The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP016404	Escherichia coli strain 210221272 chromosome, complete genome	4668621	979153	1066310	4668621	holin,transposase,lysis,tail,integrase,portal,protease,terminase	Enterobacteria_phage(30.77%)	84	983010:983065	1029556:1029611
WP_000749863.1|979153_980209_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	61.1	9.1e-119
WP_001285288.1|980496_981600_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893278.1|981611_982865_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	9.8e-96
983010:983065	attL	ATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCATTAAAATCAA	NA	NA	NA	NA
WP_000051887.1|983069_984233_-|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	100.0	2.4e-229
WP_000206732.1|984459_984765_-	hypothetical protein	NA	U5P0J0	Shigella_phage	100.0	6.8e-51
WP_001242749.1|984764_985127_-	phage protein	NA	U5P092	Shigella_phage	100.0	2.1e-67
WP_000008236.1|985117_985654_-	5'-deoxynucleotidase	NA	K7PKJ9	Enterobacteria_phage	98.9	3.7e-100
WP_000016389.1|986198_986633_+	hypothetical protein	NA	U5P096	Shigella_phage	100.0	8.4e-79
WP_000549623.1|986604_986811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000848748.1|987045_987720_-	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	100.0	1.2e-132
WP_000649477.1|987810_988011_+	helix-turn-helix domain-containing protein	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_000515828.1|988054_988606_+	protein YmfL	NA	S5FXP0	Shigella_phage	99.5	2.6e-101
WP_001250269.1|988781_988961_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000104979.1|988950_989892_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	93.0	6.4e-140
WP_002431701.1|989888_990383_+	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	97.5	3.6e-86
WP_000210170.1|990382_990709_+	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	100.0	5.4e-54
WP_000767113.1|990705_991095_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
WP_001061444.1|991114_991924_+	KilA-N domain-containing protein	NA	A0A291AWU7	Escherichia_phage	100.0	1.8e-151
WP_002431700.1|991931_992921_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.7	2.1e-194
WP_016242583.1|992934_993687_+	antitermination protein	NA	Q8SBE4	Shigella_phage	99.2	1.5e-136
WP_016242584.1|993841_994372_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001355891.1|994553_994748_+	hypothetical protein	NA	Q8SBE3	Shigella_phage	100.0	1.8e-28
WP_000799656.1|994897_995950_+	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	100.0	2.7e-208
WP_000839596.1|996016_996232_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000192451.1|996236_996581_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	95.2	2.2e-37
WP_000370545.1|996546_996819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001101168.1|996924_997467_+	lysozyme	NA	Q08J98	Stx2-converting_phage	87.8	3.0e-94
WP_139371347.1|997715_998928_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
WP_000085744.1|999481_1000174_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000373425.1|1000745_1001240_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	100.0	9.9e-84
WP_016242585.1|1001239_1003342_+|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	99.3	0.0e+00
WP_001072973.1|1003338_1003551_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	98.6	7.1e-31
WP_000985939.1|1003550_1005059_+|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.4	1.0e-288
WP_016242586.1|1005003_1007031_+|protease	Clp protease ClpP	protease	A5LH30	Enterobacteria_phage	99.7	0.0e+00
WP_016242587.1|1007117_1007441_+	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	98.1	9.4e-51
WP_001283152.1|1007433_1007709_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	98.9	8.6e-45
WP_016242588.1|1007720_1008299_+|tail	phage tail protein	tail	A0A291AWZ0	Escherichia_phage	99.0	1.2e-101
WP_001079400.1|1008295_1008697_+|tail	tail protein	tail	A0A291AWY2	Escherichia_phage	99.2	1.1e-72
WP_000211109.1|1008707_1009451_+|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	100.0	7.8e-133
WP_001440689.1|1009511_1009898_+|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	99.2	6.1e-65
WP_001161005.1|1009906_1010236_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	99.1	2.9e-55
WP_016242589.1|1010207_1013273_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	99.0	0.0e+00
WP_000847325.1|1013269_1013599_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	97.2	7.6e-56
WP_069684275.1|1013598_1014297_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	96.1	7.6e-130
WP_001377947.1|1014302_1015046_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	93.9	2.2e-143
WP_000090847.1|1014982_1015585_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.1	1.8e-87
WP_069684276.1|1015645_1019041_+	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	89.4	0.0e+00
WP_001233121.1|1019108_1019708_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	93.0	7.2e-105
WP_072648490.1|1019772_1023186_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	X2KTY7	Enterobacteria_phage	37.3	2.4e-11
WP_048236353.1|1023185_1023767_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	92.7	3.0e-100
WP_072095179.1|1024879_1026283_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.1	4.0e-106
WP_012602456.1|1026317_1027532_-	type II restriction endonuclease	NA	E5E3X4	Burkholderia_phage	38.6	7.9e-34
WP_000049501.1|1028198_1029164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001111348.1|1029727_1030138_-	hypothetical protein	NA	NA	NA	NA	NA
1029556:1029611	attR	ATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCATTAAAATCAA	NA	NA	NA	NA
WP_069684277.1|1030116_1031073_-	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_069684278.1|1031082_1033281_-	aldehyde oxidoreductase molybdenum-binding subunit PaoC	NA	A0A0P0I429	Acinetobacter_phage	25.8	5.6e-38
WP_069684279.1|1033277_1034234_-	aldehyde oxidoreductase FAD-binding subunit PaoB	NA	NA	NA	NA	NA
WP_069684280.1|1034230_1034920_-	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_001019920.1|1035337_1035952_+	YagU family protein	NA	NA	NA	NA	NA
WP_001303809.1|1036199_1036529_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001350485.1|1036841_1037552_-	fimbrial chaperone EcpE	NA	NA	NA	NA	NA
WP_001310578.1|1037520_1039164_-	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_001131096.1|1039153_1041679_-	fimbrial usher EcpC	NA	NA	NA	NA	NA
WP_000716401.1|1041704_1042373_-	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_000730972.1|1042430_1043018_-	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_001301257.1|1043092_1043635_-	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_001147279.1|1044458_1044686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000866436.1|1044720_1044861_-	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_000803998.1|1044860_1045124_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000662258.1|1045487_1045589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000020219.1|1046703_1050960_+	intimin-like adhesin FdeC	NA	NA	NA	NA	NA
WP_000621009.1|1051099_1051951_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001299021.1|1052540_1053134_-	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_000474084.1|1053145_1053382_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001046307.1|1053490_1054816_-	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.6	2.5e-113
WP_000339594.1|1055041_1055896_+	DNA-binding transcriptional regulator RclR	NA	NA	NA	NA	NA
WP_001102108.1|1056421_1057141_+	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_000023927.1|1057151_1058579_+	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_000370307.1|1058571_1059267_+	lactate utilization protein C	NA	NA	NA	NA	NA
WP_001209100.1|1059509_1060178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001159094.1|1060390_1062061_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	4.7e-61
WP_000089110.1|1062074_1063547_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001335745.1|1063560_1064148_-	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000131044.1|1064276_1066310_+|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
>prophage 2
NZ_CP016404	Escherichia coli strain 210221272 chromosome, complete genome	4668621	1592926	1663039	4668621	plate,head,capsid,lysis,tail,integrase,portal,protease,terminase	Salmonella_phage(66.04%)	81	1589708:1589722	1601598:1601612
1589708:1589722	attL	GCTGTCGCTGATGGT	NA	NA	NA	NA
WP_000290937.1|1592926_1593979_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.3	3.6e-107
WP_021574262.1|1594061_1595738_-	DUF4041 domain-containing protein	NA	A0A142LP25	Marinitoga_camini_virus	66.8	9.8e-83
WP_000107903.1|1595758_1596355_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	43.4	1.1e-39
WP_000188448.1|1596450_1596672_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000460892.1|1596704_1597214_+	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.2	1.3e-86
WP_000956192.1|1597221_1597518_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	88.5	1.9e-21
WP_000996717.1|1597635_1597977_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
WP_001244230.1|1598044_1598278_+	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	97.4	1.1e-32
WP_000752619.1|1598277_1598505_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	3.5e-36
WP_069684316.1|1598501_1599359_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	96.5	8.6e-160
WP_069684317.1|1599355_1601770_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	98.0	0.0e+00
1601598:1601612	attR	ACCATCAGCGACAGC	NA	NA	NA	NA
WP_001154434.1|1601922_1602111_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_001217568.1|1602122_1602356_+	DinI family protein	NA	E5G6M1	Salmonella_phage	98.7	2.3e-35
WP_000094764.1|1602626_1602842_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021556032.1|1602841_1603684_+	hypothetical protein	NA	A0A0M4R2T6	Salmonella_phage	48.1	1.1e-58
WP_024235280.1|1603921_1605595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021578439.1|1605626_1606655_-|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	89.2	2.4e-172
WP_021578440.1|1606654_1608421_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
WP_000216237.1|1608563_1609397_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	91.0	2.8e-123
WP_001471287.1|1609413_1610472_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.4	2.9e-181
WP_001459609.1|1610475_1611126_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	95.8	1.5e-111
WP_000673520.1|1611221_1611686_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	4.2e-76
WP_000868175.1|1611685_1611889_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
WP_000171568.1|1611892_1612108_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_001069905.1|1612088_1612601_+	lysozyme	NA	E5G6N1	Salmonella_phage	92.3	3.1e-88
WP_021578443.1|1612602_1612980_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	2.3e-16
WP_021578444.1|1612976_1613405_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	75.9	1.1e-46
WP_001039939.1|1613500_1613932_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	95.1	1.5e-72
WP_000829146.1|1613924_1614371_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	85.6	6.6e-63
WP_000993769.1|1614439_1615018_+|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	87.5	2.5e-94
WP_000177590.1|1615014_1615374_+	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	86.6	9.5e-52
WP_069684318.1|1615360_1616269_+|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.1	3.9e-142
WP_001086836.1|1616261_1616867_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.5	1.5e-110
WP_069684319.1|1616863_1618393_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	71.5	4.6e-196
WP_069684320.1|1618392_1618995_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	90.0	2.5e-97
WP_001106828.1|1618966_1619407_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	69.7	5.6e-54
WP_077252665.1|1619428_1619818_-	hypothetical protein	NA	M1FN94	Enterobacteria_phage	51.8	1.6e-12
WP_000905032.1|1619848_1620415_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	86.8	3.8e-87
WP_000046120.1|1620557_1621730_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	2.1e-204
WP_001207660.1|1621739_1622255_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.3	2.1e-89
WP_001281009.1|1622309_1622612_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	5.3e-40
WP_000763311.1|1622626_1622746_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_069684322.1|1622738_1625816_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	69.3	0.0e+00
WP_000980391.1|1625812_1626298_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	81.2	1.7e-67
WP_069684323.1|1626294_1627395_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.4	1.9e-175
WP_000972391.1|1627485_1627704_+	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_001024876.1|1627939_1629625_-	aspartate:alanine antiporter	NA	NA	NA	NA	NA
WP_000681108.1|1629894_1630272_+	inner membrane protein YbjM	NA	NA	NA	NA	NA
WP_001195240.1|1630301_1630559_-	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	61.9	8.6e-23
WP_001201560.1|1630718_1631006_+	DUF1418 family protein	NA	NA	NA	NA	NA
WP_000189159.1|1630989_1631712_+	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_000684321.1|1631772_1632675_+	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_000203025.1|1632762_1633239_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_069684325.1|1633589_1634702_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000996005.1|1634796_1635930_+	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
WP_001093854.1|1635939_1636893_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_001061665.1|1636889_1637735_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_000389260.1|1637794_1638283_+	YbjO family protein	NA	NA	NA	NA	NA
WP_001149756.1|1638323_1639451_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.0	6.0e-28
WP_001295339.1|1639649_1640381_-	ABC transporter substrate-binding protein ArtJ	NA	NA	NA	NA	NA
WP_000464491.1|1640671_1641340_-	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_001001691.1|1641339_1642056_-	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_000756569.1|1642062_1642794_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000027205.1|1642811_1643540_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
WP_044863778.1|1643757_1644273_-	lipoprotein	NA	NA	NA	NA	NA
WP_001160737.1|1644398_1644722_+	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001252135.1|1644718_1645549_+	N-acetylmuramoyl-L-alanine amidase AmiD	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
WP_001338420.1|1645545_1646559_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001136577.1|1646657_1648088_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000566372.1|1648098_1649100_-	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_000815337.1|1649136_1650855_-	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.0	2.3e-31
WP_000178677.1|1650987_1651956_-	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_069684326.1|1651967_1653620_-	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_000491142.1|1653763_1654663_-	L-lysine exporter LysO	NA	NA	NA	NA	NA
WP_001298299.1|1655157_1655853_-	aquaporin Z	NA	NA	NA	NA	NA
WP_000599802.1|1656278_1657937_+	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_001380339.1|1657933_1658890_-	DUF535 domain-containing protein	NA	NA	NA	NA	NA
WP_000746443.1|1659040_1660156_+	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
WP_000188144.1|1660152_1662099_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
WP_000410785.1|1662171_1662396_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000520781.1|1662718_1663039_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
>prophage 3
NZ_CP016404	Escherichia coli strain 210221272 chromosome, complete genome	4668621	2955150	2964592	4668621		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001333512.1|2955150_2956287_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.9e-162
WP_001423058.1|2956283_2958284_+	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	96.6	0.0e+00
WP_001373589.1|2958408_2958870_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	98.7	1.6e-75
WP_001295430.1|2958910_2959381_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|2959427_2960147_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|2960143_2961829_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240401.1|2962050_2962782_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001216963.1|2962841_2962949_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|2962929_2963661_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569315.1|2963665_2964592_-	glycine betaine ABC transporter ATP binding protein YehX	NA	F2Y1V5	Organic_Lake_phycodnavirus	26.8	2.0e-08
>prophage 4
NZ_CP016404	Escherichia coli strain 210221272 chromosome, complete genome	4668621	3180833	3252417	4668621	plate,head,holin,capsid,transposase,lysis,tail,integrase,portal,tRNA,protease,terminase	Enterobacteria_phage(50.77%)	90	3209205:3209221	3256091:3256107
WP_001283585.1|3180833_3181646_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_001289167.1|3181645_3182659_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000699145.1|3182724_3183861_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	28.8	5.9e-23
WP_000615834.1|3183959_3184955_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_000127751.1|3184951_3186130_-	arabinose transporter	NA	NA	NA	NA	NA
WP_000817178.1|3186394_3187615_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_000683789.1|3187773_3189780_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_000559764.1|3189900_3190179_-	YfcL family protein	NA	NA	NA	NA	NA
WP_001089222.1|3190212_3190761_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_000447361.1|3190760_3191570_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_001043825.1|3191569_3192394_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_001333535.1|3192397_3193483_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.8	9.1e-90
WP_001300582.1|3193517_3194450_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000730806.1|3194615_3195167_+	endonuclease SmrB	NA	NA	NA	NA	NA
WP_000698745.1|3195237_3196059_-	YfcO family protein	NA	NA	NA	NA	NA
WP_069684453.1|3196060_3196600_-	fimbrial protein	NA	NA	NA	NA	NA
WP_001232541.1|3196596_3197085_-	fimbrial protein	NA	NA	NA	NA	NA
WP_001311011.1|3197081_3197594_-	fimbrial protein	NA	NA	NA	NA	NA
WP_001281606.1|3197593_3198346_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_001195819.1|3202256_3202742_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_000426176.1|3202944_3205089_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_000531952.1|3205088_3206399_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_001296261.1|3206579_3206864_-	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_001295701.1|3207235_3208576_+	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_069684454.1|3208941_3210000_+	hypothetical protein	NA	NA	NA	NA	NA
3209205:3209221	attL	TATTGGTATCGACAACC	NA	NA	NA	NA
WP_000776768.1|3210181_3210937_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_000368140.1|3211230_3212163_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.0	2.5e-165
WP_053265620.1|3212474_3213632_+|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	99.2	5.3e-221
WP_069684455.1|3214067_3215048_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	8.9e-185
WP_069684456.1|3215459_3216494_+	acyltransferase	NA	NA	NA	NA	NA
WP_069684457.1|3217652_3218171_+|tail	tail fiber protein	tail	Q9MCR6	Enterobacteria_phage	62.4	2.8e-49
WP_069684458.1|3218170_3218773_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	89.5	4.3e-97
WP_069684459.1|3218744_3219137_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	94.6	4.6e-68
WP_069684460.1|3219207_3219870_-	hypothetical protein	NA	M1FN94	Enterobacteria_phage	84.9	4.7e-65
WP_069684461.1|3219873_3220458_-	YmfQ family protein	NA	O22003	Shigella_phage	99.0	1.2e-112
WP_000785304.1|3220448_3221507_-|plate	baseplate J/gp47 family protein	plate	U5P424	Shigella_phage	99.1	2.5e-201
WP_000424737.1|3221493_3221919_-	phage GP46 family protein	NA	U5P0R9	Shigella_phage	99.3	6.7e-81
WP_001259084.1|3221918_3222467_-|plate	phage baseplate assembly protein	plate	U5P081	Shigella_phage	98.9	5.1e-97
WP_038977178.1|3222466_3223546_-|plate	baseplate protein	plate	Q8SBG7	Shigella_phage	99.4	1.2e-206
WP_069684462.1|3223542_3224871_-	DNA circularization N-terminal domain-containing protein	NA	Q8SBG8	Shigella_phage	98.2	2.1e-245
WP_069684463.1|3224931_3226767_-|tail	phage tail tape measure protein	tail	S5FM63	Shigella_phage	99.7	4.5e-307
WP_000661047.1|3226908_3227178_-|tail	phage tail assembly protein	tail	S5FNR3	Shigella_phage	100.0	3.5e-43
WP_000090998.1|3227177_3227534_-|tail	phage tail tube protein	tail	U5P076	Shigella_phage	100.0	5.3e-63
WP_069684464.1|3227533_3229030_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	S5FKL0	Shigella_phage	98.8	2.6e-276
WP_000497751.1|3229013_3229184_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
WP_001407136.1|3229192_3229753_-	hypothetical protein	NA	Q8SBH4	Shigella_phage	98.9	4.0e-105
WP_000213500.1|3229749_3230256_-	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	99.4	6.5e-91
WP_000702402.1|3230230_3230641_-|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	98.5	9.1e-75
WP_000927710.1|3230637_3230961_-|head,tail	phage gp6-like head-tail connector protein	head,tail	S5FKK6	Shigella_phage	100.0	5.1e-57
WP_000601365.1|3230963_3231164_-	hypothetical protein	NA	S5FNU1	Shigella_phage	100.0	3.4e-27
WP_000257507.1|3231213_3232419_-|capsid	phage major capsid protein	capsid	M1FPN2	Enterobacteria_phage	100.0	1.8e-224
WP_001193631.1|3232433_3233084_-|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	100.0	2.5e-119
WP_069684465.1|3233061_3234303_-|portal	phage portal protein	portal	U5P411	Shigella_phage	99.3	7.6e-242
WP_000605604.1|3234302_3234485_-	hypothetical protein	NA	M1FJ83	Enterobacteria_phage	100.0	1.7e-25
WP_122986317.1|3234496_3235993_-|terminase	terminase large subunit	terminase	A0A1C9IIA1	Salmonella_phage	99.6	9.7e-300
WP_069684466.1|3236226_3236721_-|terminase	phage terminase small subunit P27 family	terminase	U5P067	Shigella_phage	98.8	1.1e-87
WP_047602016.1|3236846_3237197_-	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	96.6	1.0e-63
WP_069684467.1|3237423_3237687_-	hypothetical protein	NA	G8C7W4	Escherichia_phage	83.8	2.7e-08
WP_001016386.1|3237683_3238202_-	Rha family transcriptional regulator	NA	A0A2D1GLJ3	Escherichia_phage	100.0	3.2e-93
WP_060641690.1|3238406_3238844_-|lysis	lysis protein	lysis	Q9MCN3	Enterobacteria_phage	98.6	2.9e-71
WP_000229397.1|3238840_3239317_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	99.4	3.7e-88
WP_069684468.1|3239300_3239624_-|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	99.1	6.5e-52
WP_001235461.1|3240057_3240681_-	antitermination protein	NA	K7PM87	Enterobacteria_phage	100.0	3.0e-114
WP_000994515.1|3240677_3240866_-	protein ninH	NA	K7PH29	Enterobacteria_phage	100.0	1.9e-27
WP_001008199.1|3240862_3241225_-	RusA family crossover junction endodeoxyribonuclease	NA	A5VW85	Enterobacteria_phage	100.0	9.2e-63
WP_000002250.1|3241221_3241512_-	DUF1364 domain-containing protein	NA	Q9MCN9	Enterobacteria_phage	100.0	3.4e-52
WP_001003991.1|3241511_3242234_-	phage antirepressor KilAC domain-containing protein	NA	K7P6K2	Enterobacteria_phage	99.2	2.1e-130
WP_000566856.1|3242226_3242397_-	protein ninF	NA	K7PLU6	Enterobacteria_phage	98.2	4.2e-26
WP_069684552.1|3242393_3242576_-	NinE family protein	NA	A0A0P0ZC71	Stx2-converting_phage	95.0	9.1e-27
WP_075202258.1|3242542_3242716_-	protein ninD	NA	I6S1V2	Salmonella_phage	98.2	6.4e-30
WP_000736903.1|3242712_3243153_-	recombination protein NinB	NA	A0A220NRM1	Escherichia_phage	100.0	7.0e-81
WP_069684469.1|3243230_3245111_-	toprim domain-containing protein	NA	K7PK08	Enterobacteria_phage	99.5	0.0e+00
WP_069684470.1|3245218_3246079_-	replication protein	NA	K7PL20	Enterobacteria_phage	99.3	2.1e-158
WP_000166207.1|3246071_3246218_-	DUF2740 family protein	NA	Q687G5	Enterobacteria_phage	100.0	1.1e-19
WP_000035948.1|3246250_3246547_-	hypothetical protein	NA	K7PKU6	Enterobacteria_phage	100.0	2.3e-48
WP_000276885.1|3246662_3246848_-	Cro/Cl family transcriptional regulator	NA	K7PHK4	Enterobacteria_phage	100.0	1.2e-26
WP_001095982.1|3246928_3247579_+	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	100.0	4.9e-123
WP_069684471.1|3247893_3248199_+	regulator	NA	K7PJM7	Enterobacteria_phage	97.0	1.0e-46
WP_069684472.1|3248201_3248540_+	transcriptional regulator	NA	K7PJW2	Enterobacteria_phage	98.2	1.7e-58
WP_069684473.1|3248674_3248926_+	hypothetical protein	NA	A4KWV4	Enterobacteria_phage	97.6	3.1e-41
WP_069684474.1|3248965_3249262_+	hypothetical protein	NA	K7PH98	Enterobacteria_phage	98.0	1.2e-49
WP_021563807.1|3249258_3249420_+	hypothetical protein	NA	K7PMD4	Enterobacterial_phage	98.1	7.7e-22
WP_001183771.1|3249603_3249774_+	hypothetical protein	NA	A0A192Y6R1	Salmonella_phage	100.0	1.3e-24
WP_000050554.1|3249849_3250020_+	hypothetical protein	NA	K7PJW0	Enterobacteria_phage	100.0	3.0e-24
WP_000031367.1|3250030_3250636_+	ERF family protein	NA	K7P6W7	Enterobacteria_phage	100.0	4.1e-108
WP_000951323.1|3250635_3251019_+	hypothetical protein	NA	K7P6P8	Enterobacteria_phage	99.2	8.5e-67
WP_001111277.1|3251042_3251336_+	DUF2856 family protein	NA	G8C7L1	Escherichia_phage	97.9	4.7e-49
WP_001214456.1|3251346_3251511_+	DUF2737 family protein	NA	A0A2I6PID4	Escherichia_phage	100.0	1.1e-23
WP_069684476.1|3251507_3252014_+	hypothetical protein	NA	K7PGR4	Enterobacteria_phage	98.2	2.6e-87
WP_001163428.1|3252216_3252417_+	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
3256091:3256107	attR	TATTGGTATCGACAACC	NA	NA	NA	NA
>prophage 5
NZ_CP016404	Escherichia coli strain 210221272 chromosome, complete genome	4668621	3606279	3616795	4668621		Escherichia_phage(55.56%)	11	NA	NA
WP_001141322.1|3606279_3606936_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	6.2e-49
WP_001300386.1|3606986_3607754_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	7.4e-70
WP_000847985.1|3607949_3608858_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_000590403.1|3608854_3610117_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	1.7e-135
WP_001278994.1|3610113_3610752_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_001136934.1|3610756_3611533_+	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_000104441.1|3611621_3612986_+	GntP family transporter	NA	NA	NA	NA	NA
WP_000081550.1|3613079_3614072_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_001272592.1|3614134_3615274_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_069684494.1|3615413_3616040_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001295182.1|3616033_3616795_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
