
WP_009329207.1|2987420_2987771_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q9ZXF3	Bacillus_phage	60.0	1.3e-32
WP_009329208.1|2987786_2988236_-	collagen-like protein	NA	D6R3Z0	Bacillus_phage	53.3	4.0e-15
WP_017475036.1|2988261_2989578_-|capsid	phage major capsid protein	capsid	A0A0A7RTL2	Clostridium_phage	50.0	7.9e-96
WP_025807960.1|2989618_2990248_-|head,protease	HK97 family phage prohead protease	head,protease	Q9ZXF7	Bacillus_phage	81.8	6.0e-94
WP_009330392.1|2990237_2991482_-|portal	phage portal protein	portal	D6R3Y6	Bacillus_phage	83.4	1.4e-206
WP_009330378.1|2991669_2993379_-|terminase	terminase large subunit	terminase	D6R3Y4	Bacillus_phage	87.3	1.0e-300
WP_009330377.1|2993378_2993912_-|terminase	phage terminase small subunit P27 family	terminase	Q9ZXG2	Bacillus_phage	80.2	2.8e-68
WP_048355563.1|2993998_2994325_-	hypothetical protein	NA	Q9T203	Bacillus_phage	58.3	5.2e-33
WP_048350375.1|2994293_2994668_-	HNH endonuclease	NA	Q38456	Bacillus_phage	80.6	9.8e-60
WP_026080869.1|2994827_2995469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048407332.1|2995704_2995926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009329244.1|2996675_2997056_-	ArpU family transcriptional regulator	NA	Q9ZXB9	Bacillus_phage	82.9	8.8e-48
WP_073513083.1|2997168_2997567_-	hypothetical protein	NA	A0A1B1P7W5	Bacillus_phage	38.6	2.5e-05
WP_069500678.1|2997582_2998098_-	hypothetical protein	NA	D6R425	Bacillus_phage	83.6	1.1e-82
WP_071583658.1|2998100_2998271_-	Fur-regulated basic protein FbpA	NA	A0A0S2SXY0	Bacillus_phage	56.6	3.0e-08
WP_025807627.1|2998267_2998807_-	nuclease	NA	Q9ZXC2	Bacillus_phage	90.5	1.3e-89
WP_069500679.1|2998803_2999241_-	hypothetical protein	NA	Q9ZXC3	Bacillus_phage	74.5	4.7e-61
WP_069500680.1|2999521_3001942_-	DNA primase	NA	D6R422	Bacillus_phage	74.3	0.0e+00
WP_061576092.1|3002002_3002440_-	DUF669 domain-containing protein	NA	Q9ZXC5	Bacillus_phage	90.3	2.4e-73
WP_048356391.1|3002439_3003372_-	AAA family ATPase	NA	Q9ZXC7	Bacillus_phage	88.1	3.6e-151
WP_057957666.1|3003375_3003933_-	hypothetical protein	NA	Q9ZXC8	Bacillus_phage	71.4	2.4e-70
WP_048355993.1|3004392_3004584_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069500682.1|3004734_3004974_-	helix-turn-helix transcriptional regulator	NA	D6R414	Bacillus_phage	62.0	2.5e-16
WP_048355991.1|3005223_3005667_+	helix-turn-helix transcriptional regulator	NA	Q786F1	Bacillus_phage	63.9	4.9e-42
WP_048355990.1|3005698_3006178_+	ImmA/IrrE family metallo-endopeptidase	NA	Q9T201	Bacillus_phage	59.9	1.3e-43
WP_069500683.1|3006217_3007609_+	recombinase family protein	NA	Q9T200	Bacillus_phage	63.9	1.4e-170
WP_003184048.1|3008040_3008613_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_003184050.1|3008766_3009798_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_011198164.1|3010001_3010751_-	prepilin peptidase	NA	NA	NA	NA	NA
WP_003184054.1|3010893_3012198_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_069500684.1|3012273_3014916_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	42.3	2.8e-161
WP_003184058.1|3015377_3015569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016885545.1|3015588_3016611_-|coat	spore coat protein YsxE	coat	NA	NA	NA	NA
WP_069500685.1|3016638_3018180_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_009329296.1|3018328_3019624_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_003184063.1|3019649_3020624_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_003184065.1|3020627_3021419_-	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_003184068.1|3021408_3022350_-	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_003184070.1|3022389_3023220_-	cytochrome c	NA	NA	NA	NA	NA
WP_017474375.1|3023225_3024587_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_003184074.1|3024775_3025261_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003184076.1|3025308_3025896_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_016885551.1|3025892_3028217_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	45.2	1.0e-186
WP_003184080.1|3028435_3030091_-|protease	ATP-dependent protease LonB	protease	A0A0R6PGP8	Moraxella_phage	35.7	1.4e-17
WP_003184083.1|3030273_3031539_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	63.5	7.2e-147
>prophage 10
NZ_CP017247	Bacillus licheniformis strain BL1202, complete genome	4422181	3629928	3695069	4422181	plate,integrase,transposase,coat,protease,holin,portal,tail,terminase,head,capsid,tRNA	Bacillus_phage(59.52%)	84	3642470:3642489	3685255:3685274
WP_009329597.1|3629928_3630678_+|tRNA	tRNA-dependent cyclodipeptide synthase	tRNA	NA	NA	NA	NA
WP_003185271.1|3630674_3631895_+	cytochrome P450, cyclodipeptide synthase-associated	NA	NA	NA	NA	NA
WP_003185273.1|3631891_3632347_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_069500773.1|3632363_3632837_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016885738.1|3632959_3634138_-	amidase	NA	NA	NA	NA	NA
WP_017474573.1|3634327_3635377_+	oxidoreductase	NA	NA	NA	NA	NA
WP_003185281.1|3635408_3636044_-	FMN-dependent NADH-azoreductase 2	NA	NA	NA	NA	NA
WP_003185283.1|3636344_3637313_-	rhodanese-related sulfurtransferase	NA	NA	NA	NA	NA
WP_069500774.1|3637508_3637718_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003185288.1|3637701_3638283_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_003185290.1|3638439_3638589_+	YvrJ family protein	NA	NA	NA	NA	NA
WP_003185292.1|3638682_3639837_+	oxalate decarboxylase family bicupin	NA	NA	NA	NA	NA
WP_003185294.1|3639909_3640308_+	peptidase	NA	NA	NA	NA	NA
WP_069500775.1|3640404_3640890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003185298.1|3641042_3641270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003185302.1|3641670_3641955_+	hypothetical protein	NA	NA	NA	NA	NA
3642470:3642489	attL	TGGAGACGGTGGGAGTCGAA	NA	NA	NA	NA
WP_017474571.1|3642778_3643591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081112712.1|3643680_3644049_+	YolD-like family protein	NA	O64030	Bacillus_phage	40.4	2.7e-17
WP_035338316.1|3644271_3645393_-	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	35.1	2.4e-53
WP_069500776.1|3645648_3647166_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017474559.1|3647196_3647535_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025808202.1|3647662_3648616_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A141HSE6	Bacillus_phage	43.2	5.1e-60
WP_009329191.1|3648662_3648926_-|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	74.7	1.5e-30
WP_009329192.1|3648941_3649211_-	protein xhlA	NA	A0A2H4JD40	uncultured_Caudovirales_phage	58.4	1.4e-20
WP_017474775.1|3649273_3649456_-	XkdX family protein	NA	A0EWM9	Staphylococcus_virus	50.0	2.3e-06
WP_069500777.1|3649452_3649776_-	hypothetical protein	NA	M4ZR44	Bacillus_phage	44.3	6.6e-12
WP_069500778.1|3649788_3651228_-|plate	phage baseplate upper protein	plate	M4ZRP1	Bacillus_phage	58.8	2.7e-97
WP_073358672.1|3651248_3651803_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069500780.1|3653330_3655043_-	alkaline phosphatase	NA	D6R400	Bacillus_phage	66.4	8.7e-220
WP_003185333.1|3655055_3655892_-|tail	phage tail family protein	tail	D6R3Z9	Bacillus_phage	69.3	5.5e-111
WP_069500781.1|3655891_3660364_-|tail	phage tail tape measure protein	tail	A6M961	Geobacillus_virus	42.6	7.1e-72
WP_003185339.1|3660572_3660935_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003185341.1|3660988_3661606_-|tail	tail protein	tail	NA	NA	NA	NA
WP_006637250.1|3661620_3662004_-	phage protein	NA	NA	NA	NA	NA
WP_006637249.1|3662000_3662399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006637248.1|3662398_3662707_-|head	phage head closure protein	head	A0A2H4JCB1	uncultured_Caudovirales_phage	37.6	8.2e-12
WP_006637247.1|3662696_3662999_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0S2GLH6	Bacillus_phage	45.1	4.7e-12
WP_006637246.1|3663019_3663448_-	collagen-like protein	NA	D6R3Z0	Bacillus_phage	59.0	5.5e-14
WP_006637245.1|3663471_3664755_-|capsid	phage major capsid protein	capsid	A0A288WG01	Bacillus_phage	44.8	2.7e-80
WP_006637244.1|3664793_3665525_-|protease	Clp protease ClpP	protease	A0A2I7SCY8	Paenibacillus_phage	54.2	4.0e-57
WP_006637243.1|3665469_3666780_-|portal	phage portal protein	portal	D6R3Y6	Bacillus_phage	46.7	2.9e-106
WP_006637242.1|3666780_3666972_-	DUF1056 family protein	NA	NA	NA	NA	NA
WP_061578330.1|3666983_3668693_-|terminase	terminase large subunit	terminase	A0A0S2GLF0	Bacillus_phage	62.0	2.7e-205
WP_069500782.1|3668689_3669205_-|terminase	phage terminase small subunit P27 family	terminase	A6M947	Geobacillus_virus	46.4	4.4e-34
WP_069500783.1|3669436_3669811_-	HNH endonuclease	NA	A0A1U7Q1S7	Geobacillus_virus	50.8	9.0e-29
WP_069500784.1|3669837_3670146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006637235.1|3670362_3670587_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_009329244.1|3671324_3671705_-	ArpU family transcriptional regulator	NA	Q9ZXB9	Bacillus_phage	82.9	8.8e-48
WP_025807623.1|3671817_3672195_-	hypothetical protein	NA	R4JMS5	Bacillus_phage	57.9	4.3e-31
WP_025807625.1|3672210_3672726_-	hypothetical protein	NA	D6R425	Bacillus_phage	82.5	2.1e-81
WP_071583658.1|3672728_3672899_-	Fur-regulated basic protein FbpA	NA	A0A0S2SXY0	Bacillus_phage	56.6	3.0e-08
WP_025807627.1|3672895_3673435_-	nuclease	NA	Q9ZXC2	Bacillus_phage	90.5	1.3e-89
WP_025807629.1|3673431_3673869_-	hypothetical protein	NA	Q9ZXC3	Bacillus_phage	75.2	3.6e-61
WP_025807631.1|3673846_3674110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069500785.1|3674386_3676819_-	DNA primase	NA	D6R422	Bacillus_phage	79.9	0.0e+00
WP_003185383.1|3676879_3677317_-	DUF669 domain-containing protein	NA	Q9ZXC5	Bacillus_phage	91.0	8.2e-74
WP_048356391.1|3677316_3678249_-	AAA family ATPase	NA	Q9ZXC7	Bacillus_phage	88.1	3.6e-151
WP_057957666.1|3678252_3678810_-	hypothetical protein	NA	Q9ZXC8	Bacillus_phage	71.4	2.4e-70
WP_011198322.1|3678906_3679149_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009330095.1|3679236_3679503_-	hypothetical protein	NA	Q9ZXC9	Bacillus_phage	54.7	2.7e-19
WP_048406869.1|3679557_3679872_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048407027.1|3679943_3680189_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155759051.1|3680235_3680391_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017474699.1|3680446_3680737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017474700.1|3680723_3680888_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003185401.1|3681039_3681594_-	hypothetical protein	NA	A0A288WGQ2	Bacillus_phage	42.7	1.3e-31
WP_016886536.1|3681651_3681840_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003185403.1|3681971_3682160_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_035317292.1|3682156_3682951_-	ORF6N domain-containing protein	NA	D7RWL7	Brochothrix_phage	61.4	9.0e-79
WP_003185407.1|3682973_3683192_-	helix-turn-helix transcriptional regulator	NA	Q8SBM9	Clostridium_phage	61.1	7.8e-17
WP_069500786.1|3683368_3684007_+	LexA family transcriptional regulator	NA	A0A2I7SCV6	Paenibacillus_phage	47.7	1.1e-45
WP_025807644.1|3684077_3685172_+|integrase	site-specific integrase	integrase	A0A0S2GLI2	Bacillus_phage	53.9	4.9e-99
WP_009329604.1|3685723_3686197_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	61.1	1.0e-45
3685255:3685274	attR	TGGAGACGGTGGGAGTCGAA	NA	NA	NA	NA
WP_003185414.1|3686308_3688612_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	41.7	6.9e-95
WP_003185416.1|3688625_3689372_-	carboxylesterase	NA	NA	NA	NA	NA
WP_003185418.1|3689512_3689743_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_003185421.1|3689913_3690198_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	52.7	5.8e-12
WP_085959538.1|3690226_3690460_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_009329609.1|3690612_3691014_+	transcriptional regulator	NA	S6C481	Thermus_phage	45.3	4.2e-16
WP_011201739.1|3691177_3691582_+	helix-turn-helix transcriptional regulator	NA	S6C481	Thermus_phage	49.5	2.1e-15
WP_003185432.1|3691629_3692307_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_009329611.1|3692323_3693241_-	osmoprotectant ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_009329612.1|3693254_3693908_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003185439.1|3693929_3695069_-|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	F2Y1V5	Organic_Lake_phycodnavirus	30.6	8.6e-14
