The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP017184	Enterobacter roggenkampii strain DSM 16690 chromosome, complete genome	4748414	2068211	2078288	4748414		Oenococcus_phage(16.67%)	9	NA	NA
WP_069598216.1|2068211_2069426_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.4	8.2e-47
WP_025911408.1|2069440_2070460_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	27.7	4.6e-19
WP_069598217.1|2070533_2071901_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_069598218.1|2072122_2073586_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.3	7.8e-44
WP_014883679.1|2073629_2073833_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	58.2	3.4e-14
WP_044596338.1|2074120_2074552_+	universal stress protein	NA	A0A1W6JNV4	Morganella_phage	34.5	1.4e-17
WP_008502405.1|2074587_2075274_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023292548.1|2075365_2076112_-	bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG	NA	NA	NA	NA	NA
WP_045353886.1|2076254_2078288_+	peptidyl-dipeptidase Dcp	NA	A0A1V0SIU1	Klosneuvirus	22.6	1.1e-19
>prophage 2
NZ_CP017184	Enterobacter roggenkampii strain DSM 16690 chromosome, complete genome	4748414	2552319	2645109	4748414	holin,portal,protease,head,capsid,tail,terminase,integrase,lysis,plate	Escherichia_phage(21.13%)	111	2614689:2614708	2645189:2645208
WP_069598389.1|2552319_2553366_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	28.7	2.8e-19
WP_008502811.1|2553617_2554379_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.0	5.2e-07
WP_069598390.1|2554375_2554966_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_008502809.1|2555001_2555877_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_003856793.1|2555973_2556594_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_032623059.1|2556590_2557472_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_106993556.1|2557611_2557656_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_008502807.1|2557752_2559315_+	anthranilate synthase component 1	NA	NA	NA	NA	NA
WP_008502806.1|2559314_2560910_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	37.9	2.9e-52
WP_008502805.1|2560913_2562272_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	41.0	8.6e-37
WP_008502804.1|2562282_2563476_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_045352391.1|2563475_2564285_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_069598391.1|2564763_2565435_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.1	5.8e-79
WP_069598393.1|2566748_2567675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069598394.1|2567822_2569091_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	92.9	4.7e-231
WP_044857240.1|2569093_2569513_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	57.5	1.9e-35
WP_157888832.1|2569728_2570202_-|tail	tail fiber assembly protein	tail	Q37843	Escherichia_phage	39.1	1.8e-21
WP_069598396.1|2570266_2571592_-	hypothetical protein	NA	Q37842	Escherichia_phage	31.0	5.8e-38
WP_032663409.1|2571594_2572146_-|tail	phage tail protein I	tail	V5YTN0	Pseudomonas_phage	43.6	5.4e-30
WP_069598397.1|2572138_2573053_-|plate	baseplate assembly protein	plate	A0A193GYM8	Enterobacter_phage	47.5	5.2e-62
WP_069598398.1|2573042_2573390_-|plate	baseplate assembly protein	plate	V5YTB2	Pseudomonas_phage	50.4	1.3e-21
WP_069598399.1|2573428_2574547_-	late control protein D	NA	R9TNM7	Vibrio_phage	33.7	4.1e-37
WP_069598400.1|2574548_2574764_-|tail	phage tail protein	tail	R9TR63	Vibrio_phage	48.6	1.3e-11
WP_111967067.1|2574738_2575128_-|tail	phage tail protein	tail	D4HTW5	Vibrio_phage	33.9	1.7e-14
WP_069598401.1|2575205_2576879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032663398.1|2576993_2577281_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_032663397.1|2577339_2577846_-|tail	tail protein	tail	NA	NA	NA	NA
WP_069598402.1|2577842_2579312_-|tail	phage tail protein	tail	R9TMQ0	Vibrio_phage	45.8	2.6e-79
WP_069598403.1|2579350_2579968_-|plate	phage baseplate assembly protein V	plate	F1BUP5	Erwinia_phage	34.0	2.2e-16
WP_047074781.1|2579960_2580515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032663392.1|2580523_2581186_-	hypothetical protein	NA	R9TR34	Vibrio_phage	37.1	1.1e-21
WP_032663389.1|2581187_2581544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069598404.1|2581543_2581879_-	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	41.8	8.4e-10
WP_069598405.1|2581949_2584010_-|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	53.8	9.8e-202
WP_069598406.1|2583999_2585520_-|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	55.8	3.9e-155
WP_032663383.1|2585528_2585744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069598407.1|2585743_2587864_-|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	75.6	1.5e-306
WP_069598408.1|2587863_2588358_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	67.7	2.4e-53
WP_047074764.1|2588770_2589268_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069598409.1|2589680_2590199_-	hypothetical protein	NA	K7PHH7	Enterobacteria_phage	88.9	2.9e-78
WP_069598410.1|2590195_2590732_-	lysozyme	NA	K7PM52	Enterobacteria_phage	87.9	6.5e-89
WP_069598411.1|2590731_2591034_-	hypothetical protein	NA	O64361	Escherichia_phage	67.3	3.1e-32
WP_071965094.1|2591634_2591826_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069598412.1|2592444_2593161_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069598413.1|2593157_2593766_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069598414.1|2594874_2595231_-	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	83.2	5.5e-52
WP_069598415.1|2595223_2595592_-	RusA family crossover junction endodeoxyribonuclease	NA	K7P6W0	Enterobacteria_phage	60.9	9.4e-39
WP_069598416.1|2595584_2595881_-	hypothetical protein	NA	Q6V7S4	Burkholderia_virus	58.1	4.9e-22
WP_069598417.1|2596025_2596244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069598418.1|2596874_2597891_-	SMEK domain-containing protein	NA	NA	NA	NA	NA
WP_084833291.1|2598004_2598136_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	65.0	1.8e-05
WP_069598419.1|2598336_2598993_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	28.5	7.9e-12
WP_069598420.1|2599010_2599751_-	ATP-binding protein	NA	S4TNF5	Salmonella_phage	72.7	6.0e-101
WP_084833292.1|2599753_2600671_-	hypothetical protein	NA	U5P0A0	Shigella_phage	40.7	8.3e-52
WP_069598421.1|2600693_2601146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044158265.1|2601145_2601403_-	helix-turn-helix domain-containing protein	NA	K7PHA1	Enterobacteria_phage	34.3	3.3e-06
WP_044158267.1|2601497_2601893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157888818.1|2602156_2602393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069598422.1|2603010_2603283_+	hypothetical protein	NA	H6WRX2	Salmonella_phage	48.1	9.1e-15
WP_069598423.1|2603505_2605404_+	exodeoxyribonuclease VIII	NA	S4TNL0	Salmonella_phage	29.2	8.1e-25
WP_069598424.1|2605390_2605633_+	DUF4060 family protein	NA	NA	NA	NA	NA
WP_069598426.1|2605931_2607050_+|integrase	tyrosine-type recombinase/integrase	integrase	O21929	Phage_21	45.0	3.7e-78
WP_069598427.1|2607215_2608427_+	selenium metabolism membrane protein YedE/FdhT	NA	NA	NA	NA	NA
WP_069598428.1|2608423_2608657_+	sulfurtransferase-like selenium metabolism protein YedF	NA	NA	NA	NA	NA
WP_071530987.1|2608783_2609122_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008502800.1|2609168_2609801_-	outer membrane protein OmpW	NA	NA	NA	NA	NA
WP_021240310.1|2610083_2610488_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_023292236.1|2610513_2611257_+	UPF0259 family protein	NA	NA	NA	NA	NA
WP_008502797.1|2611312_2611852_+	septation protein A	NA	NA	NA	NA	NA
WP_008502796.1|2611956_2612352_+	acyl-CoA thioester hydrolase YciA	NA	NA	NA	NA	NA
WP_023617069.1|2612390_2613113_-	TonB system transport protein TonB	NA	NA	NA	NA	NA
WP_008502794.1|2613333_2613630_+	YciI family protein	NA	NA	NA	NA	NA
WP_069598429.1|2613671_2614625_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
2614689:2614708	attL	AAAAAGGCTCCCGCAGGAGC	NA	NA	NA	NA
WP_069598430.1|2614864_2616223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071965096.1|2616646_2616868_-	DNA-binding transcriptional regulator	NA	A0A2I8TV89	Erwinia_phage	72.9	4.6e-25
WP_069598431.1|2616944_2618114_-	phage late control D family protein	NA	A0A218M4J7	Erwinia_phage	81.3	1.1e-170
WP_069598432.1|2618110_2618575_-|tail	phage tail protein	tail	A0A218M4I2	Erwinia_phage	70.8	3.6e-59
WP_069598433.1|2618587_2621032_-|tail	phage tail tape measure protein	tail	Q7Y4C8	Escherichia_virus	52.9	5.8e-201
WP_069598434.1|2621021_2621144_-|tail	GpE family phage tail protein	tail	O80316	Escherichia_phage	89.7	8.5e-13
WP_038421047.1|2621176_2621485_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	73.6	1.4e-27
WP_045329379.1|2621545_2622064_-|tail	phage major tail tube protein	tail	A0A218M4J0	Erwinia_phage	82.0	1.7e-78
WP_069598435.1|2622076_2623270_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	80.4	1.4e-184
WP_069598436.1|2623394_2623991_-|tail	tail fiber assembly protein	tail	A0A218M4J2	Erwinia_phage	84.3	2.7e-91
WP_069598437.1|2623990_2625013_-|tail	phage tail protein	tail	A0A2I8TVA9	Erwinia_phage	74.7	7.9e-136
WP_069598438.1|2625009_2625618_-|tail	phage tail protein I	tail	A0A218M4J3	Erwinia_phage	97.0	1.2e-112
WP_069598439.1|2625610_2626519_-|plate	baseplate assembly protein	plate	A0A218M4K5	Erwinia_phage	94.4	4.1e-152
WP_069598440.1|2626524_2626875_-|plate	baseplate assembly protein	plate	A0A0M4RE59	Salmonella_phage	69.0	3.8e-37
WP_069598441.1|2626871_2627513_-|plate	phage baseplate assembly protein V	plate	Q6K1H6	Salmonella_virus	83.6	1.0e-96
WP_069598442.1|2627581_2628031_-	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	71.4	2.9e-50
WP_069598443.1|2628023_2628491_-|tail	phage tail protein	tail	A0A218M4K6	Erwinia_phage	69.0	2.3e-58
WP_072163335.1|2628453_2628699_-|holin	holin	holin	S4TNY4	Salmonella_phage	77.8	1.0e-28
WP_069598444.1|2628586_2629012_-|lysis	LysB family phage lysis regulatory protein	lysis	O80310	Escherichia_phage	69.3	4.6e-45
WP_069598445.1|2629008_2629518_-	lysozyme	NA	A0A218M4K3	Erwinia_phage	85.7	1.1e-77
WP_001354073.1|2629501_2629723_-	hypothetical protein	NA	A0A218M4L5	Erwinia_phage	75.3	1.4e-26
WP_023333101.1|2629713_2629917_-	hypothetical protein	NA	A0A218M4L8	Erwinia_phage	79.1	1.5e-25
WP_048998837.1|2629916_2630423_-|head	head completion/stabilization protein	head	O80306	Escherichia_phage	71.4	4.9e-62
WP_069598446.1|2630522_2631278_-|terminase	terminase endonuclease subunit	terminase	Q6K1I5	Salmonella_virus	67.3	3.3e-78
WP_069598447.1|2631281_2632376_-|capsid	phage major capsid protein, P2 family	capsid	S4TUA6	Salmonella_phage	81.1	2.7e-166
WP_069598448.1|2632431_2633286_-|capsid	GPO family capsid scaffolding protein	capsid	A0A218M4L9	Erwinia_phage	74.3	2.6e-116
WP_069598449.1|2635213_2636239_+|portal	phage portal protein	portal	Q6K1J0	Salmonella_virus	82.9	3.5e-168
WP_069598450.1|2636741_2638970_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_069598451.1|2639202_2641494_-	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	74.1	0.0e+00
WP_069598452.1|2641495_2641759_-	DUF5405 family protein	NA	U5N3W1	Enterobacteria_phage	59.3	1.8e-23
WP_063441873.1|2641790_2642000_-	DUF2732 family protein	NA	Q7Y4C2	Escherichia_virus	60.7	6.1e-11
WP_069598453.1|2642066_2642567_-	replication protein B	NA	M1SV55	Escherichia_phage	75.9	3.3e-71
WP_167352772.1|2642563_2642734_-	hypothetical protein	NA	Q7Y4C4	Escherichia_virus	61.8	1.5e-12
WP_000184654.1|2642831_2643020_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000042568.1|2643022_2643262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001064688.1|2643303_2643582_-	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	85.6	4.0e-42
WP_000106733.1|2643702_2644002_+	helix-turn-helix transcriptional regulator	NA	Q1JS61	Enterobacteria_phage	76.8	1.3e-38
WP_000111939.1|2644098_2645109_+|integrase	tyrosine-type recombinase/integrase	integrase	Q83VS6	Escherichia_phage	76.4	8.1e-149
2645189:2645208	attR	AAAAAGGCTCCCGCAGGAGC	NA	NA	NA	NA
>prophage 3
NZ_CP017184	Enterobacter roggenkampii strain DSM 16690 chromosome, complete genome	4748414	3004878	3011182	4748414		Escherichia_phage(33.33%)	6	NA	NA
WP_048223992.1|3004878_3005427_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	55.9	5.1e-49
WP_032663233.1|3005442_3006333_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	32.6	1.7e-25
WP_048224508.1|3006356_3007229_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	67.4	6.8e-112
WP_047649490.1|3007242_3008331_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	49.4	6.3e-91
WP_048223999.1|3008720_3009614_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	9.0e-43
WP_069598523.1|3009790_3011182_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	32.3	8.3e-19
>prophage 4
NZ_CP017184	Enterobacter roggenkampii strain DSM 16690 chromosome, complete genome	4748414	3112303	3207716	4748414	portal,head,protease,capsid,tail,terminase,integrase,lysis,plate	Salmonella_phage(18.75%)	103	3194028:3194043	3213502:3213517
WP_008500916.1|3112303_3112999_+|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
WP_069598553.1|3113128_3114013_+	cytidine deaminase	NA	NA	NA	NA	NA
WP_008500918.1|3114140_3114857_+	outer membrane permeability protein SanA	NA	NA	NA	NA	NA
WP_069598554.1|3114981_3116364_+	glutamine synthetase	NA	NA	NA	NA	NA
WP_008500921.1|3116413_3117424_-	galactose/methyl galactoside ABC transporter permease MglC	NA	NA	NA	NA	NA
WP_008500922.1|3117439_3118960_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	33.0	2.6e-10
WP_008500923.1|3119039_3120038_-	galactose/glucose ABC transporter substrate-binding protein MglB	NA	NA	NA	NA	NA
WP_008500924.1|3120333_3121356_-	HTH-type transcriptional regulator GalS	NA	NA	NA	NA	NA
WP_069598555.1|3121511_3122669_-	DUF418 family protein	NA	NA	NA	NA	NA
WP_008500927.1|3122688_3123357_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	55.8	6.9e-56
WP_055321900.1|3123459_3124608_-	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_069598556.1|3124746_3125574_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_069598557.1|3125677_3127648_-	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	35.9	1.6e-12
WP_008500931.1|3127873_3129343_-	amino acid permease	NA	NA	NA	NA	NA
WP_008500932.1|3129501_3130368_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_069598558.1|3130465_3131512_+	YeiH family protein	NA	NA	NA	NA	NA
WP_023294038.1|3131576_3132434_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	33.2	3.6e-25
WP_069598559.1|3132479_3134165_-	PTS fructose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_008500936.1|3134181_3135120_-	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_039025028.1|3135119_3136250_-	fused PTS fructose transporter subunit IIA/HPr protein	NA	NA	NA	NA	NA
WP_069598560.1|3136611_3137793_+	sugar efflux transporter SetB	NA	NA	NA	NA	NA
WP_021241515.1|3137789_3138044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008500940.1|3138208_3138781_+	elongation factor P-like protein YeiP	NA	NA	NA	NA	NA
WP_069598561.1|3138898_3140089_-	mannonate dehydratase	NA	NA	NA	NA	NA
WP_069598562.1|3140292_3141759_+	fructuronate reductase	NA	E5EQS6	Micromonas_sp._RCC1109_virus	30.0	1.5e-39
WP_008500943.1|3141881_3142868_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_023618663.1|3142901_3143615_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_008500946.1|3144030_3144600_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.9	3.6e-13
WP_008500947.1|3144727_3146284_+	cyclic di-GMP phosphodiesterase	NA	NA	NA	NA	NA
WP_008500948.1|3146357_3148163_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_045372656.1|3148172_3149267_+	microcin C ABC transporter permease YejB	NA	NA	NA	NA	NA
WP_069598563.1|3149266_3150292_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_021241521.1|3150293_3151883_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	33.2	2.7e-18
WP_008500952.1|3151886_3152231_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025913174.1|3152510_3153707_-	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	22.6	1.7e-20
WP_008500954.1|3153722_3154430_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_032663178.1|3154711_3156472_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	42.2	2.9e-101
WP_008500956.1|3156597_3156882_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_008500957.1|3156932_3157940_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.6	2.9e-82
WP_008500958.1|3158074_3158302_+	YejL family protein	NA	NA	NA	NA	NA
WP_069598564.1|3158321_3160082_+	DUF3413 domain-containing protein	NA	NA	NA	NA	NA
WP_069598565.1|3160336_3160657_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	73.6	1.8e-41
WP_023325685.1|3160656_3160896_-	hypothetical protein	NA	K7P7N3	Enterobacteria_phage	97.4	5.5e-40
WP_069598566.1|3160995_3161235_+	DinI family protein	NA	K7PKM2	Enterobacterial_phage	93.7	2.6e-34
WP_069598567.1|3161298_3161661_+	GtrA family protein	NA	B9UDL8	Salmonella_phage	70.0	1.5e-41
WP_069598568.1|3161657_3162575_+	glycosyltransferase family 2 protein	NA	U5P087	Shigella_phage	90.8	3.5e-159
WP_069598569.1|3162579_3163059_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157888821.1|3163033_3164269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069598570.1|3164403_3164808_-	hypothetical protein	NA	U5P0S4	Shigella_phage	41.2	5.3e-11
WP_069598571.1|3165812_3166406_-	YmfQ family protein	NA	NA	NA	NA	NA
WP_069598572.1|3166402_3167545_-|plate	baseplate J/gp47 family protein	plate	A0A0A8WEY6	Clostridium_phage	34.8	4.7e-12
WP_069598573.1|3167546_3167984_-	hypothetical protein	NA	B5TK74	Pseudomonas_phage	45.8	1.4e-12
WP_045888898.1|3167980_3168565_-|plate	phage baseplate assembly protein	plate	A0A077KAY0	Edwardsiella_phage	31.5	1.7e-05
WP_063929853.1|3168561_3169647_-|tail	phage tail protein	tail	M1PVV2	Vibrio_phage	31.5	5.8e-44
WP_069598963.1|3169643_3171047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157888822.1|3171109_3171844_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069598574.1|3171906_3173766_-	hypothetical protein	NA	T1SBJ1	Salmonella_phage	40.8	2.2e-19
WP_000807719.1|3173907_3174186_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_069598575.1|3174187_3174559_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_069598576.1|3174562_3176065_-|tail	phage tail protein	tail	B5TK67	Pseudomonas_phage	41.4	1.8e-99
WP_069598577.1|3176061_3176259_-	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_069598578.1|3176262_3176808_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_063417625.1|3176804_3177164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047744272.1|3177168_3177579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023157311.1|3177550_3178600_-|capsid	major capsid protein	capsid	V5Q8G6	Xylella_phage	33.7	3.6e-51
WP_069598579.1|3178697_3179102_-|head	head decoration protein	head	NA	NA	NA	NA
WP_069598580.1|3179101_3179692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069598581.1|3179693_3180560_-	S49 family peptidase	NA	A0A2D1GN02	Marinobacter_phage	37.9	6.2e-49
WP_001045359.1|3180556_3182194_-|portal	phage portal protein	portal	A0A291AUL8	Sinorhizobium_phage	35.2	3.3e-91
WP_000483309.1|3182193_3182457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069598582.1|3182465_3184589_-|terminase	terminase	terminase	A0A2K9V3X4	Faecalibacterium_phage	35.9	2.3e-97
WP_069598583.1|3184530_3185100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069598584.1|3185341_3185983_-	hypothetical protein	NA	A0A1B0Z000	Pseudomonas_phage	32.1	6.3e-06
WP_157888823.1|3186064_3186364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069598586.1|3186483_3186684_-	hypothetical protein	NA	K7PHC3	Enterobacterial_phage	69.8	2.5e-17
WP_069598587.1|3186890_3187427_-	hypothetical protein	NA	K7PHH7	Enterobacteria_phage	89.5	3.6e-79
WP_069598588.1|3187423_3187960_-	lysozyme	NA	K7PM52	Enterobacteria_phage	86.9	6.5e-89
WP_069598589.1|3187962_3188217_-|lysis	lysis protein	lysis	NA	NA	NA	NA
WP_069598590.1|3188281_3189334_-	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	81.7	1.2e-174
WP_069598591.1|3189666_3190359_-	antitermination protein	NA	NA	NA	NA	NA
WP_069598592.1|3190380_3191442_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	55.1	1.0e-109
WP_016247390.1|3191438_3192131_-	phage regulatory protein/antirepressor Ant	NA	G0ZND1	Cronobacter_phage	55.1	5.3e-59
WP_069598593.1|3192145_3194083_-	DNA methyltransferase	NA	H9C171	Pectobacterium_phage	53.7	5.1e-200
3194028:3194043	attL	ATGCCGGTACTCGCGC	NA	NA	NA	NA
WP_084833309.1|3194075_3195413_-	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	50.1	1.6e-115
WP_069598595.1|3195418_3196282_-	GntR family transcriptional regulator	NA	U5P0A0	Shigella_phage	85.7	8.1e-41
WP_069598596.1|3196271_3196451_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	69.2	6.6e-14
WP_047352162.1|3196623_3197172_-	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	68.1	2.2e-68
WP_032623260.1|3197164_3197428_-	helix-turn-helix transcriptional regulator	NA	A0A0P0ZCZ7	Stx2-converting_phage	57.5	1.3e-18
WP_069598597.1|3197525_3198221_+	helix-turn-helix domain-containing protein	NA	Q8HAA0	Salmonella_phage	69.6	7.9e-87
WP_057072056.1|3198938_3199310_+	hypothetical protein	NA	Q8HAA1	Salmonella_phage	89.4	3.8e-56
WP_069598598.1|3199363_3200194_+	YfdQ family protein	NA	A0A192Y6E5	Salmonella_phage	76.8	7.4e-116
WP_069598599.1|3200329_3200869_+	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	74.9	2.7e-74
WP_069598600.1|3201050_3201656_+	hypothetical protein	NA	A0A1R3Y5S0	Salmonella_virus	54.7	2.2e-21
WP_069598601.1|3201652_3202000_+	ead/Ea22-like family protein	NA	NA	NA	NA	NA
WP_069598602.1|3202001_3202367_+	HNH endonuclease	NA	A0A2R2Z2X9	Escherichia_phage	90.0	3.5e-62
WP_069598604.1|3202776_3203016_+	hypothetical protein	NA	G8C7S3	Escherichia_phage	59.4	2.3e-14
WP_016240148.1|3203015_3203192_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016240149.1|3203194_3203767_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	83.0	2.1e-93
WP_069598964.1|3203811_3204021_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069598605.1|3204023_3205211_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2D1GN00	Marinobacter_phage	30.0	1.9e-32
WP_069598606.1|3205430_3206618_-	MFS transporter	NA	NA	NA	NA	NA
WP_069598607.1|3206742_3207003_-	DUF2534 family protein	NA	NA	NA	NA	NA
WP_008500963.1|3207212_3207716_+|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
3213502:3213517	attR	ATGCCGGTACTCGCGC	NA	NA	NA	NA
>prophage 5
NZ_CP017184	Enterobacter roggenkampii strain DSM 16690 chromosome, complete genome	4748414	4033935	4063378	4748414	plate,tRNA,tail	Erwinia_phage(35.71%)	34	NA	NA
WP_008503186.1|4033935_4034949_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.6	6.3e-109
WP_001144069.1|4035185_4035401_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_069598790.1|4035515_4037261_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	39.0	1.4e-76
WP_008503184.1|4037415_4039263_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	32.6	6.4e-35
WP_008503183.1|4039360_4039867_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_110915166.1|4040389_4040641_+	DUF2542 family protein	NA	NA	NA	NA	NA
WP_069598791.1|4040868_4041069_-	late control protein B	NA	A0A2I8TV89	Erwinia_phage	77.6	1.3e-21
WP_069598792.1|4041136_4042291_-	phage late control D family protein	NA	A0A0M5M5V5	Salmonella_phage	61.7	3.9e-131
WP_045910024.1|4042287_4042752_-|tail	phage tail protein	tail	O80317	Escherichia_phage	67.9	4.3e-57
WP_023616176.1|4045016_4045136_-|tail	GpE family phage tail protein	tail	O80316	Escherichia_phage	89.7	9.7e-14
WP_045910026.1|4045168_4045471_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	67.8	8.8e-27
WP_045910027.1|4045527_4046046_-|tail	phage major tail tube protein	tail	A0A218M4J0	Erwinia_phage	80.2	2.2e-78
WP_069598793.1|4046057_4047245_-|tail	phage tail sheath protein	tail	S4TRX2	Salmonella_phage	82.5	2.0e-186
WP_023616180.1|4047633_4048071_-|tail	tail fiber assembly protein	tail	S5FXM8	Shigella_phage	34.8	3.2e-09
WP_069598794.1|4048073_4049945_-	hypothetical protein	NA	Q37842	Escherichia_phage	80.4	1.6e-89
WP_023616181.1|4049956_4050487_-|tail	phage tail protein I	tail	Q37841	Escherichia_phage	86.4	1.7e-89
WP_069598795.1|4050479_4051388_-|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	79.1	4.1e-128
WP_069598796.1|4051393_4051744_-|plate	baseplate assembly protein	plate	A0A0M4RE59	Salmonella_phage	70.7	2.4e-39
WP_069598797.1|4051740_4052382_-|plate	phage baseplate assembly protein V	plate	A0A0M4S6F6	Salmonella_phage	76.5	5.0e-88
WP_069598798.1|4052494_4052962_-|tail	phage tail protein	tail	A0A218M4K6	Erwinia_phage	60.6	2.0e-49
WP_069598799.1|4053057_4053483_-	protein lysB	NA	A0A218M4K2	Erwinia_phage	58.1	5.8e-32
WP_069598800.1|4053479_4053989_-	lysozyme	NA	A0A218M4K3	Erwinia_phage	82.7	3.9e-75
WP_023309247.1|4053972_4054194_-	hypothetical protein	NA	A0A218M4L5	Erwinia_phage	73.6	3.9e-24
WP_024906438.1|4054184_4054388_-|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	71.6	1.2e-22
WP_024906437.1|4054566_4055007_-	DinI-like family protein	NA	A0A218M4I0	Erwinia_phage	75.2	1.4e-52
WP_069598801.1|4055116_4057306_-	replication endonuclease	NA	A0A218M4H2	Erwinia_phage	73.2	0.0e+00
WP_048028939.1|4057307_4057529_-	TraR/DksA family transcriptional regulator	NA	A0A0M4S5Q7	Salmonella_phage	75.0	2.1e-25
WP_023616297.1|4057528_4057756_-	DUF2732 family protein	NA	A0A0M3UL87	Salmonella_phage	60.0	1.2e-12
WP_023616298.1|4057824_4058163_-	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	74.8	7.8e-40
WP_069598802.1|4058390_4058966_+	phage repressor protein CI	NA	A0A218M4J1	Erwinia_phage	61.7	1.7e-66
WP_069598803.1|4059247_4060417_+	DNA repair protein	NA	NA	NA	NA	NA
WP_069598804.1|4060417_4061182_-	siderophore-interacting protein	NA	NA	NA	NA	NA
WP_008503175.1|4061327_4061822_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_069598805.1|4061818_4063378_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	32.3	9.9e-13
>prophage 1
NZ_CP017185	Enterobacter roggenkampii strain DSM 16690 plasmid pDSMZ16690, complete sequence	151583	59241	102700	151583	transposase	Shigella_phage(23.53%)	35	NA	NA
WP_069599031.1|59241_61251_-	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	30.7	9.1e-27
WP_069599032.1|61323_61557_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_069599033.1|61604_62144_-	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	76.2	9.2e-51
WP_162274161.1|62172_62262_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_069599035.1|62996_63503_-	antirestriction protein	NA	A0A1I9S7Y0	Rhodococcus_phage	29.5	3.7e-09
WP_069599036.1|63913_64330_-	DUF1380 family protein	NA	NA	NA	NA	NA
WP_045420362.1|64378_64603_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069599037.1|64599_65283_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.9	4.3e-29
WP_069599038.1|65634_66306_+	DNA breaking-rejoining protein	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.4	4.5e-79
WP_069599039.1|66485_66908_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.0	1.3e-31
WP_069599040.1|66907_68182_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.3	7.3e-155
WP_069599041.1|68263_69238_-	ParB/RepB/Spo0J family partition protein	NA	A0A1B0V750	Salmonella_phage	54.1	2.7e-85
WP_069599042.1|69237_70443_-	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.6	6.2e-164
WP_069599043.1|70790_71423_+	recombinase family protein	NA	NA	NA	NA	NA
WP_069599044.1|71476_71677_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069599045.1|71822_72764_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	55.0	1.1e-75
WP_122983598.1|73610_74600_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	59.6	7.2e-102
WP_069599048.1|77105_77978_-	protein RepA	NA	J9Q7H0	Salmonella_phage	46.6	2.2e-62
WP_157888842.1|78427_78694_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157888843.1|78801_79428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000537152.1|79710_79995_+|transposase	IS3 family transposase	transposase	U5P4I9	Shigella_phage	44.8	8.9e-13
WP_077946840.1|79991_80846_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	56.2	8.0e-81
WP_069599050.1|81349_81706_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069599051.1|82112_82439_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069599100.1|83447_83555_+	uridine kinase	NA	NA	NA	NA	NA
WP_157888844.1|83846_84044_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157888857.1|84087_84387_+	phosphoribulokinase	NA	NA	NA	NA	NA
WP_069599054.1|86505_87123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069599055.1|87109_87964_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_146751463.1|87953_88157_+	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_084833317.1|89594_90449_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	56.0	3.0e-80
WP_000537152.1|90445_90730_-|transposase	IS3 family transposase	transposase	U5P4I9	Shigella_phage	44.8	8.9e-13
WP_157888845.1|91601_100481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069599058.1|100772_101033_+	DUF2534 family protein	NA	NA	NA	NA	NA
WP_157888846.1|102310_102700_+|transposase	transposase	transposase	B6DZU5	Stx2-converting_phage	87.6	2.5e-58
