The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP017181	Enterobacter kobei strain DSM 13645 chromosome, complete genome	4880257	883481	931347	4880257	terminase,head,transposase,tail,holin,integrase	uncultured_Caudovirales_phage(33.33%)	50	923457:923471	931563:931577
WP_045282386.1|883481_884639_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_014882680.1|884720_886178_-	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_003863205.1|886438_886897_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_014882681.1|887001_888246_+	esterase FrsA	NA	NA	NA	NA	NA
WP_014882682.1|888303_888705_+	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_063667288.1|888818_889871_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.1	2.2e-117
WP_014882684.1|890176_891280_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.9	5.9e-60
WP_045281951.1|891291_892545_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	45.1	1.7e-92
WP_069601721.1|892885_894058_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	50.0	1.6e-111
WP_024136027.1|894054_894231_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_069601722.1|894239_895649_-	DEAD/DEAH box helicase	NA	Q3LZN8	Bacteriophage	74.3	7.7e-214
WP_047747099.1|895775_896078_-	VRR-NUC domain-containing protein	NA	B6SD64	Bacteriophage	67.1	1.5e-26
WP_069601723.1|896174_896390_-	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_069601724.1|896400_896598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069601725.1|896594_896807_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069601726.1|896812_898873_-	DNA polymerase	NA	Q775A3	Bordetella_phage	67.8	1.1e-274
WP_069601727.1|898950_899499_-	DUF2815 family protein	NA	Q3LZQ2	Bacteriophage	60.6	4.2e-51
WP_069601728.1|899514_900819_-	DUF2800 domain-containing protein	NA	B6SCX9	Bacteriophage	60.1	6.8e-148
WP_069601729.1|900821_901736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167353001.1|902799_902946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167353002.1|903059_903218_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069601730.1|903608_904301_-	helix-turn-helix transcriptional regulator	NA	R9TNM0	Vibrio_phage	48.1	2.1e-55
WP_071978050.1|904416_904587_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_069601731.1|904590_906759_+	replication protein	NA	B6SCY1	Bacteriophage	71.1	7.2e-171
WP_069601732.1|907067_907337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069601733.1|907349_907610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069601734.1|907887_908307_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015571350.1|908320_908551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069601735.1|908554_910180_+|head,tail	head-tail connector protein	head,tail	A0A2H4J3N6	uncultured_Caudovirales_phage	57.9	5.3e-166
WP_069601736.1|910176_910410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069601737.1|910396_911233_+	hypothetical protein	NA	A0A2H4JEQ5	uncultured_Caudovirales_phage	42.9	1.3e-46
WP_069601738.1|911266_911767_+	DUF2829 domain-containing protein	NA	A0A1B0VMG3	Pseudomonas_phage	61.1	7.7e-52
WP_069601739.1|912011_912923_+	hypothetical protein	NA	A0A2H4JC66	uncultured_Caudovirales_phage	37.2	1.3e-41
WP_069601740.1|912980_913544_+	hypothetical protein	NA	A0A2H4JID6	uncultured_Caudovirales_phage	52.4	9.6e-51
WP_069601741.1|913545_915534_+	hypothetical protein	NA	A0A2H4J6H2	uncultured_Caudovirales_phage	49.8	4.9e-190
WP_069601742.1|915535_915985_+	GNAT family N-acetyltransferase	NA	A0A2H4J9Z5	uncultured_Caudovirales_phage	43.0	2.3e-23
WP_069601743.1|915987_916455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069601744.1|916457_919166_+	transglycosylase SLT domain-containing protein	NA	G9L6D3	Escherichia_phage	63.0	0.0e+00
WP_069601745.1|919165_922054_+	hypothetical protein	NA	G9L6D4	Escherichia_phage	70.9	0.0e+00
WP_069601746.1|922118_922460_+	hypothetical protein	NA	A0A2H4J7H0	uncultured_Caudovirales_phage	49.1	1.7e-18
WP_069601747.1|922456_924067_+|terminase	phage terminase large subunit	terminase	A0A2H4JCA3	uncultured_Caudovirales_phage	69.9	1.6e-223
923457:923471	attL	TTGGCAACGTGCAAA	NA	NA	NA	NA
WP_069601748.1|924087_926376_+	hypothetical protein	NA	A0A0F6TJC8	Escherichia_coli_O157_typing_phage	34.1	4.9e-61
WP_069601749.1|926380_927502_-	acyltransferase	NA	A0A2H4JA46	uncultured_Caudovirales_phage	25.8	4.8e-17
WP_069602464.1|927682_927913_+|holin	class II holin family protein	holin	A5LH82	Enterobacteria_phage	71.0	2.9e-22
WP_069601750.1|927893_928433_+	lysozyme	NA	H6WRZ4	Salmonella_phage	89.3	5.7e-93
WP_069601751.1|928429_928789_+	hypothetical protein	NA	R9TPM9	Aeromonas_phage	46.4	6.4e-16
WP_164981154.1|929623_929782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158008542.1|930305_930578_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069602465.1|930574_930781_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069602466.1|930786_931347_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
931563:931577	attR	TTTGCACGTTGCCAA	NA	NA	NA	NA
>prophage 2
NZ_CP017181	Enterobacter kobei strain DSM 13645 chromosome, complete genome	4880257	1144264	1196938	4880257	holin,integrase,transposase	Escherichia_phage(27.27%)	47	1178269:1178285	1210241:1210257
WP_032637327.1|1144264_1145245_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	1.8e-185
WP_000019445.1|1146819_1147800_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
WP_014882854.1|1148299_1148662_-	GtrA family protein	NA	B9UDL8	Salmonella_phage	66.7	4.7e-43
WP_069601790.1|1149201_1150335_-	acyltransferase	NA	A0A088CPR9	Enterobacteria_phage	30.9	3.9e-35
WP_023336848.1|1151313_1152534_+	cytochrome P450	NA	NA	NA	NA	NA
WP_014882857.1|1152866_1153883_+	iron ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_023332289.1|1153907_1155482_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_069601791.1|1155483_1156506_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.7	6.5e-21
WP_023332291.1|1156683_1158867_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_023332292.1|1158994_1160968_+	PhoX family phosphatase	NA	NA	NA	NA	NA
WP_023332293.1|1161070_1162459_+	phenylalanine transporter	NA	NA	NA	NA	NA
WP_069601792.1|1162569_1162869_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_023332294.1|1162856_1163219_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_023332295.1|1163424_1164660_+	MFS transporter	NA	NA	NA	NA	NA
WP_059372448.1|1164675_1165701_+	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_069601793.1|1165693_1166836_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_047626963.1|1166911_1167883_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	31.9	3.5e-24
WP_014882869.1|1167883_1169128_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_059372453.1|1169194_1170631_-	MFS transporter	NA	NA	NA	NA	NA
WP_059372456.1|1170738_1171608_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_069601794.1|1171761_1172364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014882873.1|1172391_1173045_-	oxygen-insensitive NAD(P)H nitroreductase	NA	NA	NA	NA	NA
WP_014882874.1|1173165_1173534_-	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_014882875.1|1173523_1174114_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023332301.1|1174304_1175408_+	RomA family MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_014882877.1|1175440_1175782_+	RamA family antibiotic efflux transcriptional regulator	NA	NA	NA	NA	NA
WP_014882878.1|1175839_1176088_-	DUF1158 domain-containing protein	NA	NA	NA	NA	NA
WP_032637327.1|1176554_1177535_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	1.8e-185
WP_014882920.1|1177731_1178205_+	cold shock domain-containing protein	NA	NA	NA	NA	NA
1178269:1178285	attL	CGTAGGCCCGGTAAGCA	NA	NA	NA	NA
WP_014882921.1|1178313_1179018_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.9	7.6e-21
WP_063943401.1|1179004_1179841_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.9	4.8e-14
WP_069601795.1|1179833_1180667_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_069601796.1|1180666_1181680_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_069601797.1|1181777_1183334_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_047027608.1|1183546_1184245_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_069601798.1|1184278_1185973_-	thiamine pyrophosphate-binding protein	NA	NA	NA	NA	NA
WP_014882927.1|1186006_1186747_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_047027606.1|1187021_1187669_-	anti-sigma factor	NA	NA	NA	NA	NA
WP_023332333.1|1187665_1188220_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_069601799.1|1188263_1188827_-	fasciclin domain-containing protein	NA	NA	NA	NA	NA
WP_069601800.1|1188977_1190642_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.8	1.9e-62
WP_069601801.1|1190655_1192128_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_014882933.1|1192141_1192729_-	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_023336880.1|1192857_1194891_+|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.3	9.9e-21
WP_069601802.1|1195027_1195420_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_069601803.1|1195416_1195701_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_045282386.1|1195780_1196938_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
1210241:1210257	attR	TGCTTACCGGGCCTACG	NA	NA	NA	NA
>prophage 3
NZ_CP017181	Enterobacter kobei strain DSM 13645 chromosome, complete genome	4880257	1563330	1662088	4880257	portal,terminase,head,tail,tRNA,holin,protease,capsid	Enterobacterial_phage(26.53%)	101	NA	NA
WP_014883226.1|1563330_1564110_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_014883227.1|1564113_1565436_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_008499954.1|1565416_1566121_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_069601861.1|1566120_1570572_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_023332553.1|1570750_1572574_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_014883230.1|1572749_1573301_+	YcbK family protein	NA	NA	NA	NA	NA
WP_023332554.1|1573321_1573969_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_014883232.1|1574021_1575212_-	aspartate transaminase	NA	NA	NA	NA	NA
WP_072093609.1|1575396_1576500_-	porin	NA	Q1MVN1	Enterobacteria_phage	52.5	1.4e-98
WP_014883234.1|1577109_1578510_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	35.9	1.4e-79
WP_059373113.1|1578675_1579878_-	nicotinate phosphoribosyltransferase	NA	A0A2L0UZQ6	Agrobacterium_phage	31.4	3.8e-44
WP_069601862.1|1580062_1581355_-	DUF3596 domain-containing protein	NA	S4TSP2	Salmonella_phage	95.6	6.5e-244
WP_045261754.1|1581399_1581657_-	excisionase family protein	NA	S4TND0	Salmonella_phage	88.8	5.2e-36
WP_062939324.1|1581640_1582012_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044596884.1|1582026_1582605_-	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	67.7	8.3e-74
WP_023062998.1|1582604_1583018_-	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	64.0	6.4e-44
WP_006811080.1|1583207_1583615_-	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	87.5	2.7e-47
WP_006811079.1|1583607_1583832_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069601863.1|1583938_1584325_-	S24 family peptidase	NA	F1C5A0	Cronobacter_phage	60.8	6.4e-38
WP_006811077.1|1584391_1584823_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_102135191.1|1584998_1585784_-	helix-turn-helix transcriptional regulator	NA	E7C9R0	Salmonella_phage	35.6	3.9e-34
WP_071978052.1|1585833_1586064_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_069602470.1|1586089_1586386_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_069601864.1|1586382_1587294_+	helix-turn-helix domain-containing protein	NA	Q8W642	Enterobacteria_phage	67.8	1.9e-93
WP_069601865.1|1587309_1588191_+	ATP-binding protein	NA	Q8W641	Enterobacteria_phage	63.3	9.7e-82
WP_069601866.1|1588187_1589567_+	AAA family ATPase	NA	Q8W640	Enterobacteria_phage	67.9	1.1e-172
WP_069601867.1|1589594_1590431_+	antitermination protein	NA	A0A1B5FPA5	Escherichia_phage	78.1	2.8e-123
WP_016240226.1|1590539_1591490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122008274.1|1592679_1592985_+|holin	phage holin family protein	holin	E7C9S8	Salmonella_phage	86.1	1.1e-43
WP_058660492.1|1592971_1593412_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	69.1	2.4e-49
WP_058660491.1|1593408_1593795_+	DUF2570 domain-containing protein	NA	A0A192Y6H8	Salmonella_phage	40.9	1.9e-13
WP_069601868.1|1594074_1594698_+	DUF1983 domain-containing protein	NA	G8C7Q4	Escherichia_phage	76.8	3.9e-85
WP_044901840.1|1594708_1594936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047363385.1|1594953_1596411_+	glycosyl transferase	NA	K7PKP3	Enterobacterial_phage	89.3	1.0e-269
WP_047363387.1|1596392_1596590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064138306.1|1597220_1597811_+	hypothetical protein	NA	K7P6K4	Enterobacteria_phage	93.1	2.3e-103
WP_042863315.1|1597807_1598149_+	HNH endonuclease	NA	K7PM05	Enterobacterial_phage	98.2	3.9e-63
WP_042863313.1|1598148_1598385_+	hypothetical protein	NA	K7PHC8	Enterobacterial_phage	80.8	6.2e-28
WP_033146302.1|1598534_1599020_+	hypothetical protein	NA	K7PGU7	Enterobacterial_phage	93.8	3.9e-77
WP_069601869.1|1599026_1600541_+|terminase	terminase large subunit	terminase	K7PLY2	Enterobacterial_phage	99.8	4.7e-294
WP_069601870.1|1600540_1601815_+|portal	phage portal protein	portal	F1C584	Cronobacter_phage	98.3	3.1e-246
WP_016063561.1|1601832_1602510_+|head,protease	HK97 family phage prohead protease	head,protease	K7PKL4	Enterobacterial_phage	100.0	2.4e-125
WP_045626368.1|1602512_1603670_+|capsid	phage major capsid protein	capsid	Q77WA0	Escherichia_phage	97.4	8.0e-209
WP_016063563.1|1603703_1604030_+|head,tail	phage head-tail connector protein	head,tail	K7PGU9	Enterobacterial_phage	100.0	2.6e-56
WP_045626370.1|1604029_1604368_+|head	phage head closure protein	head	K7P7L2	Enterobacteria_phage	96.4	5.4e-57
WP_069601871.1|1604364_1604814_+	HK97 gp10 family phage protein	NA	K7PH84	Enterobacterial_phage	98.0	1.3e-74
WP_069601872.1|1604810_1605158_+	DUF3168 domain-containing protein	NA	A0A220NRP0	Escherichia_phage	96.5	5.5e-57
WP_069601873.1|1605212_1605683_+|tail	phage tail protein	tail	K7P6W3	Enterobacteria_phage	98.1	7.4e-81
WP_069601874.1|1605737_1606139_+|tail	phage tail assembly chaperone	tail	K7PGV0	Enterobacterial_phage	98.5	1.2e-68
WP_069601875.1|1606162_1606426_+	DUF4035 domain-containing protein	NA	K7PLY6	Enterobacterial_phage	98.9	3.8e-42
WP_069601876.1|1606460_1609742_+|tail	phage tail tape measure protein	tail	A0A220NRN7	Escherichia_phage	97.9	0.0e+00
WP_032624419.1|1609744_1610083_+|tail	phage tail protein	tail	K7PKL8	Enterobacterial_phage	97.3	4.3e-62
WP_069601877.1|1610079_1610838_+|tail	phage minor tail protein L	tail	G8C7J7	Escherichia_phage	97.2	2.0e-144
WP_057992072.1|1610839_1611550_+	C40 family peptidase	NA	K7PGV2	Enterobacterial_phage	96.6	2.5e-144
WP_137984529.1|1611582_1611825_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069601879.1|1612142_1612751_+|tail	tail assembly protein	tail	K7P6S9	Enterobacteria_phage	83.2	6.2e-88
WP_069601880.1|1612804_1616635_+	DUF1983 domain-containing protein	NA	Q9MCR7	Enterobacteria_phage	83.6	0.0e+00
WP_069601881.1|1616639_1617605_+	hypothetical protein	NA	G1CSU0	Cronobacter_virus	39.7	3.7e-58
WP_137984556.1|1618223_1618802_+|tail	tail fiber domain-containing protein	tail	A0A2I6PD03	Escherichia_phage	53.7	2.7e-32
WP_069602471.1|1618932_1619199_-	DinI family protein	NA	K7PKM2	Enterobacterial_phage	93.2	4.0e-39
WP_069601882.1|1619623_1622236_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.2	7.0e-19
WP_069601883.1|1622337_1623108_-	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.1	1.9e-28
WP_069601884.1|1623104_1623896_-	aliphatic sulfonate ABC transporter permease SsuC	NA	NA	NA	NA	NA
WP_032637061.1|1623905_1625051_-	FMNH2-dependent alkanesulfonate monooxygenase	NA	NA	NA	NA	NA
WP_069601885.1|1625047_1626010_-	sulfonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_014883241.1|1626002_1626578_-	NADPH-dependent FMN reductase	NA	NA	NA	NA	NA
WP_014883242.1|1626827_1627838_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_050862060.1|1628003_1628546_+	cell division protein ZapC	NA	NA	NA	NA	NA
WP_069601886.1|1628542_1629652_-	YcbX family protein	NA	V5UTY8	Synechococcus_phage	39.1	4.1e-05
WP_023332608.1|1629750_1631859_+	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_069601887.1|1631871_1633779_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	28.1	6.2e-49
WP_014883247.1|1633792_1635046_+	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_069601888.1|1635050_1636691_+	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_069601889.1|1636687_1637254_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_013097261.1|1637510_1637678_+	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000227926.1|1637749_1638268_-	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_069601890.1|1638336_1640097_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_023332611.1|1640283_1640736_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_014883252.1|1640800_1641856_-	porin OmpA	NA	NA	NA	NA	NA
WP_014883253.1|1642211_1642721_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_069601891.1|1642935_1643565_+	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_023332614.1|1643521_1645684_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_014883256.1|1645703_1646150_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_069601892.1|1646273_1648328_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.4	3.9e-17
WP_008499922.1|1648386_1648845_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_023332617.1|1648925_1649588_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_014883259.1|1649761_1650175_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_008499919.1|1650211_1650529_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_045134648.1|1650589_1651780_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_032637048.1|1651954_1652512_+	kinase inhibitor	NA	NA	NA	NA	NA
WP_045134647.1|1652522_1653311_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_045281283.1|1653322_1653604_+	acylphosphatase	NA	NA	NA	NA	NA
WP_008499913.1|1653600_1653930_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_023332622.1|1653999_1654551_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_069601893.1|1654561_1655719_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_069601894.1|1655720_1658438_-	TcfC E-set like domain-containing protein	NA	NA	NA	NA	NA
WP_023332625.1|1658510_1659017_-	fimbrial protein	NA	NA	NA	NA	NA
WP_069601895.1|1659092_1659836_-	fimbrial protein	NA	NA	NA	NA	NA
WP_023332627.1|1660144_1660900_+	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_045134644.1|1660896_1661373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013097244.1|1661428_1662088_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	54.9	8.9e-48
>prophage 4
NZ_CP017181	Enterobacter kobei strain DSM 13645 chromosome, complete genome	4880257	1828611	1838895	4880257		Enterobacteria_phage(27.27%)	13	NA	NA
WP_069601924.1|1828611_1829898_-	DUF3596 domain-containing protein	NA	A0A0U2JGI6	Escherichia_phage	49.9	7.0e-113
WP_023343778.1|1829897_1830113_-	excisionase family protein	NA	A0A0U2RY08	Escherichia_phage	54.9	1.2e-17
WP_069601925.1|1830174_1830414_-	DUF4060 family protein	NA	M9P0E0	Enterobacteria_phage	56.6	3.3e-16
WP_069601926.1|1830400_1832305_-	exodeoxyribonuclease VIII	NA	S4TNL0	Salmonella_phage	32.8	1.2e-25
WP_047625949.1|1832526_1832799_-	hypothetical protein	NA	K7P7B3	Enterobacteria_phage	43.2	1.4e-15
WP_131774834.1|1832866_1833052_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047625950.1|1833380_1833800_-	helix-turn-helix domain-containing protein	NA	K7PM82	Enterobacteria_phage	53.1	2.9e-12
WP_044865494.1|1833877_1834090_+	Cro/Cl family transcriptional regulator	NA	H9C161	Pectobacterium_phage	43.4	4.6e-06
WP_058648178.1|1834089_1834542_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072203033.1|1834564_1835482_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	40.3	9.2e-51
WP_069601927.1|1835484_1836225_+	ATP-binding protein	NA	H6WRX8	Salmonella_phage	71.9	3.6e-98
WP_069601928.1|1836242_1836902_+	DUF1627 domain-containing protein	NA	A0A088CE47	Shigella_phage	30.0	2.2e-14
WP_069601929.1|1837173_1838895_-	AIPR family protein	NA	D0UIM0	Aggregatibacter_phage	28.8	1.4e-55
>prophage 5
NZ_CP017181	Enterobacter kobei strain DSM 13645 chromosome, complete genome	4880257	2040998	2120970	4880257	terminase,lysis,tail,coat,holin,integrase,protease	Escherichia_phage(46.15%)	93	2033168:2033184	2055609:2055625
2033168:2033184	attL	CGCGGCTCTGGCTGCGG	NA	NA	NA	NA
WP_069601975.1|2040998_2042279_-|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	51.2	1.1e-123
WP_022650951.1|2042311_2042560_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	8.3e-15
WP_069601976.1|2042589_2043216_-	Eac protein	NA	A0A220NQT7	Salmonella_phage	80.7	2.6e-97
WP_137984531.1|2043225_2043381_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	78.0	8.8e-15
WP_081330955.1|2043430_2045437_-	phage N-6-adenine-methyltransferase	NA	A0A1B0V7P0	Salmonella_phage	51.9	9.4e-141
WP_167353005.1|2045433_2045598_-	hypothetical protein	NA	G8C7S7	Escherichia_phage	96.2	2.7e-22
WP_069601977.1|2045594_2046023_-	regulator	NA	M9NYX4	Enterobacteria_phage	94.4	9.8e-72
WP_069601978.1|2046019_2046637_-	YqaJ viral recombinase family protein	NA	A0A0S2SY31	Pseudomonas_phage	56.9	1.1e-58
WP_032621589.1|2046633_2047380_-	phage recombination protein Bet	NA	A0A0M4RD39	Salmonella_phage	65.8	1.8e-65
WP_069601979.1|2047398_2047683_-	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	93.6	1.5e-47
WP_058657563.1|2047755_2047965_-	cell division protein FtsZ	NA	M9NZE2	Enterobacteria_phage	94.2	5.7e-33
WP_069601980.1|2047961_2048120_-	hypothetical protein	NA	G8C7T3	Escherichia_phage	88.2	3.5e-19
WP_069601981.1|2048116_2048323_-	hypothetical protein	NA	A0A1L2C975	Pseudomonas_phage	44.6	5.0e-05
WP_026080591.1|2049521_2049719_+	hypothetical protein	NA	G8C7T7	Escherichia_phage	96.9	1.8e-25
WP_023306034.1|2049856_2050765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069601983.1|2050877_2051537_-	helix-turn-helix domain-containing protein	NA	F1C599	Cronobacter_phage	65.6	1.2e-71
WP_022650973.1|2051645_2051864_+	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	47.0	1.9e-10
WP_069601984.1|2051894_2052440_+	hypothetical protein	NA	K7P7P2	Enterobacteria_phage	98.9	2.5e-96
WP_015571544.1|2052523_2052670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063944937.1|2052662_2053562_+	hypothetical protein	NA	A0A0N7C1Z7	Escherichia_phage	55.0	8.4e-81
WP_069601985.1|2053551_2054985_+	AAA family ATPase	NA	Q716D2	Shigella_phage	87.1	3.7e-232
WP_069601986.1|2054984_2055284_+	protein ren	NA	O48423	Enterobacteria_phage	51.6	2.8e-17
WP_069601987.1|2055280_2055577_+	DUF4406 domain-containing protein	NA	A0A222YYT7	Escherichia_phage	65.2	2.4e-29
WP_069601988.1|2056028_2056232_+	hypothetical protein	NA	R9TRD3	Aeromonas_phage	78.1	1.2e-22
2055609:2055625	attR	CGCGGCTCTGGCTGCGG	NA	NA	NA	NA
WP_069601989.1|2056228_2056693_+	hypothetical protein	NA	K7PJQ4	Enterobacteria_phage	85.8	1.8e-50
WP_069601990.1|2056695_2057211_+	hypothetical protein	NA	G9L6B3	Escherichia_phage	90.1	1.9e-93
WP_081330956.1|2057207_2058071_+	hypothetical protein	NA	G8C7V0	Escherichia_phage	42.3	3.9e-35
WP_069601991.1|2058070_2058325_+	hypothetical protein	NA	A0A1B0V7L5	Salmonella_phage	42.1	3.8e-07
WP_069601992.1|2058553_2059009_+	recombination protein NinB	NA	I6PD71	Cronobacter_phage	65.6	3.5e-59
WP_069601993.1|2059008_2059179_+	NinE family protein	NA	K7P7K0	Enterobacteria_phage	94.4	5.3e-21
WP_069601994.1|2059171_2059819_+	recombination protein NinG	NA	S4TSR3	Salmonella_phage	68.4	2.1e-78
WP_045281515.1|2059815_2060457_+	HNH endonuclease	NA	A0A2I7QND8	Vibrio_phage	46.0	4.3e-39
WP_045418805.1|2060453_2060654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069601995.1|2060756_2061578_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	76.2	1.1e-108
WP_069601996.1|2061688_2061973_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069601997.1|2062185_2062527_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	53.3	1.4e-28
WP_137984532.1|2062510_2062954_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	69.1	1.4e-49
WP_069601999.1|2062950_2063424_+|lysis	lysis protein	lysis	Q8HA85	Salmonella_phage	54.7	9.3e-39
WP_006811069.1|2063613_2064300_+	Rha family transcriptional regulator	NA	I6R9D7	Salmonella_phage	99.1	8.0e-124
WP_069602001.1|2064984_2065635_+	hypothetical protein	NA	G8C7P2	Escherichia_phage	79.6	3.2e-90
WP_069602002.1|2065631_2067203_+|terminase	terminase	terminase	G8C7P3	Escherichia_phage	95.6	0.0e+00
WP_069602003.1|2067207_2068611_+	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	95.9	2.6e-254
WP_069602004.1|2068612_2069716_+	hypothetical protein	NA	G8C7P5	Escherichia_phage	90.7	7.9e-190
WP_069602005.1|2069841_2070594_+	hypothetical protein	NA	G8C7P6	Escherichia_phage	92.8	3.9e-124
WP_137984533.1|2070590_2071331_-	hypothetical protein	NA	A0A2I2MUH3	uncultured_Caudovirales_phage	47.6	3.6e-37
WP_069602007.1|2071443_2072577_+|coat	P22 coat - protein 5 family protein	coat	G8C7P7	Escherichia_phage	83.8	2.4e-173
WP_069602008.1|2072616_2072802_+	hypothetical protein	NA	G8C7P8	Escherichia_phage	98.4	1.4e-27
WP_069602009.1|2072804_2073287_+	hypothetical protein	NA	G8C7P9	Escherichia_phage	92.5	1.5e-81
WP_069602010.1|2073288_2073642_+	hypothetical protein	NA	G8C7Q0	Escherichia_phage	87.9	3.5e-51
WP_069602011.1|2073644_2074244_+	hypothetical protein	NA	G8C7Q1	Escherichia_phage	88.4	1.1e-97
WP_069602012.1|2074233_2074680_+	DUF4128 domain-containing protein	NA	G8C7Q2	Escherichia_phage	90.6	8.7e-71
WP_069602013.1|2074726_2075659_+|tail	phage tail protein	tail	G8C7Q3	Escherichia_phage	99.0	1.8e-166
WP_048986151.1|2075701_2076037_+	hypothetical protein	NA	S4TTH3	Salmonella_phage	72.1	2.0e-40
WP_081330982.1|2076384_2076990_+	DUF1983 domain-containing protein	NA	G8C7Q4	Escherichia_phage	51.2	1.0e-29
WP_069602015.1|2077055_2077394_+	hypothetical protein	NA	G8C7Q5	Escherichia_phage	95.5	5.0e-55
WP_022651625.1|2077411_2077699_+	DUF1799 domain-containing protein	NA	I6PD79	Cronobacter_phage	61.5	9.3e-18
WP_069602016.1|2077698_2080929_+|tail	phage tail tape measure protein	tail	G8C7Q6	Escherichia_phage	43.8	4.3e-196
WP_158008543.1|2081420_2081717_+	hypothetical protein	NA	A0A2I7RH26	Vibrio_phage	44.1	6.5e-06
WP_023622600.1|2081788_2082139_+|tail	phage tail protein	tail	G8C7R0	Escherichia_phage	93.1	1.8e-55
WP_069602019.1|2082138_2082909_+|tail	phage minor tail protein L	tail	G8C7R1	Escherichia_phage	93.4	6.8e-140
WP_069602020.1|2082921_2083653_+	C40 family peptidase	NA	G8C7R2	Escherichia_phage	96.7	9.0e-150
WP_022651619.1|2083640_2084240_+|tail	tail assembly protein	tail	G8C7R3	Escherichia_phage	95.0	3.1e-100
WP_069602021.1|2084295_2088150_+	DUF1983 domain-containing protein	NA	G8C7R4	Escherichia_phage	75.3	0.0e+00
WP_032636937.1|2088154_2089120_+	hypothetical protein	NA	G1CSU0	Cronobacter_virus	39.7	4.8e-58
WP_137984559.1|2089738_2090317_+|tail	tail fiber domain-containing protein	tail	A0A2I6PD03	Escherichia_phage	53.7	2.7e-32
WP_069602022.1|2090447_2090714_-	DinI family protein	NA	K7PKM2	Enterobacterial_phage	94.3	1.8e-39
WP_069602023.1|2090813_2091053_+	hypothetical protein	NA	K7P7N3	Enterobacteria_phage	92.3	3.3e-37
WP_069602024.1|2091052_2091370_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	47.1	3.2e-19
WP_069602025.1|2091881_2092910_+	Mal regulon transcriptional regulator MalI	NA	NA	NA	NA	NA
WP_023337197.1|2093014_2094547_-	YdgA family protein	NA	NA	NA	NA	NA
WP_069602026.1|2094646_2095822_-	mannose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_014883590.1|2096021_2097668_+	fumarate hydratase	NA	NA	NA	NA	NA
WP_069602027.1|2097851_2099246_+	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_050862540.1|2099246_2100176_-	DNA replication terminus site-binding protein	NA	NA	NA	NA	NA
WP_063943061.1|2100249_2101548_-	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	24.5	3.6e-16
WP_014883594.1|2101623_2101884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032636775.1|2102121_2102838_-	two-component system response regulator RstA	NA	NA	NA	NA	NA
WP_014883596.1|2102966_2103302_+	GlpM family protein	NA	NA	NA	NA	NA
WP_014883597.1|2103298_2104021_-	dihydromonapterin reductase	NA	NA	NA	NA	NA
WP_023330267.1|2104061_2105444_-	amino acid permease	NA	NA	NA	NA	NA
WP_014883599.1|2105629_2106574_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_023330268.1|2107109_2108639_+	Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_023330269.1|2108649_2110038_+	Re/Si-specific NAD(P)(+) transhydrogenase subunit beta	NA	NA	NA	NA	NA
WP_069602028.1|2110145_2111255_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_059371920.1|2112974_2114411_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_023330279.1|2114506_2115274_+	arylamine N-acetyltransferase	NA	NA	NA	NA	NA
WP_006808895.1|2115324_2115672_-	HNH nuclease family protein	NA	NA	NA	NA	NA
WP_014883618.1|2115749_2116643_-	PhzF family phenazine biosynthesis protein	NA	NA	NA	NA	NA
WP_069602030.1|2116838_2117864_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_069602031.1|2117974_2119009_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_014883621.1|2119431_2119794_+	multidrug/spermidine efflux SMR transporter subunit MdtJ	NA	NA	NA	NA	NA
WP_069602032.1|2119780_2120110_+	multidrug/spermidine efflux SMR transporter subunit MdtI	NA	NA	NA	NA	NA
WP_045282037.1|2120148_2120970_-|protease	serine protease	protease	NA	NA	NA	NA
>prophage 6
NZ_CP017181	Enterobacter kobei strain DSM 13645 chromosome, complete genome	4880257	2159984	2176370	4880257	tail	Escherichia_phage(40.0%)	16	NA	NA
WP_069602043.1|2159984_2162423_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	7.5e-217
WP_069602044.1|2162554_2162848_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_069602045.1|2162954_2163665_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_014883673.1|2163765_2164326_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_008502414.1|2164325_2164664_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_137984535.1|2164959_2166030_+	D-galactonate dehydratase family protein	NA	G8C7R0	Escherichia_phage	90.5	3.4e-36
WP_069602046.1|2166029_2166800_+|tail	phage minor tail protein L	tail	G8C7R1	Escherichia_phage	94.1	2.1e-141
WP_137984560.1|2167088_2167451_+|tail	tail fiber domain-containing protein	tail	A0A2I6PD03	Escherichia_phage	59.8	7.4e-28
WP_069602022.1|2167581_2167848_-	DinI family protein	NA	K7PKM2	Enterobacterial_phage	94.3	1.8e-39
WP_069602049.1|2168173_2168590_+	DNA polymerase V	NA	K7P6F7	Enterobacteria_phage	92.2	9.6e-64
WP_069602050.1|2170204_2171668_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.4	5.1e-43
WP_014883679.1|2171711_2171915_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	58.2	3.4e-14
WP_014883680.1|2172203_2172635_+	universal stress protein	NA	A0A1W6JNV4	Morganella_phage	37.2	9.7e-19
WP_014883681.1|2172669_2173356_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_069602051.1|2173447_2174194_-	bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG	NA	NA	NA	NA	NA
WP_045282057.1|2174336_2176370_+	peptidyl-dipeptidase Dcp	NA	A0A1V0SIU1	Klosneuvirus	21.7	1.2e-18
>prophage 7
NZ_CP017181	Enterobacter kobei strain DSM 13645 chromosome, complete genome	4880257	2582977	2651511	4880257	portal,terminase,transposase,head,lysis,tail,holin,integrase,protease,plate,capsid	Escherichia_phage(31.82%)	79	2637392:2637410	2653837:2653855
WP_014884092.1|2582977_2584024_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	28.7	2.8e-19
WP_014884093.1|2584275_2585037_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.0	1.8e-07
WP_069602129.1|2585033_2585624_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_014884095.1|2585659_2586538_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_003856793.1|2586634_2587255_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_069602130.1|2587251_2588133_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_106993556.1|2588272_2588317_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_069602131.1|2588413_2589976_+	anthranilate synthase component 1	NA	NA	NA	NA	NA
WP_014884098.1|2589975_2591571_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	37.3	7.2e-51
WP_014884099.1|2591574_2592933_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.6	3.3e-36
WP_014884100.1|2592943_2594137_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_014884101.1|2594136_2594946_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_023330557.1|2595212_2596469_+	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_014884103.1|2596623_2596836_-	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	80.6	8.4e-24
WP_032629007.1|2597328_2597934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014884106.1|2597997_2598657_-	DsbA family protein	NA	NA	NA	NA	NA
WP_014884107.1|2598786_2599266_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014884108.1|2599406_2600228_+	alpha/beta hydrolase	NA	A0A1D8EW21	Mycobacterium_phage	25.3	3.7e-11
WP_069602132.1|2600304_2601072_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_069602133.1|2601326_2602346_-	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_069602134.1|2602445_2603225_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_069602135.1|2603462_2604011_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023338394.1|2604188_2605400_+	selenium metabolism membrane protein YedE/FdhT	NA	NA	NA	NA	NA
WP_014884113.1|2605396_2605630_+	sulfurtransferase-like selenium metabolism protein YedF	NA	NA	NA	NA	NA
WP_154816661.1|2605824_2605995_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014884115.1|2606140_2606773_-	outer membrane protein OmpW	NA	NA	NA	NA	NA
WP_014884116.1|2607054_2607459_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_014884117.1|2607484_2608228_+	UPF0259 family protein	NA	NA	NA	NA	NA
WP_014884118.1|2608286_2608826_+	septation protein A	NA	NA	NA	NA	NA
WP_008502796.1|2608930_2609326_+	acyl-CoA thioester hydrolase YciA	NA	NA	NA	NA	NA
WP_045135474.1|2609361_2610084_-	TonB system transport protein TonB	NA	NA	NA	NA	NA
WP_069602484.1|2610173_2611745_+	recombinase family protein	NA	NA	NA	NA	NA
WP_004898926.1|2612084_2612582_+	PH domain-containing protein	NA	A0A249Y2R5	Serratia_phage	33.3	3.1e-16
WP_042947327.1|2612792_2613416_+	recombinase family protein	NA	NA	NA	NA	NA
WP_012967828.1|2613746_2614109_+|protease	protease inhibitor I42 family protein	protease	NA	NA	NA	NA
WP_069602136.1|2614101_2614473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_137984538.1|2615740_2615995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019445.1|2616033_2617014_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
WP_012967825.1|2618567_2618744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023330569.1|2619230_2619527_+	YciI family protein	NA	NA	NA	NA	NA
WP_069602139.1|2619699_2621007_-	CHAT domain-containing protein	NA	A0A291AWU0	Escherichia_phage	64.7	1.5e-163
WP_000019445.1|2621005_2621986_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
WP_069602140.1|2623115_2623337_-	DNA-binding transcriptional regulator	NA	A0A2I8TV89	Erwinia_phage	71.4	3.9e-24
WP_014884123.1|2623413_2624583_-	phage late control D family protein	NA	Q6K1G4	Salmonella_virus	75.4	2.5e-162
WP_069602141.1|2624579_2625044_-|tail	phage tail protein	tail	A0A218M4I2	Erwinia_phage	70.8	3.2e-60
WP_069602142.1|2625056_2627504_-|tail	phage tail tape measure protein	tail	Q858U7	Yersinia_virus	76.4	1.4e-303
WP_000763321.1|2627493_2627616_-|tail	GpE family phage tail protein	tail	O80316	Escherichia_phage	89.7	5.0e-13
WP_014884126.1|2627648_2627957_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	73.6	1.4e-27
WP_069602143.1|2628017_2628536_-|tail	phage major tail tube protein	tail	A0A218M4J0	Erwinia_phage	80.2	6.5e-78
WP_069602144.1|2628548_2629742_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	82.1	8.0e-188
WP_023333113.1|2629864_2630269_-|tail	tail fiber assembly protein	tail	U5P083	Shigella_phage	45.5	1.7e-25
WP_069602145.1|2630280_2632332_-|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	78.6	4.2e-88
WP_069602146.1|2632343_2632874_-|tail	phage tail protein I	tail	Q37841	Escherichia_phage	87.5	1.8e-91
WP_069602147.1|2632866_2633775_-|plate	baseplate assembly protein	plate	Q6K1H4	Salmonella_virus	82.8	3.7e-137
WP_069602148.1|2633780_2634131_-	GPW/gp25 family protein	NA	A0A0M4RE59	Salmonella_phage	70.7	1.5e-38
WP_069602149.1|2634127_2634769_-|plate	phage baseplate assembly protein V	plate	Q6K1H6	Salmonella_virus	83.1	1.6e-97
WP_069602150.1|2634957_2636142_+	DUF2971 domain-containing protein	NA	NA	NA	NA	NA
WP_069602151.1|2636181_2636634_-	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	69.4	2.1e-48
WP_069602152.1|2636626_2637094_-|tail	phage tail protein	tail	A0A218M4K6	Erwinia_phage	71.6	2.9e-61
WP_081330962.1|2637056_2637302_-|holin	holin	holin	S4TNY4	Salmonella_phage	75.3	8.5e-28
WP_069602153.1|2637189_2637615_-|lysis	LysB family phage lysis regulatory protein	lysis	O80310	Escherichia_phage	69.3	1.0e-44
2637392:2637410	attL	CCGGCGGCCAGCAGTTCGC	NA	NA	NA	NA
WP_069602154.1|2637611_2638121_-	lysozyme	NA	A0A218M4K3	Erwinia_phage	85.7	3.2e-77
WP_001354073.1|2638104_2638326_-	hypothetical protein	NA	A0A218M4L5	Erwinia_phage	75.3	1.4e-26
WP_069602155.1|2638316_2638520_-|tail	tail protein X	tail	A0A218M4L8	Erwinia_phage	76.1	3.6e-24
WP_069602156.1|2638519_2639026_-|head	head completion/stabilization protein	head	O80306	Escherichia_phage	70.8	4.1e-61
WP_069602157.1|2639125_2639875_-|terminase	terminase endonuclease subunit	terminase	O80305	Escherichia_phage	71.6	1.2e-77
WP_069602158.1|2639878_2640946_-|capsid	phage major capsid protein, P2 family	capsid	S4TUA6	Salmonella_phage	83.3	1.4e-170
WP_069602159.1|2641001_2641856_-|capsid	GPO family capsid scaffolding protein	capsid	A0A218M4L9	Erwinia_phage	72.5	3.8e-115
WP_069602160.1|2642023_2643793_+|terminase	terminase ATPase subunit family protein	terminase	Q9T0R3	Escherichia_phage	84.7	3.9e-300
WP_069602161.1|2643794_2644820_+|portal	phage portal protein	portal	Q6K1J0	Salmonella_virus	83.3	1.8e-167
WP_032609409.1|2645176_2645731_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032609411.1|2645878_2646163_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069602162.1|2646159_2648457_-	replication endonuclease	NA	Q858T4	Yersinia_virus	72.9	0.0e+00
WP_045630572.1|2648458_2648722_-	DUF5405 family protein	NA	U5N3W1	Enterobacteria_phage	57.0	3.3e-22
WP_014884152.1|2648744_2648963_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	62.1	3.8e-11
WP_069602163.1|2649029_2649530_-	replication protein B	NA	M1SV55	Escherichia_phage	75.3	7.4e-71
WP_032658818.1|2649696_2649972_-	regulatory phage cox family protein	NA	Q1JS60	Enterobacteria_phage	84.4	1.5e-41
WP_069602164.1|2650107_2650404_+	helix-turn-helix transcriptional regulator	NA	Q1JS61	Enterobacteria_phage	71.1	3.3e-34
WP_069602165.1|2650467_2651511_+|integrase	tyrosine-type recombinase/integrase	integrase	Q83VS6	Escherichia_phage	76.6	1.4e-148
2653837:2653855	attR	GCGAACTGCTGGCCGCCGG	NA	NA	NA	NA
>prophage 8
NZ_CP017181	Enterobacter kobei strain DSM 13645 chromosome, complete genome	4880257	2878481	2937007	4880257	coat,tail,transposase	Escherichia_phage(27.27%)	56	NA	NA
WP_069602196.1|2878481_2879444_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_047626991.1|2879440_2881825_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_014884347.1|2881800_2882559_-	molecular chaperone	NA	NA	NA	NA	NA
WP_032636170.1|2882575_2883124_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_023337442.1|2883136_2883709_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_014884350.1|2884138_2885398_+	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_014884351.1|2885501_2886005_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_047626983.1|2886024_2888061_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_014884353.1|2888065_2888995_-	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_008500417.1|2888991_2889879_-	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_014884354.1|2890002_2890581_-	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_078310272.1|2890583_2890943_-	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_014884355.1|2891728_2892157_+	universal stress protein UspC	NA	NA	NA	NA	NA
WP_014884356.1|2892173_2893598_-	alpha,alpha-trehalose-phosphate synthase	NA	NA	NA	NA	NA
WP_063614365.1|2893572_2894376_-	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_014884358.1|2894552_2895533_-	arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
WP_014884359.1|2895547_2897062_-	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	28.0	1.5e-13
WP_008500409.1|2897133_2898123_-	arabinose ABC transporter substrate-binding protein AraF	NA	NA	NA	NA	NA
WP_014884361.1|2898911_2899415_+	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_014884362.1|2899569_2900913_+	anaerobic C4-dicarboxylate transporter	NA	NA	NA	NA	NA
WP_014884363.1|2900955_2901207_-	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
WP_014884364.1|2901315_2901399_-	stress response protein AzuC	NA	NA	NA	NA	NA
WP_069602197.1|2901636_2901975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014884366.1|2902172_2902670_+	non-heme ferritin	NA	NA	NA	NA	NA
WP_048997443.1|2902706_2903048_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048997444.1|2903279_2904491_+	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_069602198.1|2904523_2905192_-	YecA family protein	NA	V5LQX0	Emiliania_huxleyi_virus	31.2	1.1e-05
WP_000019445.1|2905795_2906776_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
WP_069602199.1|2907187_2909230_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_047653976.1|2909222_2910677_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_137984540.1|2910698_2911867_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	95.4	6.2e-177
WP_069602200.1|2912181_2912673_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069602201.1|2915230_2915971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008500348.1|2916658_2917207_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_014884376.1|2917263_2919096_-	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_023330806.1|2919092_2919749_-	UvrY/SirA/GacA family response regulator transcription factor	NA	NA	NA	NA	NA
WP_014832453.1|2920213_2920438_+	DUF2594 family protein	NA	NA	NA	NA	NA
WP_047625769.1|2920504_2921227_-	transcriptional regulator SdiA	NA	NA	NA	NA	NA
WP_014884379.1|2921448_2922201_-	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.9	2.9e-26
WP_014884380.1|2922197_2922866_-	cystine ABC transporter permease	NA	NA	NA	NA	NA
WP_023330807.1|2922887_2923874_-	D-cysteine desulfhydrase	NA	NA	NA	NA	NA
WP_014884382.1|2923981_2924782_-	cystine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_014884383.1|2924868_2925420_-	flagella biosynthesis regulatory protein FliZ	NA	NA	NA	NA	NA
WP_014170714.1|2925474_2926194_-	RNA polymerase sigma factor FliA	NA	NA	NA	NA	NA
WP_063308697.1|2926357_2927710_-	FliC/FljB family flagellin	NA	NA	NA	NA	NA
WP_063308698.1|2927979_2929392_+	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
WP_014884387.1|2929422_2929833_+	flagellar export chaperone FliS	NA	NA	NA	NA	NA
WP_014884388.1|2929832_2930204_+	flagella biosynthesis regulatory protein FliT	NA	NA	NA	NA	NA
WP_045135352.1|2930301_2931789_+	alpha-amylase	NA	NA	NA	NA	NA
WP_045135351.1|2931882_2932296_-	lipoprotein	NA	NA	NA	NA	NA
WP_069602202.1|2932525_2932915_-	DNA polymerase V	NA	G8C7R9	Escherichia_phage	90.7	8.9e-64
WP_069602203.1|2933028_2933391_+	GtrA family protein	NA	U5P0S6	Shigella_phage	79.2	5.4e-47
WP_069602204.1|2933387_2934320_+	glycosyltransferase family 2 protein	NA	U5P087	Shigella_phage	91.1	9.4e-160
WP_071978058.1|2934329_2935832_+	glucosyltransferase domain-containing protein	NA	Q8LTG0	Salmonella_phage	26.6	2.1e-36
WP_071978059.1|2935981_2936254_+	hypothetical protein	NA	I6NRL3	Burkholderia_virus	45.5	4.5e-06
WP_080964260.1|2936644_2937007_-|tail	tail fiber domain-containing protein	tail	A0A2I6PD03	Escherichia_phage	57.9	6.2e-27
>prophage 9
NZ_CP017181	Enterobacter kobei strain DSM 13645 chromosome, complete genome	4880257	3026641	3034069	4880257		Enterobacteria_phage(50.0%)	7	NA	NA
WP_045281012.1|3026641_3027646_+	NAD-dependent epimerase	NA	A0A2K9L4U8	Tupanvirus	30.7	1.0e-34
WP_045134937.1|3027697_3028864_-	UDP-glucose 6-dehydrogenase	NA	A0A1J0FA55	Only_Syngen_Nebraska_virus	53.0	3.5e-111
WP_014884476.1|3029118_3030525_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	4.0e-37
WP_023330866.1|3030660_3031209_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	55.0	4.1e-54
WP_069602221.1|3031219_3032116_-	dTDP-4-dehydrorhamnose reductase	NA	NA	NA	NA	NA
WP_014884479.1|3032122_3032989_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.7	4.1e-109
WP_014884480.1|3033004_3034069_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.8	1.1e-100
>prophage 10
NZ_CP017181	Enterobacter kobei strain DSM 13645 chromosome, complete genome	4880257	3200351	3207898	4880257		Salmonella_phage(37.5%)	9	NA	NA
WP_069602251.1|3200351_3200672_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	97.2	2.1e-55
WP_032647577.1|3201022_3201385_+	GtrA family protein	NA	B9UDL8	Salmonella_phage	71.7	4.3e-44
WP_069602252.1|3201381_3202299_+	glycosyltransferase family 2 protein	NA	U5P087	Shigella_phage	91.8	6.4e-161
WP_137984544.1|3202300_3203935_+	hypothetical protein	NA	B9UDL6	Salmonella_phage	33.4	5.8e-48
WP_069602254.1|3204152_3206204_-	hypothetical protein	NA	B1GS50	Salmonella_phage	55.8	1.6e-23
WP_063928810.1|3206486_3206732_-	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	52.0	2.7e-10
WP_069602491.1|3206880_3207207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069602255.1|3207220_3207478_-	hypothetical protein	NA	G8C7W3	Escherichia_phage	53.3	3.6e-13
WP_069602257.1|3207619_3207898_-	hypothetical protein	NA	K7PGW4	Enterobacterial_phage	95.7	6.1e-06
>prophage 11
NZ_CP017181	Enterobacter kobei strain DSM 13645 chromosome, complete genome	4880257	3523085	3532687	4880257	holin	Salmonella_phage(28.57%)	9	NA	NA
WP_032637829.1|3523085_3523634_-	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	80.6	2.6e-77
WP_017692897.1|3525044_3525275_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032637826.1|3526369_3526639_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	83.1	1.5e-30
WP_032635818.1|3526646_3527276_-	glycoside hydrolase family 19 protein	NA	G8C7W0	Escherichia_phage	87.6	5.1e-101
WP_045892218.1|3527275_3527557_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	46.2	7.5e-20
WP_015570936.1|3527543_3527930_-|holin	phage holin family protein	holin	A0A192Y8P2	Salmonella_phage	78.1	3.2e-45
WP_015570937.1|3528107_3529070_-	hypothetical protein	NA	A9YX09	Burkholderia_phage	44.7	3.3e-67
WP_137984547.1|3530465_3530558_-	YlcG family protein	NA	NA	NA	NA	NA
WP_032635812.1|3531601_3532687_+	recombinase RecT	NA	K7PKR8	Enterobacteria_phage	53.5	7.0e-106
>prophage 12
NZ_CP017181	Enterobacter kobei strain DSM 13645 chromosome, complete genome	4880257	3540242	3716056	4880257	portal,terminase,head,transposase,tail,tRNA,integrase,capsid	Salmonella_phage(50.0%)	173	3625868:3625895	3715766:3715778
WP_045135187.1|3540242_3540980_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_014884852.1|3541112_3542441_+	ATP-dependent RNA helicase SrmB	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	31.8	7.1e-44
WP_014884853.1|3542493_3542877_-	autonomous glycyl radical cofactor GrcA	NA	A0A193GZ98	Escherichia_phage	72.8	7.3e-34
WP_014884854.1|3543191_3543881_+	uracil-DNA glycosylase	NA	A0A076JX67	Equid_alphaherpesvirus	48.8	1.3e-54
WP_014884855.1|3543921_3545052_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_014884856.1|3545256_3545676_+	thioredoxin TrxC	NA	A0A1J0GW78	Streptomyces_phage	40.2	7.7e-13
WP_045135188.1|3545745_3546444_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_069602302.1|3546479_3549143_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_023331103.1|3549253_3550609_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_014884860.1|3550654_3550978_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_069602303.1|3550974_3552270_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.4	3.1e-44
WP_014884862.1|3557883_3560457_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.2	5.3e-128
WP_014884863.1|3560587_3561319_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_014884864.1|3561315_3562296_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_014884865.1|3562427_3563165_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_014884866.1|3563432_3563774_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_100249759.1|3563878_3563926_+	pheA operon leader peptide PheL	NA	NA	NA	NA	NA
WP_023331106.1|3564033_3565194_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_069602304.1|3565190_3566063_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_023337646.1|3566123_3567245_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_014884870.1|3567255_3568326_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.5	9.0e-90
WP_014884871.1|3568540_3568915_+	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_023337647.1|3569008_3569605_+	YfiR family protein	NA	NA	NA	NA	NA
WP_014884873.1|3569597_3570818_+	diguanylate cyclase DgcN	NA	A0A2K8I9Y5	Pseudomonas_phage	39.8	1.9e-06
WP_069602305.1|3570830_3571316_+	OmpA family protein	NA	NA	NA	NA	NA
WP_063614188.1|3571318_3572689_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_045281750.1|3572727_3573132_-	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
WP_002914145.1|3573264_3573612_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_014884877.1|3573655_3574423_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_028014127.1|3574454_3574994_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_003863133.1|3575009_3575258_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_014884878.1|3575374_3576736_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_014884879.1|3576902_3577694_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_032635780.1|3577712_3578999_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_014884881.1|3579050_3579644_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_008502500.1|3579766_3580645_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_069602306.1|3580730_3582392_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_014884883.1|3582530_3582869_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_023331115.1|3582977_3583265_-	RnfH family protein	NA	NA	NA	NA	NA
WP_023331116.1|3583254_3583731_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_008502505.1|3583848_3584331_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	2.3e-29
WP_045334934.1|3584899_3585118_-	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	94.4	5.7e-36
WP_069602307.1|3585186_3586287_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	91.5	2.7e-182
WP_069602308.1|3586283_3586712_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	88.0	1.6e-58
WP_014884891.1|3587870_3588269_-|tail	tail fiber assembly protein	tail	N0DPE7	Edwardsiella_phage	58.5	2.4e-11
WP_014884903.1|3588494_3588962_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	58.7	1.3e-48
WP_032678727.1|3589060_3589714_-	hypothetical protein	NA	E5G6M7	Salmonella_phage	56.1	5.2e-56
WP_069602309.1|3589717_3590866_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	66.7	1.5e-130
WP_032665781.1|3590881_3591709_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	67.4	4.1e-74
WP_069602310.1|3591858_3593622_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	87.4	2.9e-311
WP_069602311.1|3593621_3594674_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	79.0	2.1e-155
WP_069602312.1|3594705_3596145_-	TIR domain-containing protein	NA	NA	NA	NA	NA
WP_014884911.1|3596508_3597096_-	hypothetical protein	NA	S5M7T3	Escherichia_phage	37.2	4.5e-19
WP_080021220.1|3597137_3597536_-	DUF4065 domain-containing protein	NA	Q0H268	Geobacillus_phage	36.0	1.1e-08
WP_014884913.1|3598016_3598250_-	DinI family protein	NA	A0A1S6L014	Salmonella_phage	87.0	1.2e-31
WP_014884914.1|3598260_3598449_-	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	90.0	3.7e-23
WP_069602314.1|3598608_3599304_-	DNA adenine methylase	NA	A0A0M4S5U3	Salmonella_phage	74.1	1.1e-93
WP_069602315.1|3599455_3601759_-	replication endonuclease	NA	A0A0M4RTM8	Salmonella_phage	63.1	2.9e-271
WP_071978060.1|3601751_3602816_-	DNA cytosine methyltransferase	NA	A0A0M3ULA1	Salmonella_phage	51.3	2.8e-91
WP_000019951.1|3603976_3604249_-	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_001572377.1|3604370_3605486_+	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000723070.1|3605743_3606178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001572376.1|3606395_3607742_-	copper resistance membrane spanning protein PcoS	NA	W8CYF6	Bacillus_phage	26.6	2.3e-18
WP_072196614.1|3607780_3608749_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.8	1.1e-184
WP_001572373.1|3608937_3610557_+	phosphoethanolamine--lipid A transferase MCR-9.1	NA	NA	NA	NA	NA
WP_001572372.1|3610633_3611110_+	WbuC family cupin fold metalloprotein	NA	NA	NA	NA	NA
WP_001572371.1|3611322_3612672_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_001572368.1|3612647_3613316_-	response regulator	NA	NA	NA	NA	NA
WP_020978935.1|3613509_3613800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000427614.1|3613903_3614908_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_001572363.1|3616754_3617459_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	9.0e-139
WP_001572362.1|3617612_3618635_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_069602317.1|3619680_3620010_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2I6TCA4	Escherichia_phage	42.2	4.1e-17
WP_000780222.1|3619990_3620272_+	helix-turn-helix transcriptional regulator	NA	A0A2I6TC97	Escherichia_phage	38.0	1.3e-08
WP_023312637.1|3621173_3621878_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	5.3e-139
WP_047064190.1|3621982_3623212_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000427614.1|3624556_3625561_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
3625868:3625895	attL	GCCTCACCCTTATTCAGCCCCGCCTGTA	NA	NA	NA	NA
WP_004729622.1|3626000_3626753_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
3625868:3625895	attL	GCCTCACCCTTATTCAGCCCCGCCTGTA	NA	NA	NA	NA
WP_001567390.1|3626993_3627863_+	DMT family transporter	NA	NA	NA	NA	NA
3625868:3625895	attL	GCCTCACCCTTATTCAGCCCCGCCTGTA	NA	NA	NA	NA
WP_023287190.1|3627996_3629220_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_004729618.1|3629405_3630179_-	SDR family oxidoreductase	NA	A0A0M4JSW6	Mollivirus	26.0	7.3e-09
WP_020277918.1|3630244_3630946_-	DsbA family oxidoreductase	NA	NA	NA	NA	NA
WP_006687059.1|3631011_3632118_-	alkene reductase	NA	NA	NA	NA	NA
WP_002431133.1|3632331_3632661_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_000888080.1|3632690_3633029_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_020277920.1|3633033_3633615_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000108589.1|3633756_3634314_-	OsmC family protein	NA	NA	NA	NA	NA
WP_012695450.1|3634498_3635083_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	35.5	9.7e-22
WP_057072953.1|3635242_3635935_+	DUF4158 domain-containing protein	NA	NA	NA	NA	NA
WP_000427614.1|3636116_3637121_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_024552202.1|3637199_3637634_-	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_024552203.1|3637705_3638056_+	mercuric ion transporter MerT	NA	NA	NA	NA	NA
WP_024552204.1|3638068_3638344_+	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_024552205.1|3638371_3638794_+	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_069602318.1|3638833_3640519_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.3	1.9e-38
WP_021138753.1|3640536_3640902_+	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_021138754.1|3640898_3641135_+	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_024552207.1|3641131_3642121_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_036595897.1|3642243_3643962_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_028604704.1|3643964_3644873_+	TniB family NTP-binding protein	NA	NA	NA	NA	NA
WP_069602319.1|3644869_3646087_+	TniQ family protein	NA	NA	NA	NA	NA
WP_000904941.1|3646147_3646762_+	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	51.9	1.3e-37
WP_001087809.1|3646814_3647051_-	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_003465059.1|3647047_3647413_-	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000136268.1|3647429_3649076_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.3	1.0e-39
WP_000654684.1|3649072_3649318_-	mercury resistance system transport protein MerF	NA	NA	NA	NA	NA
WP_000735441.1|3649320_3649596_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001294667.1|3649611_3649962_-	mercuric ion transporter MerT	NA	NA	NA	NA	NA
WP_000429838.1|3650033_3650468_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_000427623.1|3650567_3651572_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_074422537.1|3651753_3651930_-|integrase	integrase	integrase	NA	NA	NA	NA
WP_003100858.1|3651965_3652292_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003465043.1|3652546_3652903_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_069602320.1|3653671_3656659_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	53.3	6.0e-293
3654015:3654042	attR	GCCTCACCCTTATTCAGCCCCGCCTGTA	NA	NA	NA	NA
WP_039265225.1|3656826_3657468_+	recombinase family protein	NA	NA	NA	NA	NA
3654015:3654042	attR	GCCTCACCCTTATTCAGCCCCGCCTGTA	NA	NA	NA	NA
WP_039265224.1|3657772_3658588_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
3654015:3654042	attR	GCCTCACCCTTATTCAGCCCCGCCTGTA	NA	NA	NA	NA
WP_039265223.1|3658616_3659378_+	SDR family NAD(P)-dependent oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	25.1	8.3e-05
WP_039265222.1|3659420_3660620_+	MFS transporter	NA	NA	NA	NA	NA
WP_039265221.1|3660630_3661566_+	GlxA family transcriptional regulator	NA	NA	NA	NA	NA
WP_039265220.1|3663069_3663603_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_022542389.1|3666472_3667477_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_011191356.1|3668071_3669121_+	P-type conjugative transfer protein TrbG	NA	NA	NA	NA	NA
WP_011191355.1|3669117_3670338_+	TrbI/VirB10 family protein	NA	NA	NA	NA	NA
WP_018429611.1|3670337_3670577_+	DUF2274 domain-containing protein	NA	NA	NA	NA	NA
WP_004357616.1|3671725_3672259_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004099025.1|3672285_3673245_+	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_004099026.1|3673283_3673670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004099027.1|3673940_3674429_+	DUF417 family protein	NA	NA	NA	NA	NA
WP_004357657.1|3674487_3674670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026227539.1|3674905_3675481_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_069602321.1|3675877_3676903_-	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_025760400.1|3676902_3677496_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_004357650.1|3677498_3678731_-	OsmC family protein	NA	NA	NA	NA	NA
WP_018716209.1|3678875_3679835_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004099035.1|3679981_3680425_+	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_004099036.1|3680426_3680966_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_004099038.1|3681098_3681803_+	glutathione S-transferase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_004357645.1|3681799_3682768_+	magnesium and cobalt transport protein CorA	NA	NA	NA	NA	NA
WP_004099040.1|3682859_3683432_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004099042.1|3683519_3683969_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004099044.1|3684075_3684477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004357638.1|3684507_3685779_-	MFS transporter	NA	NA	NA	NA	NA
WP_004357637.1|3685766_3686279_-	DM13 domain-containing protein	NA	NA	NA	NA	NA
WP_011191345.1|3686282_3686753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011191344.1|3686904_3687195_-	DUF1330 domain-containing protein	NA	NA	NA	NA	NA
WP_004357630.1|3687257_3687689_-	heme-binding protein	NA	NA	NA	NA	NA
WP_011191343.1|3687762_3688773_-	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_033982388.1|3689378_3689984_+	sulfite oxidase-like oxidoreductase	NA	NA	NA	NA	NA
WP_044059343.1|3689976_3690720_+	ferredoxin reductase	NA	NA	NA	NA	NA
WP_033982398.1|3690788_3692054_+	thiolase family protein	NA	NA	NA	NA	NA
WP_046092728.1|3692448_3692730_+	DUF427 domain-containing protein	NA	NA	NA	NA	NA
WP_018429638.1|3692900_3693167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110277527.1|3693378_3696180_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.1	0.0e+00
WP_069602322.1|3696258_3697263_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_167353006.1|3697444_3698017_-	signal peptidase II	NA	NA	NA	NA	NA
WP_004364974.1|3698020_3698917_-	cation transporter	NA	NA	NA	NA	NA
WP_004364961.1|3699012_3699420_+	Cd(II)/Pb(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_001189111.1|3700707_3702216_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
WP_001097217.1|3704367_3704667_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_033144814.1|3705029_3705956_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024143025.1|3705967_3707524_-	TnsD family Tn7-like transposition protein	NA	NA	NA	NA	NA
WP_069602323.1|3707565_3709014_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_069602324.1|3709013_3711137_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_024551180.1|3711123_3711966_-	TnsA endonuclease N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_023307009.1|3712233_3712461_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	80.0	5.4e-29
WP_014884920.1|3712460_3712694_-	DUF2732 domain-containing protein	NA	A0A1S6L021	Salmonella_phage	67.5	8.1e-20
WP_014884921.1|3712763_3712964_-	hypothetical protein	NA	A0A0M5M7U3	Salmonella_phage	73.8	3.0e-23
WP_014884922.1|3712950_3713178_-	DUF2724 domain-containing protein	NA	A0A0M4RTI3	Salmonella_phage	74.7	1.6e-25
WP_069602325.1|3713185_3713695_-	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	87.6	1.7e-78
WP_000102104.1|3713730_3713970_-	hypothetical protein	NA	A0A1S6KZZ6	Salmonella_phage	98.7	8.8e-38
WP_063849407.1|3714089_3714722_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	60.0	1.1e-66
WP_069602326.1|3714724_3715747_+|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	93.8	1.2e-189
WP_137984548.1|3715750_3716056_+	hypothetical protein	NA	E5G6K9	Salmonella_phage	41.1	6.6e-14
>prophage 13
NZ_CP017181	Enterobacter kobei strain DSM 13645 chromosome, complete genome	4880257	4102369	4232658	4880257	transposase,tRNA,holin,integrase,protease	Escherichia_phage(14.81%)	110	4192448:4192507	4239280:4240475
WP_014885283.1|4102369_4103383_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.6	1.8e-108
WP_001144069.1|4103619_4103835_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_014885284.1|4103950_4105696_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	39.0	3.2e-76
WP_014885285.1|4105861_4107706_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
WP_014885286.1|4107808_4108315_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_069602376.1|4109731_4110952_+	CHASE domain-containing protein	NA	NA	NA	NA	NA
WP_001067855.1|4110998_4111703_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001023257.1|4115540_4115990_-	copper resistance protein	NA	NA	NA	NA	NA
WP_000925242.1|4116224_4118042_+	multicopper oxidase PcoA	NA	NA	NA	NA	NA
WP_032664822.1|4118041_4118938_+	copper resistance outer membrane transporter PcoB	NA	NA	NA	NA	NA
WP_000025662.1|4118977_4119358_+	copper resistance system metallochaperone PcoC	NA	NA	NA	NA	NA
WP_000998778.1|4119362_4120292_+	copper resistance inner membrane protein PcoD	NA	NA	NA	NA	NA
WP_001188930.1|4120346_4121027_+	copper response regulator transcription factor PcoR	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
WP_032638101.1|4121023_4122424_+	copper resistance membrane spanning protein PcoS	NA	W8CYF6	Bacillus_phage	26.6	2.4e-18
WP_004388336.1|4122639_4123074_+	copper resistance system metallochaperone PcoE	NA	NA	NA	NA	NA
WP_032638098.1|4123297_4123594_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_013087106.1|4123580_4123841_-	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_032638097.1|4124858_4125629_+	conjugal transfer protein TraX	NA	NA	NA	NA	NA
WP_032638096.1|4125759_4126086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032638095.1|4126060_4126867_-	DUF4225 domain-containing protein	NA	NA	NA	NA	NA
WP_069602377.1|4127746_4128760_-	replication initiation protein	NA	NA	NA	NA	NA
WP_007869691.1|4129412_4129679_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_013087269.1|4129666_4130152_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_069602379.1|4132231_4133218_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_023328886.1|4133343_4133649_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069602380.1|4133688_4134669_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	57.7	1.4e-92
WP_003847784.1|4134893_4136045_-	trypsin-like peptidase domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	30.3	9.9e-26
WP_069602381.1|4136069_4137035_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_060657179.1|4137012_4137510_-	heat resistance protein PsiE-GI	NA	NA	NA	NA	NA
WP_069602382.1|4137512_4139222_-	heat resistance system K+/H+ antiporter KefB-GI	NA	NA	NA	NA	NA
WP_069602383.1|4139225_4139666_-	heat resistance system thioredoxin Trx-GI	NA	A0A1J0GW78	Streptomyces_phage	37.7	9.9e-11
WP_004118192.1|4139655_4140801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069602384.1|4140880_4141492_-	heat resistance membrane protein HdeD-GI	NA	NA	NA	NA	NA
WP_004118195.1|4141581_4142469_-	heat resistance protein YfdX2	NA	NA	NA	NA	NA
WP_001022486.1|4142571_4143486_-	heat resistance protein YfdX1	NA	NA	NA	NA	NA
WP_001275372.1|4143508_4143967_-	small heat shock protein sHSP20-GI	NA	NA	NA	NA	NA
WP_023205099.1|4144054_4144195_-|protease	ATP-dependent metalloprotease FtsH	protease	NA	NA	NA	NA
WP_017146640.1|4144942_4145134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069602385.1|4145133_4147983_-	heat shock survival AAA family ATPase ClpK	NA	K4FB40	Cronobacter_phage	41.1	2.6e-128
WP_069602386.1|4148088_4148658_-	small heat shock protein sHSP20	NA	NA	NA	NA	NA
WP_000643630.1|4148692_4148974_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004118208.1|4149195_4149459_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071978066.1|4149473_4149737_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_004181997.1|4150887_4151895_-	formamidase	NA	NA	NA	NA	NA
WP_004181996.1|4151930_4152620_-	urea ABC transporter ATP-binding subunit UrtE	NA	A0A2H4PQG7	Staphylococcus_phage	29.9	5.9e-18
WP_004181995.1|4152630_4153380_-	urea ABC transporter ATP-binding protein UrtD	NA	A0A2H4PQG7	Staphylococcus_phage	26.4	2.4e-17
WP_032638062.1|4153376_4154492_-	urea ABC transporter permease subunit UrtC	NA	NA	NA	NA	NA
WP_004181993.1|4154501_4155428_-	urea ABC transporter permease subunit UrtB	NA	NA	NA	NA	NA
WP_004197507.1|4155484_4156675_-	urea ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_069602389.1|4156979_4160360_+	response regulator	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.8	5.8e-34
WP_004181990.1|4160322_4161243_+	two-component system response regulator RssB	NA	W8CYM9	Bacillus_phage	34.1	2.0e-13
WP_081330974.1|4162239_4163208_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	91.3	1.7e-172
WP_000427614.1|4163481_4164486_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_069602392.1|4166446_4168180_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.7	1.1e-15
WP_004118225.1|4168187_4169135_-	acetamidase/formamidase family protein	NA	NA	NA	NA	NA
WP_004152278.1|4169179_4170784_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004118227.1|4170796_4171717_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_004118228.1|4171716_4172565_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_004118229.1|4172561_4173155_-	ANTAR domain-containing protein	NA	NA	NA	NA	NA
WP_004118840.1|4173151_4174279_-	transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004118231.1|4174563_4174731_-|integrase	integrase	integrase	NA	NA	NA	NA
WP_161989521.1|4174659_4174872_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025760133.1|4176042_4177041_-	endoglucanase	NA	NA	NA	NA	NA
WP_025760132.1|4177049_4177529_-	cellulose synthase	NA	NA	NA	NA	NA
WP_032672713.1|4177528_4181569_-	cellulose biosynthesis protein BcsC	NA	NA	NA	NA	NA
WP_069602393.1|4181582_4183877_-	cellulose biosynthesis cyclic di-GMP-binding regulatory protein BcsB	NA	NA	NA	NA	NA
WP_025760128.1|4186004_4186808_-	cellulose synthase operon protein YhjQ	NA	NA	NA	NA	NA
WP_047028230.1|4186798_4187386_-	cellulose biosynthesis protein BcsO	NA	NA	NA	NA	NA
WP_137984550.1|4187709_4188417_-|transposase	IS5 family transposase	transposase	Q38213	Escherichia_phage	68.1	1.8e-110
WP_069602397.1|4189769_4190117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081330975.1|4190155_4190572_-	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	46.4	2.9e-12
WP_158008545.1|4190547_4190958_-	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	81.2	9.8e-45
WP_069602398.1|4191030_4191336_-	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	84.2	2.5e-45
WP_014885294.1|4191881_4192103_-	hypothetical protein	NA	NA	NA	NA	NA
4192448:4192507	attL	GGAAGGTGCGAATAAGCAGGTCATTTCTTCCCAAGCTGACTCGCTGATTAAAATTTCGCG	NA	NA	NA	NA
WP_000019445.1|4192594_4193575_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
WP_081330977.1|4193628_4194027_+	transcriptional regulator	NA	F1BUS8	Erwinia_phage	30.4	9.0e-11
WP_014885296.1|4194043_4194610_+	PH domain-containing protein	NA	Q4ZA70	Staphylococcus_virus	32.8	3.7e-18
WP_069602399.1|4195511_4196681_+	DNA repair protein	NA	NA	NA	NA	NA
WP_069602400.1|4196681_4197446_-	siderophore-interacting protein	NA	NA	NA	NA	NA
WP_014885300.1|4197593_4198088_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_069602401.1|4199980_4201501_-	PAS domain-containing methyl-accepting chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	47.8	1.4e-32
WP_032635487.1|4201936_4203316_+	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	27.6	5.8e-33
WP_023331347.1|4203388_4203991_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_069602402.1|4204033_4204720_+	B3/4 domain-containing protein	NA	NA	NA	NA	NA
WP_069602403.1|4204732_4205581_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_045268585.1|4205731_4206703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023331350.1|4206744_4207038_-	(4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase	NA	NA	NA	NA	NA
WP_014885309.1|4207034_4207922_-	3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase	NA	NA	NA	NA	NA
WP_014885310.1|4207933_4208935_-	autoinducer 2 ABC transporter substrate-binding protein LsrB	NA	NA	NA	NA	NA
WP_045134798.1|4208936_4209914_-	autoinducer 2 import system permease LsrD	NA	NA	NA	NA	NA
WP_023338805.1|4209914_4210946_-	autoinducer 2 ABC transporter permease LsrC	NA	NA	NA	NA	NA
WP_069602404.1|4210942_4212430_-	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	31.0	3.4e-18
WP_023338807.1|4212645_4213614_+	transcriptional regulator LsrR	NA	NA	NA	NA	NA
WP_047625402.1|4213648_4215229_+	autoinducer-2 kinase	NA	NA	NA	NA	NA
WP_069602405.1|4215414_4217436_+	NADPH-dependent 2,4-dienoyl-CoA reductase	NA	NA	NA	NA	NA
WP_069601972.1|4217538_4218696_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_014885317.1|4218814_4219951_-	23S rRNA (guanine(1835)-N(2))-methyltransferase RlmG	NA	NA	NA	NA	NA
WP_014885318.1|4220034_4220538_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_014885319.1|4220608_4221607_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_069602406.1|4221858_4222824_+	TerC family protein	NA	A0A291LBC5	Escherichia_phage	32.8	2.6e-35
WP_023331360.1|4223035_4224277_+	serine/threonine transporter SstT	NA	NA	NA	NA	NA
WP_023337835.1|4224370_4225858_-	altronate dehydratase	NA	NA	NA	NA	NA
WP_014885323.1|4225875_4227288_-	glucuronate isomerase	NA	NA	NA	NA	NA
WP_023331362.1|4227762_4229061_+	MFS transporter	NA	NA	NA	NA	NA
WP_014885325.1|4229242_4230019_+	transcriptional regulator ExuR	NA	NA	NA	NA	NA
WP_014885326.1|4230362_4231025_+	DedA family protein	NA	NA	NA	NA	NA
WP_014885327.1|4231027_4231411_+	EnvZ/OmpR regulon moderator MzrA	NA	NA	NA	NA	NA
WP_014885328.1|4231554_4231923_+	DUF1090 domain-containing protein	NA	NA	NA	NA	NA
WP_008503141.1|4231952_4232258_+	DUF883 domain-containing protein	NA	NA	NA	NA	NA
WP_014885329.1|4232259_4232658_+|holin	phage holin family protein	holin	NA	NA	NA	NA
4239280:4240475	attR	GGAAGGTGCGAATAAGCAGGTCATTTCTTCCCAAGCTGACTCGCTGATTAAAATTTCGCGGATCTGGGCCGATTTTTTTCCCGCAAACACATCGAATCAGCCTATTTAGGCTATTTTTTCCACCATTTCTGGCGTTATTTCCGGTTTTTACTGAGATCTCTCCCACTGACGTATCATTTGGTCCACCCGAAACAGGTTGGCCAGGGTGAATAACATCGCCAGTTGGTTATCGTTTTTCAGCAGCCCTTTGTATCTGGCTTTCACGAAGCCGAACTGCCGCTTGATGATGCGAAACGGGTGCTCCACCCTGGCACGGATGCTGGCTTTCATGTATTCGATGTTGATGGCCGTTTTGTTCTTGCGCGGATGCTGCTTCAAGGTTTTTACCTTGCCGGGACGCTCGGCGATCAGCCAGTCCACATCCACCTCGGCCAGCTCCTCGCGCTGTGGCGCTCCTTGGTAGCCGGCATCGGCTGAGACAAATTGCTCCTCTCCATGAAGCAGATTACCCAGCTGATTGAGGTCATGCTCGTTGGCCGCGGTGGTGACCAGGCTGTGGGTCAGGCCACTCTTGGCATCGACACCAATGTGGGCCTTCATGCCAAAGTGCCACTGATTGCCTTTCTTGGTCTGATGCATCTCCGGATCGCGTTGCTGCTCTTTGTTCTTGGTAGAGCTGGGTGCCTCAATGATGGTGGCATCCACCAAAGTGCCTTGGGTCATCATGACGCCTGCTTCGGCCAGCCAGCGATTGATGGTCTTGAACAATTGACGGGCCAGTTGATGCTGCTCGAGCAGGTGGCGGAAATTCATGATGGTGGTGCGATCCGGCAGGGCGCTATCCAGGGATAATCGGGCAAACAGGCGCATGGAGGCGATTTCGTACAGGGCATCTTCCATGGCACCGTCGCTCAGGTTGTACCAATGCTGCATGCAGTGAATACGCAGCATGGTCTCCAGCGGATAGGGCCGTCGGCCATTGCCCGCCTTGGGATAAAACGGCTCGATGACAGCGGTCATATTCTGCCATGGCAGAATCTGCTCCATGCGGGAGAGGAAAATCTCTTTTCGGGTCTGACGGCGCTTAGTGCTGAATTCACTATCGGCGAAGGTGAGTTGATGGCTCATGATGTCCCTCTGGGATGCGCTCCGGATGAATATGATGATCTCATATCAGGAACTTGTTCGCACCTTCC	NA	NA	NA	NA
>prophage 1
NZ_CP017182	Enterobacter kobei strain DSM 13645 plasmid pDSMZ13645, complete sequence	47221	0	7188	47221	integrase	Macacine_betaherpesvirus(75.0%)	4	3008:3020	8081:8093
WP_013087134.1|1826_2792_-	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	76.9	9.8e-136
WP_023327689.1|2791_3958_-	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	94.3	5.5e-218
3008:3020	attL	TTCTTCCATCCAG	NA	NA	NA	NA
WP_015572055.1|4698_5709_+	replication initiation protein	NA	J9Q7H0	Salmonella_phage	55.2	6.3e-85
WP_015572054.1|6411_7188_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	91.2	7.0e-52
8081:8093	attR	TTCTTCCATCCAG	NA	NA	NA	NA
>prophage 2
NZ_CP017182	Enterobacter kobei strain DSM 13645 plasmid pDSMZ13645, complete sequence	47221	16738	20063	47221		Bacillus_phage(66.67%)	4	NA	NA
WP_000694953.1|16738_17089_-	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	54.3	1.9e-20
WP_000790483.1|17232_17664_-	silver-binding protein SilE	NA	NA	NA	NA	NA
WP_032638115.1|17914_19390_-	copper/silver sensor histidine kinase SilS	NA	W8CYF6	Bacillus_phage	30.5	2.1e-28
WP_001572351.1|19382_20063_-	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	35.6	2.1e-31
>prophage 3
NZ_CP017182	Enterobacter kobei strain DSM 13645 plasmid pDSMZ13645, complete sequence	47221	23436	30549	47221		Leptospira_phage(33.33%)	5	NA	NA
WP_000574021.1|23436_26583_+	Cu(+)/Ag(+) efflux RND transporter permease subunit SilA	NA	S5VTK5	Leptospira_phage	22.6	8.0e-62
WP_008322815.1|26669_27110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069602501.1|27236_29684_+	Ag(+)-translocating P-type ATPase SilP	NA	A0A218MNH6	uncultured_virus	34.9	7.6e-84
WP_000843494.1|29724_29922_+	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_137984562.1|29955_30549_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A2H4JAF5	uncultured_Caudovirales_phage	31.9	1.0e-10
>prophage 4
NZ_CP017182	Enterobacter kobei strain DSM 13645 plasmid pDSMZ13645, complete sequence	47221	38464	47040	47221	transposase	Stx2-converting_phage(50.0%)	8	NA	NA
WP_137984563.1|38464_38743_+|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	97.7	1.2e-43
WP_000612626.1|38864_39212_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_032638099.1|39260_40799_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	93.6	6.3e-278
WP_069602503.1|40901_42467_+	MCP four helix bundle domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	28.2	2.9e-12
WP_013087140.1|44243_44447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049022775.1|44741_45404_-	plasmid partitioning/stability family protein	NA	NA	NA	NA	NA
WP_081330987.1|45406_46378_-	StbA family protein	NA	A0A222YXF2	Escherichia_phage	47.1	4.1e-73
WP_013087136.1|46608_47040_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.3	1.0e-28
