The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP012568	Klebsiella pneumoniae strain UCLAOXA232KP chromosome, complete genome	5313304	98540	143487	5313304	head,tRNA,coat,terminase,tail,lysis	Cronobacter_phage(27.08%)	65	NA	NA
WP_004143010.1|98540_99926_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	3.5e-46
WP_004143016.1|99971_100184_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_004143017.1|100185_101052_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.8	1.3e-30
WP_071531921.1|102523_102859_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_040182114.1|102860_103079_-	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	52.2	4.4e-12
WP_040182113.1|103075_103603_-	phage N-6-adenine-methyltransferase	NA	Q9ZWX6	Enterobacteria_phage	61.0	1.1e-56
WP_040182112.1|103631_104255_-	YqaJ viral recombinase family protein	NA	A0A0S2SY31	Pseudomonas_phage	59.2	5.8e-57
WP_040182110.1|104251_104998_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	67.7	7.0e-65
WP_040182107.1|105014_105299_-	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	81.9	1.7e-40
WP_019704100.1|105388_105583_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074183191.1|105575_105701_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004178796.1|106084_107017_-	hypothetical protein	NA	K7PGT0	Enterobacteria_phage	55.5	1.9e-91
WP_004178798.1|107013_107487_-	hypothetical protein	NA	K7PLT9	Enterobacteria_phage	58.5	1.1e-52
WP_032429930.1|107736_108459_-	helix-turn-helix transcriptional regulator	NA	E7C9R0	Salmonella_phage	63.2	9.4e-75
WP_004194000.1|108527_108755_+	Cro/Cl family transcriptional regulator	NA	A0A2I6PIE5	Escherichia_phage	61.2	1.9e-18
WP_001548453.1|108794_109016_+	hypothetical protein	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
WP_065807611.1|109101_109956_+	replication protein	NA	K7PGT1	Enterobacteria_phage	54.8	2.8e-62
WP_065807612.1|109940_110813_+	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	69.4	3.8e-94
WP_012542626.1|110809_111103_+	protein ren	NA	O48423	Enterobacteria_phage	65.6	2.5e-26
WP_162899465.1|111105_111555_+	hypothetical protein	NA	R9TME7	Aeromonas_phage	31.7	7.5e-06
WP_065807614.1|111551_111788_+	hypothetical protein	NA	S4TVX5	Salmonella_phage	50.0	1.5e-13
WP_065807615.1|111780_112320_+	hypothetical protein	NA	A0A1V0E5L5	Salmonella_phage	37.6	9.3e-19
WP_009308003.1|112319_112496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077269010.1|112996_113473_+	DUF551 domain-containing protein	NA	A0A077SK54	Escherichia_phage	35.4	3.0e-13
WP_004191566.1|113879_114476_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	54.3	1.2e-56
WP_071854273.1|114481_114649_+	NinE family protein	NA	NA	NA	NA	NA
WP_065807617.1|114645_115314_+	metallophosphoesterase	NA	K7P6H8	Enterobacteria_phage	76.0	4.1e-101
WP_065807618.1|115306_115915_+	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	65.7	2.3e-50
WP_065807619.1|115911_116142_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004136182.1|116138_116279_+	YlcG family protein	NA	NA	NA	NA	NA
WP_065807620.1|116275_116965_+	antiterminator	NA	I6PDF8	Cronobacter_phage	54.9	1.1e-56
WP_012967717.1|117739_118054_+	hypothetical protein	NA	H6WRZ3	Salmonella_phage	86.1	8.3e-44
WP_040181191.1|118056_118560_+	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	78.4	5.0e-75
WP_040181192.1|118556_119024_+|lysis	lysis protein	lysis	Q76H63	Enterobacteria_phage	73.5	7.5e-57
WP_087749278.1|119026_119164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069377345.1|119232_119883_+	hypothetical protein	NA	G8C7P2	Escherichia_phage	89.4	6.2e-102
WP_040181332.1|119879_121448_+|terminase	terminase	terminase	G8C7P3	Escherichia_phage	91.2	2.4e-301
WP_040181330.1|121459_122908_+	hypothetical protein	NA	F1C5D7	Cronobacter_phage	51.0	2.1e-118
WP_087749279.1|122825_123839_+|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	69.7	1.8e-116
WP_020804668.1|123835_124039_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040181327.1|124089_125445_+	hypothetical protein	NA	F1C5D9	Cronobacter_phage	53.1	5.1e-130
WP_016529582.1|125444_125906_+	hypothetical protein	NA	B1GS72	Salmonella_phage	50.3	5.0e-29
WP_040027496.1|125902_126958_+|coat	phage coat protein	coat	A0A291AXD4	Shigella_phage	53.2	2.2e-101
WP_029884066.1|126990_127230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032439723.1|127232_127613_+	hypothetical protein	NA	F1C5E2	Cronobacter_phage	54.5	4.1e-29
WP_038434988.1|127612_127786_+	hypothetical protein	NA	Q5G8X7	Enterobacteria_phage	51.8	1.2e-12
WP_040181321.1|127785_128148_+	hypothetical protein	NA	G0ZNE2	Cronobacter_phage	50.8	1.6e-27
WP_040181318.1|128150_128519_+	hypothetical protein	NA	F1C5E3	Cronobacter_phage	82.0	1.9e-47
WP_023339086.1|128515_128899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023283367.1|128957_129722_+	immunoglobulin domain-containing protein	NA	G0ZNE6	Cronobacter_phage	43.8	2.7e-40
WP_040181312.1|129790_130504_+	hypothetical protein	NA	G0ZNE7	Cronobacter_phage	54.6	2.1e-63
WP_040181310.1|130721_131279_+	Rha family transcriptional regulator	NA	A0A088CBJ5	Shigella_phage	88.2	6.7e-89
WP_023339090.1|131425_131623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052450973.1|131591_132065_+	DUF2335 domain-containing protein	NA	NA	NA	NA	NA
WP_040181307.1|132160_132499_+	hypothetical protein	NA	H6WRV3	Salmonella_phage	57.3	1.0e-31
WP_071854270.1|132554_133025_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040181305.1|133116_135687_+|tail	tail protein (tape measure)	tail	F1C5E9	Cronobacter_phage	40.3	8.5e-94
WP_040181302.1|135727_135907_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071854269.1|135926_136340_-	hypothetical protein	NA	G0ZNE8	Cronobacter_phage	89.8	5.0e-65
WP_023283377.1|136453_136930_+	hypothetical protein	NA	A0A2P1MXB5	Escherichia_phage	49.0	3.0e-37
WP_004196571.1|136929_137400_+	hypothetical protein	NA	R9TPR6	Aeromonas_phage	40.4	1.2e-27
WP_040181295.1|137396_137792_+	C40 family peptidase	NA	F1C5F2	Cronobacter_phage	54.8	4.7e-36
WP_040186451.1|137778_140256_+	MoaD/ThiS family protein	NA	F1C5A7	Cronobacter_phage	45.3	1.4e-197
WP_071854268.1|142341_143142_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040181289.1|143247_143487_+	hypothetical protein	NA	K7P7N3	Enterobacteria_phage	51.9	4.2e-16
>prophage 2
NZ_CP012568	Klebsiella pneumoniae strain UCLAOXA232KP chromosome, complete genome	5313304	625078	634552	5313304	tRNA,protease	Dickeya_phage(16.67%)	8	NA	NA
WP_002896440.1|625078_626194_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
WP_004150848.1|626190_628131_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896516.1|628207_628429_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_002896520.1|628754_629072_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896522.1|629102_631382_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_001040187.1|631512_631731_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_023302126.1|632084_632786_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_023302125.1|632830_634552_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
>prophage 3
NZ_CP012568	Klebsiella pneumoniae strain UCLAOXA232KP chromosome, complete genome	5313304	873560	943175	5313304	head,portal,tRNA,plate,integrase,terminase,tail,capsid	Enterobacteria_phage(50.0%)	83	900756:900773	937931:937948
WP_004150803.1|873560_874667_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_004150802.1|874723_875182_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_004150801.1|875198_875849_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_004150800.1|876089_877340_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.1e-19
WP_004213085.1|877612_878326_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004150798.1|878322_878715_-	amino acid-binding protein	NA	NA	NA	NA	NA
WP_004150797.1|878707_879031_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_048263900.1|879119_879326_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019704434.1|879273_879459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004140530.1|879479_879707_-	DUF1272 domain-containing protein	NA	NA	NA	NA	NA
WP_004140529.1|879819_881013_-	glutathione-dependent formaldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_137013050.1|881228_881417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150795.1|881636_881822_+	general stress protein	NA	NA	NA	NA	NA
WP_004148027.1|881912_882407_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_004140514.1|882433_882940_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_004179357.1|882956_883844_+	manganese catalase family protein	NA	NA	NA	NA	NA
WP_004140511.1|883899_885306_+	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_004183659.1|885302_886313_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_004140506.1|886428_886626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150791.1|887192_887825_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_032409986.1|887864_888044_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150790.1|888441_889128_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_020804938.1|889240_889405_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023302066.1|889438_890947_-	UbiD family decarboxylase	NA	NA	NA	NA	NA
WP_021313530.1|891067_891958_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023302065.1|891964_893749_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.1	5.8e-17
WP_004140494.1|893822_895031_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_069377336.1|895333_896377_+	type II asparaginase	NA	NA	NA	NA	NA
WP_023302064.1|897038_897953_+	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	50.4	1.1e-72
WP_004150783.1|898042_898681_+	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_004140489.1|898811_899075_+	DUF2534 family protein	NA	NA	NA	NA	NA
WP_004140488.1|899134_899260_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004892898.1|899377_899452_-	protein YoaJ	NA	NA	NA	NA	NA
WP_004150782.1|899451_899553_-	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_004176549.1|899610_900624_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	29.0	1.9e-12
900756:900773	attL	AAAAAAAGCCCCGTCGGG	NA	NA	NA	NA
WP_040181453.1|900888_901872_-|integrase	tyrosine-type recombinase/integrase	integrase	Q83VS6	Escherichia_phage	79.8	1.4e-150
WP_004213095.1|901987_902287_-	helix-turn-helix transcriptional regulator	NA	Q1JS61	Enterobacteria_phage	77.8	6.5e-38
WP_020806130.1|902407_902686_+	regulatory phage cox family protein	NA	Q1JS60	Enterobacteria_phage	88.9	6.2e-43
WP_004216643.1|902706_902925_+	hypothetical protein	NA	A0A0M5M1I3	Salmonella_phage	49.1	3.6e-06
WP_040181449.1|902940_903318_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023329526.1|903333_903606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004213098.1|903674_903899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023329528.1|903895_904462_+	3'-5' exoribonuclease	NA	D4HTX2	Vibrio_phage	33.2	2.8e-13
WP_040181444.1|904694_905651_+	DNA adenine methylase	NA	A0A0M4QWR0	Salmonella_phage	54.4	1.5e-83
WP_162899463.1|905668_907720_+	replication endonuclease	NA	A0A0M4RTM8	Salmonella_phage	52.3	6.2e-188
WP_040181442.1|908540_910811_-	UvrD-helicase domain-containing protein	NA	NA	NA	NA	NA
WP_040181440.1|910810_911602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048289843.1|912446_913508_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	68.1	9.1e-143
WP_040181438.1|913501_915229_-	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	67.1	1.0e-228
WP_040181436.1|915385_916225_+|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	66.3	4.3e-95
WP_023328071.1|916234_917269_+|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	50.0	3.6e-96
WP_040181433.1|917318_918176_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	61.3	9.8e-71
WP_040181431.1|918288_918804_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	48.8	2.7e-39
WP_004131559.1|918803_919004_+|tail	tail protein X	tail	A0A0A7NV57	Enterobacteria_phage	63.1	1.6e-16
WP_004213110.1|918994_919279_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023339943.1|919275_919821_+	lysozyme	NA	Q1I0Z1	Pasteurella_virus	43.0	6.3e-31
WP_158246032.1|920007_920343_+	peptidase	NA	B6SD31	Bacteriophage	33.3	2.1e-05
WP_040181428.1|920343_920811_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	58.8	4.5e-46
WP_020316957.1|920807_921443_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	51.9	4.6e-57
WP_009486481.1|921439_922027_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	60.5	6.9e-60
WP_040181426.1|922023_922374_+	GPW/gp25 family protein	NA	A0A0A7NQ90	Enterobacteria_phage	58.2	1.8e-23
WP_023300878.1|922375_923299_+|plate	baseplate J/gp47 family protein	plate	A0A0A7NPY5	Enterobacteria_phage	43.6	7.6e-53
WP_040181424.1|923288_926315_+|tail	phage tail protein I	tail	D5LGZ2	Escherichia_phage	40.7	6.4e-24
WP_023339950.1|926311_926524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040181419.1|926523_927621_+|tail	phage tail protein	tail	G4KKN6	Yersinia_phage	47.8	5.2e-08
WP_052450975.1|928220_929444_+	DUF262 domain-containing protein	NA	A0A1V0S9I8	Catovirus	27.5	7.8e-05
WP_040181417.1|929461_930124_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040181415.1|930587_931061_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	66.9	6.6e-53
WP_040181412.1|931076_934052_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	46.4	2.0e-219
WP_071591910.1|934038_934176_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	65.9	4.4e-10
WP_004131585.1|934196_934514_-	hypothetical protein	NA	B9A7B2	Serratia_phage	54.8	1.0e-17
WP_004216461.1|934559_935075_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	61.2	2.2e-57
WP_071854307.1|935043_936246_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	70.7	3.3e-157
WP_040181406.1|936400_937540_+	phage late control D family protein	NA	B9A7A9	Serratia_phage	72.3	9.4e-146
WP_004213128.1|937583_937835_+	ogr/Delta-like zinc finger family protein	NA	A0A2I8TV89	Erwinia_phage	49.2	3.4e-08
WP_004176548.1|938099_938339_+	DUF333 domain-containing protein	NA	NA	NA	NA	NA
937931:937948	attR	AAAAAAAGCCCCGTCGGG	NA	NA	NA	NA
WP_014343000.1|938328_938667_-	DUF488 family protein	NA	NA	NA	NA	NA
WP_020802835.1|938671_939181_-	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_004140471.1|939326_940019_+	CTP synthase	NA	NA	NA	NA	NA
WP_020324105.1|940050_941226_-	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_004140469.1|941333_942128_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002901080.1|942111_942558_-	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_004892876.1|942674_943175_-|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
>prophage 4
NZ_CP012568	Klebsiella pneumoniae strain UCLAOXA232KP chromosome, complete genome	5313304	1097723	1187249	5313304	protease,head,portal,plate,tRNA,integrase,holin,terminase,tail,capsid	Klebsiella_phage(63.46%)	97	1093439:1093454	1116032:1116047
1093439:1093454	attL	ACCTGCAATAGCTCTC	NA	NA	NA	NA
WP_023285032.1|1097723_1098485_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.1	3.1e-20
WP_004224331.1|1098701_1100234_+	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	30.0	1.5e-21
WP_016197745.1|1100432_1100981_-	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_040186739.1|1101177_1102359_+|integrase	site-specific integrase	integrase	A0A0M4QX09	Salmonella_phage	84.2	1.3e-201
WP_077255525.1|1102339_1102582_-	AlpA family transcriptional regulator	NA	A0A0M4RTZ2	Salmonella_phage	73.8	2.2e-20
WP_004198245.1|1102541_1102688_-	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	70.8	2.9e-15
WP_103219593.1|1102760_1103645_-	hypothetical protein	NA	A0A2H4FNA9	Salmonella_phage	70.6	5.1e-06
WP_040186810.1|1103641_1103866_-	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	94.6	1.7e-30
WP_032415174.1|1103855_1104581_-	Rha family transcriptional regulator	NA	A0A286S260	Klebsiella_phage	99.6	1.4e-131
WP_040186812.1|1104586_1105105_-	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	97.7	9.4e-93
WP_040186814.1|1105145_1105586_-	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	80.8	7.5e-59
WP_004177208.1|1105582_1105801_-	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	98.6	6.6e-32
WP_040186816.1|1105772_1106027_-	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	89.3	1.4e-36
WP_023304721.1|1106019_1106385_-	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	97.5	5.8e-57
WP_004177202.1|1106385_1106610_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040182568.1|1106792_1107206_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029602970.1|1107369_1108029_-	LexA family transcriptional regulator	NA	A0A1B5FPF4	Escherichia_phage	79.5	9.4e-98
WP_071854265.1|1108184_1108418_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPK9	Escherichia_phage	63.9	4.9e-17
WP_040182571.1|1109088_1109457_+	hypothetical protein	NA	A0A286S263	Klebsiella_phage	82.8	6.7e-53
WP_048322137.1|1109498_1111157_+	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	97.5	0.0e+00
WP_071854264.1|1111158_1112121_+	toprim domain-containing protein	NA	A0A286N2Q0	Klebsiella_phage	98.8	3.1e-182
WP_040182574.1|1112117_1112900_+	antitermination protein	NA	F1C595	Cronobacter_phage	79.1	6.5e-114
WP_004184721.1|1113053_1113311_+	hypothetical protein	NA	A0A286N2Q3	Klebsiella_phage	100.0	1.3e-42
WP_031280381.1|1113216_1113663_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017145563.1|1114225_1114621_+|holin	phage holin family protein	holin	K7PHB9	Enterobacterial_phage	98.5	2.6e-63
WP_019705280.1|1114607_1114889_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	80.6	3.9e-37
WP_023304728.1|1114888_1115518_+	glycoside hydrolase family 19 protein	NA	G8C7W0	Escherichia_phage	90.9	6.9e-106
WP_040182576.1|1115525_1115801_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	41.6	9.9e-09
WP_031591489.1|1116036_1116321_-	hypothetical protein	NA	NA	NA	NA	NA
1116032:1116047	attR	GAGAGCTATTGCAGGT	NA	NA	NA	NA
WP_023304730.1|1116453_1116726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032408647.1|1117050_1117287_+	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	94.9	1.6e-31
WP_071854263.1|1117367_1117574_+	DUF551 domain-containing protein	NA	A0A286N2R2	Klebsiella_phage	97.1	1.1e-33
WP_040182580.1|1117644_1117935_+	HNH endonuclease	NA	A0A286N2R3	Klebsiella_phage	94.8	2.9e-51
WP_040182582.1|1117947_1118157_+	hypothetical protein	NA	A0A286N2R4	Klebsiella_phage	84.1	2.4e-23
WP_004143905.1|1118278_1118713_+	hypothetical protein	NA	A0A286S1P9	Klebsiella_phage	100.0	6.2e-74
WP_004143904.1|1118722_1120255_+|terminase	terminase	terminase	A0A286S1M9	Klebsiella_phage	100.0	3.9e-296
WP_017880221.1|1120257_1121535_+|portal	phage portal protein	portal	A0A286S1N5	Klebsiella_phage	100.0	6.2e-247
WP_077255528.1|1121540_1122221_+|head,protease	HK97 family phage prohead protease	head,protease	A0A286S1N1	Klebsiella_phage	99.6	2.7e-124
WP_040186862.1|1122232_1123396_+|capsid	phage major capsid protein	capsid	A0A286S1R4	Klebsiella_phage	99.2	3.8e-211
WP_044067369.1|1123432_1123675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040186860.1|1123622_1123949_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A286S294	Klebsiella_phage	99.1	9.8e-56
WP_004899632.1|1124009_1124207_+	hypothetical protein	NA	A0A286S2A5	Klebsiella_phage	96.9	2.4e-25
WP_040186341.1|1124208_1124541_+|head	phage head closure protein	head	A0A286S2A2	Klebsiella_phage	98.2	1.0e-55
WP_004216814.1|1124533_1125073_+	HK97 gp10 family phage protein	NA	A0A286S249	Klebsiella_phage	99.4	3.0e-94
WP_000561415.1|1125069_1125435_+	DUF3168 domain-containing protein	NA	A0A286S1R1	Klebsiella_phage	92.6	3.9e-61
WP_000115125.1|1125490_1125982_+	hypothetical protein	NA	A0A286S1Q8	Klebsiella_phage	100.0	2.3e-88
WP_001177591.1|1126025_1126379_+|tail	phage tail assembly chaperone family protein, TAC	tail	A0A286S1N4	Klebsiella_phage	99.1	4.9e-61
WP_004143895.1|1126411_1126675_+	hypothetical protein	NA	A0A286S1P2	Klebsiella_phage	98.8	5.9e-43
WP_004143894.1|1126740_1127208_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040182604.1|1127252_1129700_+|tail	phage tail tape measure protein	tail	A0A286S1S3	Klebsiella_phage	66.5	5.9e-278
WP_004899614.1|1129699_1130179_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	98.7	1.7e-93
WP_040182606.1|1130165_1130648_+	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	98.8	6.0e-86
WP_004152651.1|1130657_1131038_+	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	99.2	1.8e-72
WP_048322138.1|1131034_1134103_+	kinase	NA	A0A286S259	Klebsiella_phage	97.2	0.0e+00
WP_040186352.1|1136152_1136953_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019705237.1|1138054_1138303_-	DinI-like family protein	NA	S5MQI1	Escherichia_phage	70.4	1.0e-25
WP_004176434.1|1139148_1139640_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_023302033.1|1139682_1141227_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_004179544.1|1141236_1142580_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004176431.1|1142576_1143266_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_021440002.1|1143262_1144969_+	OmpA family protein	NA	NA	NA	NA	NA
WP_002902160.1|1144973_1145465_+	type VI secretion system effector Hcp	NA	NA	NA	NA	NA
WP_023302030.1|1145729_1148384_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	33.4	7.7e-98
WP_024623002.1|1148385_1150755_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	33.0	2.4e-18
WP_021440005.1|1150758_1151535_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_023302028.1|1151559_1152090_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_040181976.1|1152077_1154477_+	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_040181978.1|1154519_1154777_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_021440008.1|1154725_1155907_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021440009.1|1155896_1159346_+	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_004183804.1|1159342_1160935_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_021440010.1|1161013_1162768_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004176418.1|1162731_1163817_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_040181981.1|1163794_1164337_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_009309032.1|1164464_1164959_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023302022.1|1165025_1165739_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_021440012.1|1165812_1166406_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004151596.1|1166410_1167166_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_004151595.1|1167324_1168203_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_004179576.1|1168253_1168460_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_021440014.1|1168485_1169415_-	aromatic alcohol reductase	NA	NA	NA	NA	NA
WP_004190483.1|1169559_1170465_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_052455031.1|1170484_1170799_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020324664.1|1171495_1172365_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_024622999.1|1172357_1173269_+	NmrA/HSCARG family protein	NA	NA	NA	NA	NA
WP_004179582.1|1173323_1173872_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004179583.1|1173960_1174995_+	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_023285056.1|1175039_1176215_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_002902393.1|1176435_1177242_+	methionine-binding protein	NA	NA	NA	NA	NA
WP_004892563.1|1178255_1178924_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_019705261.1|1179991_1180738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004176404.1|1180850_1181045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023302016.1|1181281_1182400_-	oxidoreductase	NA	NA	NA	NA	NA
WP_023302015.1|1182362_1183106_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.1	1.0e-15
WP_004148192.1|1183385_1184369_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_004151591.1|1184894_1186268_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.3	8.6e-53
WP_002902422.1|1186313_1187249_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	93.0	3.5e-138
>prophage 5
NZ_CP012568	Klebsiella pneumoniae strain UCLAOXA232KP chromosome, complete genome	5313304	1361915	1372803	5313304		Escherichia_phage(87.5%)	9	NA	NA
WP_002210516.1|1361915_1362536_-	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
WP_032423485.1|1362528_1363794_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.3	6.6e-233
WP_002903955.1|1363805_1364708_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_002210513.1|1364969_1365731_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_001620095.1|1365751_1366612_-	class A broad-spectrum beta-lactamase SHV-1	NA	A0A077SL40	Escherichia_phage	99.7	4.4e-156
WP_004176262.1|1366909_1367170_+	hypothetical protein	NA	A0A077SK33	Escherichia_phage	98.8	5.4e-41
WP_040182017.1|1367256_1368345_+	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	99.7	8.8e-210
WP_004176258.1|1368375_1369641_-	MFS transporter	NA	NA	NA	NA	NA
WP_040182019.1|1369695_1372803_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
>prophage 6
NZ_CP012568	Klebsiella pneumoniae strain UCLAOXA232KP chromosome, complete genome	5313304	2029415	2081551	5313304	tail,tRNA,plate,head	uncultured_Caudovirales_phage(40.0%)	52	NA	NA
WP_004891136.1|2029415_2030672_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_002910405.1|2030942_2031554_+	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_014343188.1|2031553_2032402_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_002910407.1|2032585_2033533_+	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.5	2.3e-44
WP_004189412.1|2033657_2035337_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.4	1.0e-23
WP_023301802.1|2035338_2036385_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002910437.1|2036605_2036881_-	stress-induced protein YchH	NA	NA	NA	NA	NA
WP_009307591.1|2037153_2037738_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_002910443.1|2037855_2038947_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_004145442.1|2039027_2039357_-	DUF1869 domain-containing protein	NA	NA	NA	NA	NA
WP_002910453.1|2039440_2040355_-	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_009307590.1|2040486_2041902_-	type VI secretion system ImpA family N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_004152261.1|2041921_2042365_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_004184604.1|2042367_2042904_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_004152910.1|2042884_2043901_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_069377385.1|2043930_2045694_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_023301801.1|2045827_2049244_-	type VI secretion system protein ImpL	NA	NA	NA	NA	NA
WP_029499423.1|2050473_2050731_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_032413757.1|2050756_2051164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004148791.1|2051656_2052553_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023342696.1|2052567_2054595_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A2H4JIA8	uncultured_Caudovirales_phage	31.6	2.6e-74
WP_009307584.1|2054597_2057225_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	31.5	2.3e-17
WP_009307583.1|2057683_2059381_-	OmpA family protein	NA	NA	NA	NA	NA
WP_004175498.1|2059384_2060038_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_009307582.1|2060034_2061375_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_002910650.1|2061940_2062270_+	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_002910652.1|2062384_2062924_+	DUF2058 domain-containing protein	NA	NA	NA	NA	NA
WP_002910654.1|2062949_2063648_-	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	27.2	2.6e-05
WP_040181240.1|2063839_2064322_+	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_040181238.1|2065296_2065614_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	52.0	1.8e-22
WP_064172271.1|2065613_2065853_-	hypothetical protein	NA	K7P7N3	Enterobacteria_phage	50.6	1.4e-14
WP_071854259.1|2065957_2066758_-	hypothetical protein	NA	NA	NA	NA	NA
WP_119183683.1|2066767_2068750_-	hypothetical protein	NA	A0A286S1P0	Klebsiella_phage	27.6	1.2e-26
WP_069377383.1|2068768_2069542_-	hypothetical protein	NA	A0A248SL44	Klebsiella_phage	49.2	8.6e-26
WP_040181232.1|2069541_2070315_-	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	51.0	1.8e-68
WP_065807624.1|2070311_2071511_-|plate	baseplate J/gp47 family protein	plate	A0A0M4RD32	Salmonella_phage	75.3	5.8e-162
WP_048289810.1|2071510_2071864_-	bacteriophage protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	78.6	3.0e-50
WP_065807623.1|2071860_2072517_-	translation initiation factor IF-2	NA	A0A0M5M1K7	Salmonella_phage	64.8	1.7e-83
WP_050008892.1|2072739_2073096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065807629.1|2073107_2073416_-	hypothetical protein	NA	A0A0M4RTY3	Salmonella_phage	90.9	2.4e-35
WP_065807621.1|2073451_2074513_-	hypothetical protein	NA	A0A0M4QX01	Salmonella_phage	69.9	2.1e-139
WP_074422975.1|2074515_2074743_-	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	49.3	1.3e-17
WP_065802512.1|2074818_2075394_-	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	71.2	1.7e-66
WP_065802509.1|2075393_2077391_-	lytic transglycosylase domain-containing protein	NA	A0A0M4REK7	Salmonella_phage	61.7	7.5e-231
WP_065802507.1|2077380_2077533_-	NTP pyrophosphohydrolase	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	76.0	1.0e-15
WP_065802505.1|2077574_2077994_-	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	66.7	3.0e-41
WP_023312781.1|2077997_2078441_-	DUF3277 family protein	NA	A0A0M5M1K6	Salmonella_phage	80.0	2.1e-61
WP_065802503.1|2078450_2079596_-	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	77.7	1.3e-166
WP_004152176.1|2079599_2080040_-	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	51.7	1.6e-40
WP_065519890.1|2080134_2080521_-|head,tail	head-tail adaptor	head,tail	A0A2H4J1A4	uncultured_Caudovirales_phage	75.8	5.8e-47
WP_064151821.1|2080520_2081135_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065802501.1|2081131_2081551_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	60.7	4.4e-40
>prophage 7
NZ_CP012568	Klebsiella pneumoniae strain UCLAOXA232KP chromosome, complete genome	5313304	2090655	2122126	5313304	lysis,integrase,terminase	Salmonella_phage(27.03%)	48	2083643:2083659	2100210:2100226
2083643:2083659	attL	TATCGGTTTCGTATCTG	NA	NA	NA	NA
WP_071854257.1|2090655_2091180_-	host cell division inhibitor Icd-like protein	NA	A0A2H4JGN8	uncultured_Caudovirales_phage	43.7	1.4e-14
WP_048265733.1|2091965_2092178_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_064162991.1|2092301_2093531_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1V0E8G8	Vibrio_phage	40.5	3.6e-74
WP_040181205.1|2094120_2094615_-	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	61.5	2.1e-49
WP_040181203.1|2094618_2095821_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	52.8	5.3e-107
WP_025714258.1|2095830_2096025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025714257.1|2096070_2096619_-	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	56.9	1.0e-49
WP_039108763.1|2096674_2098126_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	68.4	7.2e-191
WP_040181195.1|2098363_2099764_-|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	69.2	7.2e-188
WP_074422973.1|2099714_2100203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087749278.1|2100559_2100697_-	hypothetical protein	NA	NA	NA	NA	NA
2100210:2100226	attR	TATCGGTTTCGTATCTG	NA	NA	NA	NA
WP_040181192.1|2100699_2101167_-|lysis	lysis protein	lysis	Q76H63	Enterobacteria_phage	73.5	7.5e-57
WP_040181191.1|2101163_2101667_-	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	78.4	5.0e-75
WP_012967717.1|2101669_2101984_-	hypothetical protein	NA	H6WRZ3	Salmonella_phage	86.1	8.3e-44
WP_065807620.1|2102758_2103448_-	antiterminator	NA	I6PDF8	Cronobacter_phage	54.9	1.1e-56
WP_004136182.1|2103444_2103585_-	YlcG family protein	NA	NA	NA	NA	NA
WP_065807619.1|2103581_2103812_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065807618.1|2103808_2104417_-	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	65.7	2.3e-50
WP_065807617.1|2104409_2105078_-	metallophosphoesterase	NA	K7P6H8	Enterobacteria_phage	76.0	4.1e-101
WP_071854273.1|2105074_2105242_-	NinE family protein	NA	NA	NA	NA	NA
WP_004191566.1|2105247_2105844_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	54.3	1.2e-56
WP_077269010.1|2106250_2106727_-	DUF551 domain-containing protein	NA	A0A077SK54	Escherichia_phage	35.4	3.0e-13
WP_009308003.1|2107227_2107404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065807615.1|2107403_2107943_-	hypothetical protein	NA	A0A1V0E5L5	Salmonella_phage	37.6	9.3e-19
WP_065807614.1|2107935_2108172_-	hypothetical protein	NA	S4TVX5	Salmonella_phage	50.0	1.5e-13
WP_162899465.1|2108168_2108618_-	hypothetical protein	NA	R9TME7	Aeromonas_phage	31.7	7.5e-06
WP_012542626.1|2108620_2108914_-	protein ren	NA	O48423	Enterobacteria_phage	65.6	2.5e-26
WP_065807612.1|2108910_2109783_-	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	69.4	3.8e-94
WP_001548453.1|2110705_2110927_-	hypothetical protein	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
WP_004191589.1|2110967_2111186_-	helix-turn-helix transcriptional regulator	NA	A0A1P8DTF8	Proteus_phage	50.7	1.4e-13
WP_021312733.1|2111294_2111954_+	helix-turn-helix domain-containing protein	NA	K7P7K3	Enterobacteria_phage	61.5	1.9e-69
WP_004219883.1|2112332_2112458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008807814.1|2112450_2112657_+	phage encoded cell division inhibitor protein	NA	A0A0M4S6W3	Salmonella_phage	94.1	1.4e-31
WP_040181687.1|2112737_2113022_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	78.7	4.3e-39
WP_040181685.1|2113037_2113883_+	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	58.8	2.6e-68
WP_124072215.1|2114050_2114500_+	hypothetical protein	NA	A0A221SAP1	Ralstonia_phage	52.6	1.0e-18
WP_040181683.1|2114492_2115179_+	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	90.6	4.8e-113
WP_016529279.1|2115175_2115334_+	DUF1317 family protein	NA	A0A0N7CHV0	Escherichia_phage	58.8	6.7e-10
WP_024264482.1|2115330_2115858_+	phage N-6-adenine-methyltransferase	NA	Q9ZWX6	Enterobacteria_phage	62.2	1.3e-57
WP_040181679.1|2115854_2116625_+	hypothetical protein	NA	D5LH17	Escherichia_phage	51.0	3.2e-65
WP_065802489.1|2116841_2117606_+	hypothetical protein	NA	Q71T76	Escherichia_phage	58.3	3.0e-71
WP_040218332.1|2117602_2117794_+	DUF1382 family protein	NA	G9L698	Escherichia_phage	64.4	1.3e-12
WP_032431536.1|2117790_2118000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009483816.1|2117996_2118215_+	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	52.2	2.6e-12
WP_040181674.1|2118218_2118464_+	excisionase family protein	NA	A0A286S2A4	Klebsiella_phage	92.1	1.9e-35
WP_021312745.1|2118506_2119769_+	DUF3596 domain-containing protein	NA	A0A286S1S8	Klebsiella_phage	95.0	1.7e-233
WP_074183181.1|2120009_2120819_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_004175494.1|2120830_2122126_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	36.8	9.6e-62
>prophage 8
NZ_CP012568	Klebsiella pneumoniae strain UCLAOXA232KP chromosome, complete genome	5313304	2457343	2464248	5313304	tRNA	Bacillus_phage(33.33%)	6	NA	NA
WP_004149058.1|2457343_2458822_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	8.5e-30
WP_004175198.1|2458818_2459541_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
WP_004144192.1|2459859_2461221_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.8	1.8e-207
WP_004151134.1|2461463_2462360_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_004180550.1|2462600_2463374_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	3.9e-26
WP_004175147.1|2463384_2464248_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
>prophage 9
NZ_CP012568	Klebsiella pneumoniae strain UCLAOXA232KP chromosome, complete genome	5313304	2663145	2728301	5313304	head,portal,terminase,tRNA,integrase,holin,protease,tail,capsid	Klebsiella_phage(53.19%)	78	2685876:2685899	2725329:2725352
WP_009307375.1|2663145_2663958_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_002913227.1|2663957_2664971_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_009307374.1|2665034_2666171_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	27.8	1.6e-20
WP_023282884.1|2666281_2667259_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_004149211.1|2667345_2668521_-	MFS transporter	NA	NA	NA	NA	NA
WP_002913291.1|2668730_2669951_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_023301691.1|2670109_2672098_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_002913338.1|2672159_2672441_-	YfcL family protein	NA	NA	NA	NA	NA
WP_002913339.1|2672472_2673021_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_002913340.1|2673020_2673830_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_004174960.1|2673829_2674654_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_023287874.1|2674656_2675742_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	46.6	7.7e-89
WP_069377392.1|2675783_2676716_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_002913348.1|2676883_2677435_+	endonuclease SmrB	NA	NA	NA	NA	NA
WP_002913355.1|2677455_2677941_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_004174952.1|2678150_2680295_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_002913358.1|2680294_2681605_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_002913359.1|2681764_2682049_-	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_002913360.1|2682422_2683745_+	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_002913362.1|2683806_2684568_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_004149224.1|2684857_2685787_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	81.4	6.7e-134
2685876:2685899	attL	TGTCCCCTTAGTTAAATGGATATA	NA	NA	NA	NA
WP_032422721.1|2685993_2686365_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	50.9	9.2e-26
WP_019705521.1|2686321_2686561_-	hypothetical protein	NA	I6PD82	Cronobacter_phage	55.7	1.5e-21
WP_077255527.1|2687111_2687564_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_019705523.1|2687653_2688013_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_040181868.1|2689358_2690159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065802474.1|2692204_2695273_-	kinase	NA	A0A286S259	Klebsiella_phage	97.7	0.0e+00
WP_064184941.1|2695269_2695650_-	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	96.0	1.8e-69
WP_064184942.1|2695659_2696142_-	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	98.8	3.9e-85
WP_004899614.1|2696128_2696608_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	98.7	1.7e-93
WP_064184943.1|2696607_2699142_-|tail	phage tail tape measure protein	tail	A0A286S1S3	Klebsiella_phage	74.4	0.0e+00
WP_133060711.1|2699190_2699568_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004104224.1|2699626_2699890_-	hypothetical protein	NA	A0A286S1P2	Klebsiella_phage	91.9	3.0e-39
WP_004899623.1|2699892_2700276_-|tail	phage tail assembly chaperone family protein, TAC	tail	A0A286S1N4	Klebsiella_phage	86.3	1.4e-53
WP_000115125.1|2700319_2700811_-	hypothetical protein	NA	A0A286S1Q8	Klebsiella_phage	100.0	2.3e-88
WP_000561415.1|2700867_2701233_-	DUF3168 domain-containing protein	NA	A0A286S1R1	Klebsiella_phage	92.6	3.9e-61
WP_064184944.1|2701229_2701769_-	HK97 gp10 family phage protein	NA	A0A286S249	Klebsiella_phage	99.4	2.3e-94
WP_064184945.1|2701761_2702094_-|head	phage head closure protein	head	A0A286S2A2	Klebsiella_phage	99.1	1.5e-56
WP_004143899.1|2702095_2702293_-	hypothetical protein	NA	A0A286S2A5	Klebsiella_phage	100.0	1.7e-26
WP_017880223.1|2702353_2702680_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A286S294	Klebsiella_phage	100.0	7.5e-56
WP_133060710.1|2702627_2702870_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064184946.1|2702906_2704070_-|capsid	phage major capsid protein	capsid	A0A286S1R4	Klebsiella_phage	99.7	7.7e-212
WP_077269009.1|2704081_2704762_-|head,protease	HK97 family phage prohead protease	head,protease	A0A286S1N1	Klebsiella_phage	99.6	6.0e-124
WP_017880221.1|2704767_2706045_-|portal	phage portal protein	portal	A0A286S1N5	Klebsiella_phage	100.0	6.2e-247
WP_004143904.1|2706047_2707580_-|terminase	terminase	terminase	A0A286S1M9	Klebsiella_phage	100.0	3.9e-296
WP_064184913.1|2707589_2708024_-	hypothetical protein	NA	A0A286S1P9	Klebsiella_phage	99.3	2.4e-73
WP_004216880.1|2708145_2708355_-	hypothetical protein	NA	A0A286N2R4	Klebsiella_phage	87.0	2.6e-25
WP_042950190.1|2708367_2708658_-	HNH endonuclease	NA	A0A286N2R3	Klebsiella_phage	94.8	1.7e-51
WP_042950192.1|2708714_2708936_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004216876.1|2709002_2709248_-	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	96.3	3.0e-33
WP_064184914.1|2709324_2710617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106493672.1|2710613_2711036_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052454910.1|2711191_2711389_-	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	84.5	7.3e-22
WP_064184915.1|2711339_2711615_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	65.2	2.1e-22
WP_064184916.1|2711611_2711959_-	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	78.3	5.7e-38
WP_064184917.1|2711955_2712495_-	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	96.6	3.1e-99
WP_024176410.1|2712491_2712791_-|holin	phage holin family protein	holin	A0A286N2Q5	Klebsiella_phage	83.8	4.5e-39
WP_064184918.1|2712960_2713200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064184919.1|2713351_2713930_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	55.6	1.9e-49
WP_071854253.1|2713943_2714924_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	66.9	1.1e-134
WP_000779146.1|2714936_2715314_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	73.6	2.3e-48
WP_049006283.1|2715323_2716133_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	69.3	3.5e-110
WP_069377391.1|2716129_2717098_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	66.0	1.6e-85
WP_001208720.1|2717087_2717267_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	73.1	4.6e-15
WP_004213338.1|2717504_2717966_-	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	88.2	1.7e-69
WP_024176406.1|2717991_2718201_-	cell division protein	NA	NA	NA	NA	NA
WP_019705289.1|2718295_2718940_+	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	40.7	8.2e-38
WP_040149782.1|2719328_2719628_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064184923.1|2719627_2720413_+	hypothetical protein	NA	C7BGF1	Burkholderia_phage	53.3	8.1e-64
WP_048270910.1|2720540_2720951_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064184924.1|2721228_2721969_+	hypothetical protein	NA	R9TPK2	Aeromonas_phage	97.3	2.5e-30
WP_004141386.1|2721968_2722181_+	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	45.5	8.1e-11
WP_064184925.1|2722177_2722786_+	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	82.4	4.8e-48
WP_064184926.1|2722993_2723932_-	DUF2971 domain-containing protein	NA	J9Q7Y9	Salmonella_phage	31.7	5.8e-08
WP_064184927.1|2723964_2725134_-|integrase	site-specific integrase	integrase	A0A2R2Z2Y0	Escherichia_phage	85.5	1.1e-200
WP_004174945.1|2725652_2726135_+	WbuC family cupin fold metalloprotein	NA	NA	NA	NA	NA
2725329:2725352	attR	TGTCCCCTTAGTTAAATGGATATA	NA	NA	NA	NA
WP_023301636.1|2726501_2727383_+	hypothetical protein	NA	A0A2H4JEC4	uncultured_Caudovirales_phage	56.8	1.5e-05
WP_004149227.1|2727392_2728301_-	transcriptional regulator CynR	NA	A0A2P0ZL89	Lactobacillus_phage	24.2	4.6e-10
>prophage 1
NZ_CP012569	Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-3.X, complete sequence	83730	11158	52423	83730	integrase,transposase	Escherichia_phage(21.05%)	51	28050:28066	49562:49578
WP_000845048.1|11158_12172_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_000237816.1|12344_12797_+	NAD(+)--rifampin ADP-ribosyltransferase Arr-2	NA	NA	NA	NA	NA
WP_022631163.1|12877_14131_-	group II intron reverse transcriptase/maturase	NA	H7BVN7	unidentified_phage	29.7	3.0e-12
WP_022631510.1|14851_15406_+	AAC(6')-Ib family aminoglycoside 6'-N-acetyltransferase	NA	NA	NA	NA	NA
WP_015632396.1|15816_16596_+	16S rRNA (guanine(1405)-N(7))-methyltransferase RmtF1	NA	NA	NA	NA	NA
WP_031281281.1|18244_18877_-	type B chloramphenicol O-acetyltransferase	NA	A0A2R8FE91	Brazilian_cedratvirus	40.9	2.6e-28
WP_000376623.1|19659_20160_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001389365.1|20666_21431_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_004098817.1|21691_22906_+	type II site-specific deoxyribonuclease	NA	E5E3X4	Burkholderia_phage	42.5	1.2e-34
WP_072094655.1|22939_24343_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	9.0e-106
WP_071854279.1|24691_25396_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	4.5e-138
WP_001348075.1|25442_25679_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_071854281.1|25752_26169_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_001261282.1|26165_26396_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_165763053.1|26352_26814_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015632378.1|26958_27273_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024191724.1|27321_27633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016162067.1|27697_28702_+	hypothetical protein	NA	NA	NA	NA	NA
28050:28066	attL	CGCCGGAAACGCTGGTC	NA	NA	NA	NA
WP_032495756.1|28745_28907_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015632375.1|28899_29694_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	88.7	5.5e-52
WP_006788217.1|30165_30345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004197649.1|30464_31091_-	ParA family plasmid-partitioning AAA ATPase	NA	A0A222YXS3	Escherichia_phage	43.6	2.9e-40
WP_004098982.1|31723_32599_-	RepB family plasmid replication initiator protein	NA	Q71TL8	Escherichia_phage	56.4	5.6e-82
WP_016162068.1|33010_34282_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.0	2.6e-152
WP_015632467.1|34281_34713_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.7	7.2e-30
WP_015632466.1|35656_36682_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_015632465.1|36867_37086_+	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_015632464.1|37085_37391_+	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_015632463.1|37535_37880_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015632462.1|37921_38488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016162071.1|38691_38949_-	helix-turn-helix transcriptional regulator	NA	H2DE32	Erwinia_phage	56.4	5.1e-07
WP_016162072.1|39378_39606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015632459.1|39947_40391_-	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0R6PJ17	Moraxella_phage	33.8	4.6e-16
WP_015632458.1|40416_40599_-	type II toxin-antitoxin system HicA family toxin	NA	A0A0D4DC32	Acinetobacter_phage	48.3	2.0e-05
WP_015632457.1|40959_41940_+	partitioning protein	NA	A0A0A7NPX4	Enterobacteria_phage	49.4	2.3e-76
WP_015632456.1|41932_42361_+	plasmid partitioning/stability family protein	NA	NA	NA	NA	NA
WP_015632455.1|42513_42972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015632454.1|42968_43457_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_015632453.1|43584_44022_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016162075.1|44615_44975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032441934.1|45118_45298_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015632451.1|45371_46232_+	DUF4942 domain-containing protein	NA	I6RTT5	Marinomonas_phage	29.6	2.8e-17
WP_015632450.1|46401_46839_+	antirestriction protein	NA	NA	NA	NA	NA
WP_016162076.1|47530_47764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015632449.1|47817_48138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015632448.1|48408_48741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016162079.1|49136_49448_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015632446.1|49450_51379_+	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
49562:49578	attR	GACCAGCGTTTCCGGCG	NA	NA	NA	NA
WP_016162080.1|51419_51671_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016162081.1|51682_51940_-	hypothetical protein	NA	A0A1B2LRT6	Wolbachia_phage	41.5	1.2e-05
WP_015632445.1|52015_52423_+|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	40.2	1.4e-14
>prophage 1
NZ_CP012570	Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-4.X, complete sequence	111236	0	111036	111236	integrase,tail,terminase,portal	Salmonella_phage(90.72%)	112	15680:15698	98536:98554
WP_014342073.1|0_1218_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	47.3	1.3e-73
WP_014342074.1|1669_1882_-	hypothetical protein	NA	J9Q7S8	Salmonella_phage	80.0	4.3e-28
WP_019704552.1|1881_2217_-	hypothetical protein	NA	J9Q7Z5	Salmonella_phage	67.6	2.1e-37
WP_014342076.1|2579_2756_-	hypothetical protein	NA	J9Q7G9	Salmonella_phage	68.8	4.7e-12
WP_019704549.1|4005_4272_-	hypothetical protein	NA	J9Q7G8	Salmonella_phage	84.1	1.7e-34
WP_014342079.1|4271_5216_-	exonuclease	NA	J9Q7S6	Salmonella_phage	93.0	1.1e-171
WP_032439699.1|5276_6284_-	hypothetical protein	NA	J9Q7Z3	Salmonella_phage	88.6	5.4e-145
WP_032439785.1|6403_6835_-	hypothetical protein	NA	J9Q6I8	Salmonella_phage	91.4	3.4e-64
WP_032439697.1|6985_7633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032439695.1|7737_8712_+	FRG domain-containing protein	NA	NA	NA	NA	NA
WP_072199362.1|8811_9237_-	hypothetical protein	NA	J9Q7S4	Salmonella_phage	80.9	7.5e-56
WP_060613611.1|9251_12770_-	DNA polymerase III subunit alpha	NA	J9Q7Z2	Salmonella_phage	93.2	0.0e+00
WP_032439780.1|12950_14183_-	AAA family ATPase	NA	J9Q733	Salmonella_phage	86.4	2.2e-212
WP_071854283.1|14279_16559_-	porphyrin biosynthesis protein	NA	J9Q7G6	Salmonella_phage	63.1	5.0e-247
15680:15698	attL	TAGGTATGTACTTACTTAT	NA	NA	NA	NA
WP_014342091.1|17160_17541_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_032439777.1|17535_18636_-|integrase	site-specific integrase	integrase	A0A1P8DTG6	Proteus_phage	30.0	9.4e-18
WP_019704541.1|18985_19345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014342093.1|19409_19820_-	type II toxin-antitoxin system YafO family toxin	NA	NA	NA	NA	NA
WP_014342094.1|19829_20435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026005930.1|20529_20775_-	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	47.4	5.3e-14
WP_014342096.1|20905_21679_-	phosphate starvation-inducible protein PhoH	NA	W8D063	Erwinia_phage	65.0	1.1e-89
WP_014342097.1|21919_23509_+	hypothetical protein	NA	NA	NA	NA	NA
WP_179235152.1|24676_24919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014342103.1|25066_25282_-	hypothetical protein	NA	J9Q6I3	Salmonella_phage	77.1	3.2e-23
WP_014342104.1|25265_25430_-	hypothetical protein	NA	J9Q729	Salmonella_phage	72.5	6.7e-13
WP_014342105.1|25441_26764_-	putative DNA ligase	NA	J9Q7G5	Salmonella_phage	85.2	4.8e-226
WP_050484893.1|26763_27231_-	hypothetical protein	NA	J9Q7R9	Salmonella_phage	63.9	7.5e-49
WP_032439773.1|27310_28099_-	hypothetical protein	NA	J9Q7Z0	Salmonella_phage	51.1	6.9e-71
WP_032439771.1|28387_29554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072196452.1|29596_30721_-	DNA primase	NA	J9Q720	Salmonella_phage	91.6	6.3e-203
WP_014342110.1|30868_32209_-	AAA family ATPase	NA	J9Q7G4	Salmonella_phage	95.7	7.0e-241
WP_014342111.1|32273_32999_-	hypothetical protein	NA	J9Q7R8	Salmonella_phage	88.4	1.3e-127
WP_032439768.1|33181_33592_-	hypothetical protein	NA	J9Q6F2	Salmonella_phage	38.6	9.2e-19
WP_174565794.1|33584_34352_-	hypothetical protein	NA	J9Q719	Salmonella_phage	42.9	6.6e-18
WP_014342115.1|34424_34781_-	hypothetical protein	NA	J9Q7G3	Salmonella_phage	97.9	1.4e-44
WP_014342116.1|34786_35452_-	AAA family ATPase	NA	J9Q7R7	Salmonella_phage	83.3	8.3e-102
WP_072199352.1|35691_36213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032439763.1|36415_36667_-	hypothetical protein	NA	J9Q7R6	Salmonella_phage	74.7	1.2e-24
WP_032439761.1|36669_37362_-	membrane protein	NA	J9Q7Y7	Salmonella_phage	89.1	1.2e-119
WP_004109805.1|37375_37699_-	hypothetical protein	NA	J9Q6E7	Salmonella_phage	95.3	2.3e-49
WP_032439760.1|37794_39240_-|tail	tail fiber domain-containing protein	tail	A0A0H4TGH1	Klebsiella_phage	37.1	1.3e-38
WP_019704527.1|51477_52089_-|tail	tail assembly protein	tail	J9Q7F8	Salmonella_phage	72.1	1.1e-76
WP_004109817.1|52076_52874_-	C40 family peptidase	NA	J9Q7R4	Salmonella_phage	85.3	5.4e-140
WP_071854284.1|52866_53565_-|tail	phage minor tail protein L	tail	J9Q7Y5	Salmonella_phage	87.0	1.2e-122
WP_032439754.1|53651_53987_-|tail	phage tail protein	tail	J9Q6E1	Salmonella_phage	83.6	5.7e-51
WP_048292502.1|54030_58566_-	tape measure protein	NA	J9Q712	Salmonella_phage	69.7	0.0e+00
WP_014342129.1|58573_58798_-	hypothetical protein	NA	J9Q7F7	Salmonella_phage	93.2	2.0e-31
WP_004109835.1|58923_59241_-	hypothetical protein	NA	J9Q7R3	Salmonella_phage	93.3	1.8e-46
WP_004109839.1|59302_60049_-	Ig domain-containing protein	NA	J9Q7Y4	Salmonella_phage	83.0	3.7e-106
WP_014342130.1|60116_60509_-	hypothetical protein	NA	J9Q6D8	Salmonella_phage	69.0	5.3e-48
WP_004109845.1|60510_60984_-	hypothetical protein	NA	J9Q711	Salmonella_phage	93.6	1.9e-76
WP_004109848.1|60974_61319_-	hypothetical protein	NA	J9Q7F6	Salmonella_phage	92.1	7.4e-54
WP_032439750.1|61416_62250_-	hypothetical protein	NA	J9Q7R2	Salmonella_phage	84.1	2.2e-131
WP_021313129.1|62249_62684_-	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	84.0	2.9e-63
WP_014342134.1|62731_63160_-	Ig domain-containing protein	NA	J9Q6D6	Salmonella_phage	71.6	7.9e-29
WP_004109857.1|63238_64117_-	hypothetical protein	NA	J9Q710	Salmonella_phage	94.2	4.7e-153
WP_014342135.1|64143_65043_-	hypothetical protein	NA	J9Q7F4	Salmonella_phage	82.6	1.0e-123
WP_048292499.1|65065_66640_-|portal	phage portal protein	portal	J9Q7R1	Salmonella_phage	88.2	2.8e-273
WP_004109863.1|66672_67929_-|terminase	terminase	terminase	J9Q7Y2	Salmonella_phage	97.4	9.4e-248
WP_004109866.1|67931_68573_-	DNA-binding protein	NA	J9Q6D4	Salmonella_phage	88.2	5.0e-96
WP_004109869.1|68748_69015_-	hypothetical protein	NA	J9Q757	Salmonella_phage	90.9	1.3e-37
WP_004109872.1|69024_69915_-	hypothetical protein	NA	J9Q7I6	Salmonella_phage	97.0	5.4e-165
WP_019704585.1|69920_70175_-	hypothetical protein	NA	J9Q7U0	Salmonella_phage	96.4	2.0e-40
WP_019704584.1|70167_70806_-	ATP-binding cassette domain-containing protein	NA	J9Q807	Salmonella_phage	97.6	1.4e-109
WP_014342142.1|70802_71471_-	ParB N-terminal domain-containing protein	NA	J9Q6L1	Salmonella_phage	91.4	1.9e-106
WP_050484892.1|71470_72175_-	ParB N-terminal domain-containing protein	NA	J9Q756	Salmonella_phage	89.3	2.8e-108
WP_071854285.1|72234_73794_+	DEAD/DEAH box helicase	NA	J9Q7I4	Salmonella_phage	92.5	4.4e-279
WP_014342145.1|73796_74072_+	hypothetical protein	NA	J9Q7T9	Salmonella_phage	68.1	4.0e-26
WP_019704582.1|74122_74560_-	hypothetical protein	NA	A0A1V0E7W1	Vibrio_phage	36.4	9.5e-14
WP_014342147.1|74715_75246_+	transcriptional regulator	NA	J9Q6L0	Salmonella_phage	84.5	3.5e-71
WP_148722482.1|75255_75555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004109892.1|75879_76530_+	hypothetical protein	NA	J9Q754	Salmonella_phage	91.7	8.4e-107
WP_004109904.1|76580_76784_+	hypothetical protein	NA	J9Q7I3	Salmonella_phage	95.5	4.1e-28
WP_021313140.1|77375_77858_-	hypothetical protein	NA	J9Q805	Salmonella_phage	70.6	1.3e-64
WP_032439735.1|78083_78272_+	hypothetical protein	NA	E5FFJ6	Burkholderia_phage	61.1	1.1e-11
WP_032439733.1|78299_78581_-	ABC transporter	NA	J9Q753	Salmonella_phage	83.9	5.3e-42
WP_032439731.1|78707_79115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072199357.1|79234_79534_-	hypothetical protein	NA	J9Q7T7	Salmonella_phage	68.7	5.0e-30
WP_023279445.1|79682_79895_-	hypothetical protein	NA	J9Q804	Salmonella_phage	77.9	4.4e-25
WP_019704577.1|79907_80126_-	hypothetical protein	NA	J9Q6K7	Salmonella_phage	81.9	2.9e-27
WP_019704576.1|81676_82903_-	hypothetical protein	NA	J9Q803	Salmonella_phage	54.2	1.6e-119
WP_019704575.1|83073_83391_-	hypothetical protein	NA	J9Q750	Salmonella_phage	74.3	9.2e-43
WP_019704574.1|84005_84752_+	NYN domain-containing protein	NA	NA	NA	NA	NA
WP_071786700.1|84896_85325_-	GFA family protein	NA	NA	NA	NA	NA
WP_019704573.1|85598_85958_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019704572.1|86204_86468_-	hypothetical protein	NA	J9Q7T5	Salmonella_phage	70.5	1.7e-29
WP_019704571.1|86619_87321_-	hypothetical protein	NA	J9Q6K2	Salmonella_phage	69.7	3.0e-78
WP_071854286.1|87409_89095_-	DUF4942 domain-containing protein	NA	J9Q747	Salmonella_phage	91.1	0.0e+00
WP_019704569.1|89223_89802_-	hypothetical protein	NA	J9Q7H6	Salmonella_phage	57.0	3.9e-55
WP_019704568.1|89929_90085_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	61.2	1.3e-05
WP_019704567.1|90084_90510_-	tellurite/colicin resistance protein	NA	Q71TK7	Escherichia_phage	80.9	9.8e-56
WP_023343110.1|90810_91350_-	hypothetical protein	NA	J9Q6J9	Salmonella_phage	46.0	6.4e-28
WP_019704565.1|91507_92095_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	80.2	3.4e-91
WP_019704564.1|92667_92901_-	hypothetical protein	NA	J9Q7H5	Salmonella_phage	84.2	2.7e-31
WP_071854287.1|93098_93692_-	phage N-6-adenine-methyltransferase	NA	J9Q7T2	Salmonella_phage	83.8	1.2e-96
WP_019704562.1|93876_94710_-	hypothetical protein	NA	J9Q7Z9	Salmonella_phage	53.1	1.2e-62
WP_014342174.1|94835_95393_-	3'-5' exonuclease	NA	J9Q6J8	Salmonella_phage	84.2	1.4e-86
WP_023279504.1|95402_95822_-	hypothetical protein	NA	J9Q743	Salmonella_phage	74.1	6.5e-52
WP_014342176.1|95885_96530_-	AAA family ATPase	NA	J9Q7H4	Salmonella_phage	76.6	6.8e-93
WP_019704561.1|96529_97006_-	dihydrofolate reductase	NA	J9Q7T1	Salmonella_phage	79.0	1.9e-71
WP_162899470.1|97002_97398_-	hypothetical protein	NA	J9Q7Z8	Salmonella_phage	74.8	2.6e-50
WP_014342179.1|97417_98521_-	thymidylate synthase	NA	J9Q6J6	Salmonella_phage	79.8	2.5e-180
WP_014342180.1|98714_99590_-	nucleoside triphosphate pyrophosphohydrolase family protein	NA	J9Q742	Salmonella_phage	84.7	4.5e-140
98536:98554	attR	ATAAGTAAGTACATACCTA	NA	NA	NA	NA
WP_014342181.1|99667_100810_-	ribonucleotide-diphosphate reductase subunit beta	NA	J9Q7H3	Salmonella_phage	95.8	9.0e-213
WP_071854289.1|100940_103244_-	ribonucleoside-diphosphate reductase subunit alpha	NA	J9Q7T0	Salmonella_phage	90.8	0.0e+00
WP_014342183.1|103319_103889_-	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	90.5	3.8e-95
WP_014342184.1|103898_104609_-	hypothetical protein	NA	J9Q6J5	Salmonella_phage	57.6	2.8e-71
WP_019704556.1|104634_106551_-	AAA family ATPase	NA	J9Q741	Salmonella_phage	84.8	3.3e-300
WP_014342187.1|106547_106781_-	hypothetical protein	NA	J9Q7H1	Salmonella_phage	66.1	3.4e-18
WP_014342188.1|106780_107866_-	metallophosphoesterase	NA	J9Q7S9	Salmonella_phage	84.2	2.0e-182
WP_019704555.1|108518_110078_+	DUF4041 domain-containing protein	NA	X5JAC1	Clostridium_phage	52.3	6.6e-57
WP_014342193.1|110391_111036_-	hypothetical protein	NA	J9Q739	Salmonella_phage	80.7	8.3e-99
>prophage 1
NZ_CP012571	Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-5.X, complete sequence	126863	0	12798	126863		Escherichia_phage(37.5%)	15	NA	NA
WP_011977818.1|1720_2926_+	AAA family ATPase	NA	A0A077SL49	Escherichia_phage	69.3	5.3e-163
WP_011977819.1|2925_3900_+	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	53.8	1.4e-86
WP_011977820.1|3981_5253_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.3	1.1e-150
WP_001568036.1|5252_5684_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.3	2.1e-29
WP_011977821.1|5917_6889_+	mediator of plasmid stability	NA	A0A222YXF2	Escherichia_phage	46.8	8.2e-74
WP_032435767.1|6891_7563_+	plasmid partitioning/stability family protein	NA	NA	NA	NA	NA
WP_001568040.1|7625_7856_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011977792.1|8292_8994_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.7	2.4e-27
WP_001568042.1|8993_9215_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001568043.1|9224_9644_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_013214013.1|9697_10465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023279469.1|11144_11573_+	antirestriction protein	NA	NA	NA	NA	NA
WP_011977778.1|11615_12122_+	antirestriction protein ArdA	NA	G9FHQ1	Rhodococcus_virus	31.4	1.2e-07
WP_001568047.1|12164_12356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011977779.1|12543_12798_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	48.8	4.0e-12
>prophage 2
NZ_CP012571	Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-5.X, complete sequence	126863	15937	26442	126863	transposase	Escherichia_phage(28.57%)	14	NA	NA
WP_004152756.1|15937_16501_+	methyltransferase	NA	M4M9L8	Vibrio_phage	42.0	1.7e-18
WP_023280871.1|17331_17874_+	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	76.7	4.6e-50
WP_001568055.1|17922_18171_+	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_071854292.1|18240_20298_+	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	25.2	3.4e-21
WP_001568057.1|20342_20774_+	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_015065516.1|20770_21499_+	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_001568059.1|21495_21822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020806188.1|22187_23168_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	2.3e-185
WP_019706020.1|23260_23473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014343499.1|23483_23708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152720.1|23788_24109_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	39.5	6.8e-09
WP_004152721.1|24098_24377_+	helix-turn-helix transcriptional regulator	NA	O64356	Escherichia_phage	39.4	2.5e-07
WP_023287139.1|24377_24791_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004152492.1|25620_26442_+	DUF945 domain-containing protein	NA	K4F5L3	Cronobacter_phage	40.1	1.2e-44
>prophage 3
NZ_CP012571	Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-5.X, complete sequence	126863	55479	64993	126863		Virus_Rctr197k(25.0%)	8	NA	NA
WP_015065542.1|55479_60738_+	conjugative transfer relaxase/helicase TraI	NA	A0A1P8DII4	Virus_Rctr197k	33.8	8.0e-06
WP_015065543.1|60817_61543_+	type-F conjugative transfer system pilin acetylase TraX	NA	A0A1D6ZIU7	Xanthomonas_phage	28.3	1.2e-05
WP_015065544.1|61698_62292_+	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_071854295.1|62411_62633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015065546.1|62682_63327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022631529.1|63382_64033_+	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_015065549.1|64029_64338_+	hypothetical protein	NA	K7PKY8	Enterobacterial_phage	40.4	1.7e-17
WP_023157996.1|64513_64993_+	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	31.7	1.2e-17
>prophage 4
NZ_CP012571	Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-5.X, complete sequence	126863	71197	94286	126863	transposase,integrase	Escherichia_phage(33.33%)	20	71135:71194	90847:91666
71135:71194	attL	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTG	NA	NA	NA	NA
WP_001067855.1|71197_71902_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001247892.1|74590_74881_+	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_001293886.1|74877_75279_+	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_000215515.1|75268_75625_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000091613.1|75879_76194_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000509966.1|77896_78502_-	recombinase family protein	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	5.5e-20
WP_015632391.1|79883_82877_-|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	46.6	1.3e-258
WP_022631505.1|82880_83291_-	putative toxin-antitoxin system toxin component, PIN family	NA	NA	NA	NA	NA
WP_023356273.1|83290_83530_-	ribbon-helix-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001389365.1|83872_84637_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_000376623.1|85143_85644_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000259031.1|85771_86611_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000679427.1|86604_86952_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000777554.1|87655_88129_-	trimethoprim-resistant dihydrofolate reductase DfrA1	NA	G3MBI7	Bacillus_virus	32.1	3.7e-19
WP_001749986.1|88263_88716_-	NAD(+)--rifampin ADP-ribosyltransferase Arr-3	NA	NA	NA	NA	NA
WP_000845048.1|88888_89902_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001067855.1|90138_90843_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000427623.1|91397_92402_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
90847:91666	attR	CAGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCAGCTGGGACGCATCGAGCGCACACTGTTCATCCTGGACTGGCTGCAAAGCGTCGAGCTGCGCCGCCGCGTGCATGCCGGGCTGAACAAAGGCGAGGCGCGCAACGCGCTGGCCCGCGCCGTGTTCTTCAACCGCCTGGGGGAAATCCGCGACCGCAGCTTCGAGCAGCAGCGCTACCGGGCCAGCGGCCTCAACCTGGTGACGGCGGCCATCGTGCTATGGAACACGGTCTATCTGGAGCGGGCCGCGAACGCCTTGCGTGGCCACGGTCAAGCCGTCGATGACGGCCTGTTGCAGTACCTGTCGCCGCTCGGCTGGGAGCACATCAACCTGACCGGCGATTACCTCTGGCGCAGCAGCGCCAAGATCGGCGCGGGCAAGTTCAGGCCGCTACGGCCGCTGCAACCGGCTTAGCGTGCTTTATTTAATGAGATGGTCACTCCCTCCTTCCCGGTATTATGCTGAGGACAGGCTTTCATTCGGAGAACTATCATGGAAAACATTGCGCTCATTGGTATCGATCTGGGTAAAAACTCTTTCCATATTCATTGCCAGGATCGTCGCGGGAAGGCTGTTTACCGTAAAAAATTTACCCGGCCAAAGTTGATCGAATTTTTGGCGACATGCCCCGCTACAACCATCGCAATGGAAGCCTGTGGCGGTTCTCACTTTATGGCACGCAAGTTGGAAGAGTTGGGGCATTCCCCAAAGCTGATATCACCACAATTTGTCCGCCCGTTCGTTAAAAGCAATAAAAACGA	NA	NA	NA	NA
WP_022631502.1|92816_93017_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004099053.1|93317_94286_-|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.8	5.1e-185
>prophage 5
NZ_CP012571	Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-5.X, complete sequence	126863	110582	115475	126863	transposase	Escherichia_phage(40.0%)	5	NA	NA
WP_032441952.1|110582_111605_+|transposase	IS21-like element ISSen3 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	85.6	8.7e-175
WP_001531258.1|111601_112384_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	96.5	6.1e-136
WP_015632382.1|113064_113505_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	60.3	2.6e-19
WP_004189161.1|113501_113852_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	63.8	5.2e-39
WP_014839879.1|113882_115475_+|transposase	IS66-like element ISKox1 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.6	1.2e-175
>prophage 6
NZ_CP012571	Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-5.X, complete sequence	126863	124735	125515	126863	integrase	Macacine_betaherpesvirus(100.0%)	1	NA	NA
WP_013214009.1|124735_125515_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.0	5.4e-52
>prophage 1
NZ_CP012572	Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-6.X, complete sequence	163420	0	10150	163420		Macacine_betaherpesvirus(40.0%)	7	NA	NA
WP_000523813.1|1610_2777_+	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	97.7	1.4e-224
WP_004152062.1|2776_3748_+	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	86.6	4.1e-150
WP_014386156.1|6571_7843_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	64.0	2.5e-155
WP_004182047.1|7842_8268_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	50.4	2.9e-31
WP_004118481.1|8482_8713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004118478.1|9233_9659_+	antirestriction protein	NA	NA	NA	NA	NA
WP_004152754.1|9895_10150_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	50.0	1.2e-11
>prophage 2
NZ_CP012572	Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-6.X, complete sequence	163420	13289	17650	163420		Vibrio_phage(33.33%)	4	NA	NA
WP_004152756.1|13289_13853_+	methyltransferase	NA	M4M9L8	Vibrio_phage	42.0	1.7e-18
WP_071854301.1|14683_15226_+	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	76.7	3.5e-50
WP_014386159.1|15274_15523_+	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_014386160.1|15592_17650_+	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	25.4	9.1e-22
>prophage 3
NZ_CP012572	Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-6.X, complete sequence	163420	21157	22126	163420	transposase	Salmonella_phage(100.0%)	1	NA	NA
WP_074422984.1|21157_22126_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.8	2.5e-184
>prophage 4
NZ_CP012572	Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-6.X, complete sequence	163420	25868	27017	163420		Mycoplasma_phage(100.0%)	1	NA	NA
WP_014386168.1|25868_27017_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	45.0	1.4e-24
>prophage 5
NZ_CP012572	Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-6.X, complete sequence	163420	42943	43731	163420		Enterobacteria_phage(50.0%)	2	NA	NA
WP_014386179.1|42943_43384_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	62.8	4.0e-20
WP_014386180.1|43380_43731_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	63.8	6.9e-39
>prophage 6
NZ_CP012572	Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-6.X, complete sequence	163420	50433	51022	163420		Shigella_phage(50.0%)	2	NA	NA
WP_014386190.1|50433_50754_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	39.5	3.0e-09
WP_004152721.1|50743_51022_+	helix-turn-helix transcriptional regulator	NA	O64356	Escherichia_phage	39.4	2.5e-07
>prophage 7
NZ_CP012572	Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-6.X, complete sequence	163420	82129	91533	163420		Virus_Rctr197k(33.33%)	4	NA	NA
WP_071854302.1|82129_87388_+	conjugative transfer relaxase/helicase TraI	NA	A0A1P8DII4	Virus_Rctr197k	33.3	5.2e-05
WP_014386207.1|87432_88158_+	type-F conjugative transfer system pilin acetylase TraX	NA	A0A1D6ZIU7	Xanthomonas_phage	27.9	3.5e-05
WP_004152380.1|88229_88823_+	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_014386209.1|90009_91533_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	38.7	7.0e-88
>prophage 8
NZ_CP012572	Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-6.X, complete sequence	163420	95305	98590	163420		Liberibacter_phage(100.0%)	1	NA	NA
WP_040182250.1|95305_98590_+	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	27.4	3.3e-66
>prophage 9
NZ_CP012572	Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-6.X, complete sequence	163420	104992	162552	163420	transposase,integrase,holin,protease	uncultured_Caudovirales_phage(26.32%)	50	120852:120865	163279:163292
WP_064762441.1|104992_105472_+	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	33.1	5.4e-18
WP_004099069.1|105791_106070_+	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_014386216.1|106285_106363_+	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_004099067.1|106355_107213_+	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_000616807.1|108201_108855_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000557619.1|108947_109205_+	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_001398199.1|109137_109539_+	type II toxin-antitoxin system toxin endoribonuclease PemK	NA	NA	NA	NA	NA
WP_001553819.1|109675_112573_-|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	4.2e-182
WP_001067855.1|112842_113547_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_004152101.1|113788_114139_+	As(III)-sensing metalloregulatory transcriptional repressor ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	1.4e-23
WP_004152100.1|114188_114551_+	arsenite efflux transporter metallochaperone ArsD	NA	NA	NA	NA	NA
WP_004152099.1|114568_116320_+	arsenite efflux transporter ATPase subunit ArsA	NA	NA	NA	NA	NA
WP_004152098.1|116367_117657_+	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	74.0	1.9e-171
WP_004152097.1|117669_118095_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	72.9	2.3e-52
WP_004152096.1|118127_118664_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_004152095.1|120560_120923_-	arsenic metallochaperone ArsD family protein	NA	NA	NA	NA	NA
120852:120865	attL	GGCTTCATCGCTGA	NA	NA	NA	NA
WP_004182005.1|120998_121544_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_004152093.1|121552_122266_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	77.0	2.9e-92
WP_004152092.1|122262_122589_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004152091.1|122920_123418_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_031944101.1|123467_123977_-	aquaporin	NA	NA	NA	NA	NA
WP_004152086.1|125719_125899_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_004152085.1|126130_126565_-	copper resistance system metallochaperone PcoE	NA	NA	NA	NA	NA
WP_004152084.1|126781_128182_-	copper resistance membrane spanning protein PcoS	NA	W8CYF6	Bacillus_phage	26.3	4.1e-18
WP_001188930.1|128178_128859_-	copper response regulator transcription factor PcoR	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
WP_004118344.1|128913_129843_-	copper resistance inner membrane protein PcoD	NA	NA	NA	NA	NA
WP_000025662.1|129847_130228_-	copper resistance system metallochaperone PcoC	NA	NA	NA	NA	NA
WP_185157552.1|130267_131158_-	copper resistance outer membrane transporter PcoB	NA	NA	NA	NA	NA
WP_000925242.1|131163_132981_-	multicopper oxidase PcoA	NA	NA	NA	NA	NA
WP_001023257.1|133214_133664_+	copper resistance protein	NA	NA	NA	NA	NA
WP_004118669.1|133952_134690_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A2H4JAF5	uncultured_Caudovirales_phage	32.5	1.2e-11
WP_000843497.1|134723_134921_-	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_004098955.1|134961_137409_-	Ag(+)-translocating P-type ATPase SilP	NA	A0A218MNH6	uncultured_virus	35.8	7.6e-84
WP_000758228.1|137535_137976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004098958.1|138062_141209_-	Cu(+)/Ag(+) efflux RND transporter permease subunit SilA	NA	S5VTK5	Leptospira_phage	22.5	4.0e-61
WP_004152079.1|141219_142512_-	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit SilB	NA	NA	NA	NA	NA
WP_001246153.1|142625_142979_-	cation efflux system protein CusF	NA	NA	NA	NA	NA
WP_000475512.1|143007_144393_-	Cu(+)/Ag(+) efflux RND transporter outer membrane channel SilC	NA	NA	NA	NA	NA
WP_001572351.1|144582_145263_+	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	35.6	2.1e-31
WP_003032875.1|145255_146731_+	copper/silver sensor histidine kinase SilS	NA	W8CYF6	Bacillus_phage	30.1	1.0e-27
WP_004178091.1|146981_147413_+	silver-binding protein SilE	NA	NA	NA	NA	NA
WP_085955172.1|148841_150048_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	63.2	1.7e-100
WP_004178088.1|151088_153086_+|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	25.9	9.7e-21
WP_004152070.1|153148_154426_+	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_080895248.1|155408_156845_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004197688.1|157464_157722_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011977741.1|158394_159363_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.1	2.5e-184
WP_071527918.1|159382_159694_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004152065.1|159720_160668_-	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	30.6	1.8e-12
WP_001515717.1|161811_162552_+|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	58.6	5.4e-25
163279:163292	attR	GGCTTCATCGCTGA	NA	NA	NA	NA
