The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP012561	Klebsiella pneumoniae strain UCLAOXA232KP chromosome, complete genome	5312206	2282332	2338480	5312206	portal,integrase,head,tail,capsid,protease,holin,terminase,tRNA	Klebsiella_phage(54.35%)	72	2305332:2305355	2344786:2344809
WP_004145598.1|2282332_2283751_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_002913435.1|2283802_2284195_-	putative DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_002913434.1|2284198_2284552_-	putative DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_023301631.1|2285173_2287345_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_002913423.1|2287393_2288596_-	nucleoside permease NupC	NA	NA	NA	NA	NA
WP_002913421.1|2288942_2290184_+	Nramp family divalent metal transporter	NA	NA	NA	NA	NA
WP_004899719.1|2290241_2290595_-	DUF2502 domain-containing protein	NA	NA	NA	NA	NA
WP_023301632.1|2290725_2291718_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_023301633.1|2291898_2293560_+	indolepyruvate decarboxylase	NA	NA	NA	NA	NA
WP_004180794.1|2293556_2294792_-	ion channel protein	NA	NA	NA	NA	NA
WP_002913377.1|2295055_2296021_+	glucokinase	NA	NA	NA	NA	NA
WP_002913374.1|2296074_2296812_-	response regulator transcription factor	NA	A0A2R2ZGH8	Clostridioides_phage	26.3	1.5e-14
WP_004149230.1|2296823_2298521_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	28.5	6.7e-47
WP_004153200.1|2298519_2298633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032409803.1|2298629_2298815_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002913372.1|2298903_2300118_+	alanine transaminase	NA	NA	NA	NA	NA
WP_099119320.1|2300188_2300260_-	membrane protein YpdK	NA	NA	NA	NA	NA
WP_004185022.1|2300598_2301795_-	cyanate transporter	NA	NA	NA	NA	NA
WP_023301635.1|2301791_2302250_-	nucleoside deaminase	NA	A0A0B5J096	Pandoravirus	33.1	7.2e-12
WP_004149227.1|2302382_2303291_+	transcriptional regulator CynR	NA	A0A2P0ZL89	Lactobacillus_phage	24.2	4.6e-10
WP_023301636.1|2303300_2304182_-	hypothetical protein	NA	A0A2H4JEC4	uncultured_Caudovirales_phage	56.8	1.5e-05
WP_004174945.1|2304548_2305031_-	WbuC family cupin fold metalloprotein	NA	NA	NA	NA	NA
2305332:2305355	attL	TATATCCATTTAACTAAGGGGACA	NA	NA	NA	NA
WP_064184927.1|2305549_2306719_+|integrase	site-specific integrase	integrase	A0A2R2Z2Y0	Escherichia_phage	85.5	1.1e-200
WP_064184926.1|2306751_2307690_+	DUF2971 domain-containing protein	NA	J9Q7Y9	Salmonella_phage	31.7	5.8e-08
WP_077255880.1|2307705_2307891_-	hypothetical protein	NA	G3CFG7	Escherichia_phage	61.4	2.4e-14
WP_064184925.1|2307898_2308507_-	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	82.4	4.8e-48
WP_004141386.1|2308503_2308716_-	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	45.5	8.1e-11
WP_064184924.1|2308715_2309456_-	hypothetical protein	NA	R9TPK2	Aeromonas_phage	97.3	2.5e-30
WP_048270910.1|2309733_2310144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064184923.1|2310271_2311057_-	hypothetical protein	NA	C7BGF1	Burkholderia_phage	53.3	8.1e-64
WP_040149782.1|2311056_2311356_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019705289.1|2311744_2312389_-	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	40.7	8.2e-38
WP_024176406.1|2312483_2312693_+	cell division protein	NA	NA	NA	NA	NA
WP_004213338.1|2312718_2313180_+	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	88.2	1.7e-69
WP_001208720.1|2313417_2313597_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	73.1	4.6e-15
WP_069377391.1|2313586_2314555_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	66.0	1.6e-85
WP_049006283.1|2314551_2315361_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	69.3	3.5e-110
WP_000779146.1|2315370_2315748_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	73.6	2.3e-48
WP_071854253.1|2315760_2316741_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	66.9	1.1e-134
WP_064184919.1|2316754_2317333_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	55.6	1.9e-49
WP_064184918.1|2317484_2317724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024176410.1|2317893_2318193_+|holin	phage holin family protein	holin	A0A286N2Q5	Klebsiella_phage	83.8	4.5e-39
WP_064184917.1|2318189_2318729_+	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	96.6	3.1e-99
WP_064184916.1|2318725_2319073_+	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	78.3	5.7e-38
WP_064184915.1|2319069_2319345_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	65.2	2.1e-22
WP_052454910.1|2319295_2319493_+	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	84.5	7.3e-22
WP_106493672.1|2319648_2320071_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064184914.1|2320067_2321360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004216876.1|2321436_2321682_+	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	96.3	3.0e-33
WP_042950192.1|2321748_2321970_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042950190.1|2322026_2322317_+	HNH endonuclease	NA	A0A286N2R3	Klebsiella_phage	94.8	1.7e-51
WP_004216880.1|2322329_2322539_+	hypothetical protein	NA	A0A286N2R4	Klebsiella_phage	87.0	2.6e-25
WP_064184913.1|2322660_2323095_+	hypothetical protein	NA	A0A286S1P9	Klebsiella_phage	99.3	2.4e-73
WP_004143904.1|2323104_2324637_+|terminase	terminase	terminase	A0A286S1M9	Klebsiella_phage	100.0	3.9e-296
WP_017880221.1|2324639_2325917_+|portal	phage portal protein	portal	A0A286S1N5	Klebsiella_phage	100.0	6.2e-247
WP_077269009.1|2325922_2326603_+|head,protease	HK97 family phage prohead protease	head,protease	A0A286S1N1	Klebsiella_phage	99.6	6.0e-124
WP_064184946.1|2326614_2327778_+|capsid	phage major capsid protein	capsid	A0A286S1R4	Klebsiella_phage	99.7	7.7e-212
WP_133060710.1|2327814_2328057_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017880223.1|2328004_2328331_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A286S294	Klebsiella_phage	100.0	7.5e-56
WP_004143899.1|2328391_2328589_+	hypothetical protein	NA	A0A286S2A5	Klebsiella_phage	100.0	1.7e-26
WP_064184945.1|2328590_2328923_+|head	phage head closure protein	head	A0A286S2A2	Klebsiella_phage	99.1	1.5e-56
WP_064184944.1|2328915_2329455_+	HK97 gp10 family phage protein	NA	A0A286S249	Klebsiella_phage	99.4	2.3e-94
WP_000561415.1|2329451_2329817_+	DUF3168 domain-containing protein	NA	A0A286S1R1	Klebsiella_phage	92.6	3.9e-61
WP_000115125.1|2329873_2330365_+	hypothetical protein	NA	A0A286S1Q8	Klebsiella_phage	100.0	2.3e-88
WP_004899623.1|2330408_2330792_+|tail	phage tail assembly chaperone family protein, TAC	tail	A0A286S1N4	Klebsiella_phage	86.3	1.4e-53
WP_004104224.1|2330794_2331058_+	hypothetical protein	NA	A0A286S1P2	Klebsiella_phage	91.9	3.0e-39
WP_133060711.1|2331116_2331494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064184943.1|2331542_2334077_+|tail	phage tail tape measure protein	tail	A0A286S1S3	Klebsiella_phage	74.4	0.0e+00
WP_004899614.1|2334076_2334556_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	98.7	1.7e-93
WP_064184942.1|2334542_2335025_+	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	98.8	3.9e-85
WP_064184941.1|2335034_2335415_+	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	96.0	1.8e-69
WP_065802474.1|2335411_2338480_+	kinase	NA	A0A286S259	Klebsiella_phage	97.7	0.0e+00
2344786:2344809	attR	TATATCCATTTAACTAAGGGGACA	NA	NA	NA	NA
>prophage 2
NZ_CP012561	Klebsiella pneumoniae strain UCLAOXA232KP chromosome, complete genome	5312206	2566435	2573340	5312206	tRNA	Planktothrix_phage(33.33%)	6	NA	NA
WP_004175147.1|2566435_2567299_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
WP_004180550.1|2567309_2568083_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	3.9e-26
WP_004151134.1|2568323_2569220_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_004144192.1|2569462_2570824_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.8	1.8e-207
WP_004175198.1|2571142_2571865_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
WP_004149058.1|2571861_2573340_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	8.5e-30
>prophage 3
NZ_CP012561	Klebsiella pneumoniae strain UCLAOXA232KP chromosome, complete genome	5312206	2907356	2964189	5312206	integrase,head,tail,plate,lysis,terminase	Salmonella_phage(32.76%)	82	2905527:2905544	2954833:2954850
2905527:2905544	attL	GGCGCCGACCTGCTGGCG	NA	NA	NA	NA
WP_004175494.1|2907356_2908652_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	36.8	9.6e-62
WP_074183181.1|2908663_2909473_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_040181674.1|2911017_2911263_-	excisionase family protein	NA	A0A286S2A4	Klebsiella_phage	92.1	1.9e-35
WP_009483816.1|2911266_2911485_-	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	52.2	2.6e-12
WP_032431536.1|2911481_2911691_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040218332.1|2911687_2911879_-	DUF1382 family protein	NA	G9L698	Escherichia_phage	64.4	1.3e-12
WP_065802489.1|2911875_2912640_-	hypothetical protein	NA	Q71T76	Escherichia_phage	58.3	3.0e-71
WP_040181679.1|2912856_2913627_-	hypothetical protein	NA	D5LH17	Escherichia_phage	51.0	3.2e-65
WP_024264482.1|2913623_2914151_-	phage N-6-adenine-methyltransferase	NA	Q9ZWX6	Enterobacteria_phage	62.2	1.3e-57
WP_016529279.1|2914147_2914306_-	DUF1317 family protein	NA	A0A0N7CHV0	Escherichia_phage	58.8	6.7e-10
WP_040181683.1|2914302_2914989_-	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	90.6	4.8e-113
WP_124072215.1|2914981_2915431_-	hypothetical protein	NA	A0A221SAP1	Ralstonia_phage	52.6	1.0e-18
WP_040181685.1|2915598_2916444_-	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	58.8	2.6e-68
WP_040181687.1|2916459_2916744_-	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	78.7	4.3e-39
WP_008807814.1|2916824_2917031_-	phage encoded cell division inhibitor protein	NA	A0A0M4S6W3	Salmonella_phage	94.1	1.4e-31
WP_004219883.1|2917023_2917149_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021312733.1|2917527_2918187_-	helix-turn-helix domain-containing protein	NA	K7P7K3	Enterobacteria_phage	61.5	1.9e-69
WP_004191589.1|2918295_2918514_+	helix-turn-helix transcriptional regulator	NA	A0A1P8DTF8	Proteus_phage	50.7	1.4e-13
WP_001548453.1|2918554_2918776_+	hypothetical protein	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
WP_065807611.1|2918861_2919716_+	replication protein	NA	K7PGT1	Enterobacteria_phage	54.8	2.8e-62
WP_065807612.1|2919700_2920573_+	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	69.4	3.8e-94
WP_012542626.1|2920569_2920863_+	protein ren	NA	O48423	Enterobacteria_phage	65.6	2.5e-26
WP_162899465.1|2920865_2921315_+	hypothetical protein	NA	R9TME7	Aeromonas_phage	31.7	7.5e-06
WP_065807614.1|2921311_2921548_+	hypothetical protein	NA	S4TVX5	Salmonella_phage	50.0	1.5e-13
WP_065807615.1|2921540_2922080_+	hypothetical protein	NA	A0A1V0E5L5	Salmonella_phage	37.6	9.3e-19
WP_009308003.1|2922079_2922256_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077269010.1|2922756_2923233_+	DUF551 domain-containing protein	NA	A0A077SK54	Escherichia_phage	35.4	3.0e-13
WP_004191566.1|2923639_2924236_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	54.3	1.2e-56
WP_071854273.1|2924241_2924409_+	NinE family protein	NA	NA	NA	NA	NA
WP_065807617.1|2924405_2925074_+	metallophosphoesterase	NA	K7P6H8	Enterobacteria_phage	76.0	4.1e-101
WP_065807618.1|2925066_2925675_+	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	65.7	2.3e-50
WP_065807619.1|2925671_2925902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004136182.1|2925898_2926039_+	YlcG family protein	NA	NA	NA	NA	NA
WP_065807620.1|2926035_2926725_+	antiterminator	NA	I6PDF8	Cronobacter_phage	54.9	1.1e-56
WP_012967717.1|2927499_2927814_+	hypothetical protein	NA	H6WRZ3	Salmonella_phage	86.1	8.3e-44
WP_040181191.1|2927816_2928320_+	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	78.4	5.0e-75
WP_040181192.1|2928316_2928784_+|lysis	lysis protein	lysis	Q76H63	Enterobacteria_phage	73.5	7.5e-57
WP_087749278.1|2928786_2928924_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074422973.1|2929280_2929769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040181195.1|2929719_2931120_+|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	69.2	7.2e-188
WP_039108763.1|2931357_2932809_+	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	68.4	7.2e-191
WP_025714257.1|2932864_2933413_+	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	56.9	1.0e-49
WP_025714258.1|2933458_2933653_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040181203.1|2933662_2934865_+	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	52.8	5.3e-107
WP_040181205.1|2934868_2935363_+	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	61.5	2.1e-49
WP_064162991.1|2935952_2937182_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1V0E8G8	Vibrio_phage	40.5	3.6e-74
WP_048265733.1|2937305_2937518_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_071854257.1|2938303_2938828_+	host cell division inhibitor Icd-like protein	NA	A0A2H4JGN8	uncultured_Caudovirales_phage	43.7	1.4e-14
WP_069377377.1|2938820_2939003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064162993.1|2938995_2939874_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_064162994.1|2939866_2940046_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064162995.1|2940042_2940306_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064162996.1|2940302_2940521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071854258.1|2940526_2940745_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_069377378.1|2940741_2943087_+	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	39.9	1.3e-146
WP_069377379.1|2944091_2944760_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069377380.1|2945260_2945776_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069377382.1|2946331_2946850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040181209.1|2947684_2947966_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065802501.1|2947934_2948354_+	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	60.7	4.4e-40
WP_064151821.1|2948350_2948965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065519890.1|2948964_2949351_+|head,tail	head-tail adaptor	head,tail	A0A2H4J1A4	uncultured_Caudovirales_phage	75.8	5.8e-47
WP_004152176.1|2949445_2949886_+	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	51.7	1.6e-40
WP_065802503.1|2949889_2951035_+	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	77.7	1.3e-166
WP_023312781.1|2951044_2951488_+	DUF3277 family protein	NA	A0A0M5M1K6	Salmonella_phage	80.0	2.1e-61
WP_065802505.1|2951491_2951911_+	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	66.7	3.0e-41
WP_065802507.1|2951952_2952105_+	NTP pyrophosphohydrolase	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	76.0	1.0e-15
WP_065802509.1|2952094_2954092_+	lytic transglycosylase domain-containing protein	NA	A0A0M4REK7	Salmonella_phage	61.7	7.5e-231
WP_065802512.1|2954091_2954667_+	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	71.2	1.7e-66
WP_074422975.1|2954742_2954970_+	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	49.3	1.3e-17
2954833:2954850	attR	GGCGCCGACCTGCTGGCG	NA	NA	NA	NA
WP_065807621.1|2954972_2956034_+	hypothetical protein	NA	A0A0M4QX01	Salmonella_phage	69.9	2.1e-139
WP_065807629.1|2956069_2956378_+	hypothetical protein	NA	A0A0M4RTY3	Salmonella_phage	90.9	2.4e-35
WP_050008892.1|2956389_2956746_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065807623.1|2956968_2957625_+	translation initiation factor IF-2	NA	A0A0M5M1K7	Salmonella_phage	64.8	1.7e-83
WP_048289810.1|2957621_2957975_+	bacteriophage protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	78.6	3.0e-50
WP_065807624.1|2957974_2959174_+|plate	baseplate J/gp47 family protein	plate	A0A0M4RD32	Salmonella_phage	75.3	5.8e-162
WP_040181232.1|2959170_2959944_+	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	51.0	1.8e-68
WP_069377383.1|2959943_2960717_+	hypothetical protein	NA	A0A248SL44	Klebsiella_phage	49.2	8.6e-26
WP_119183683.1|2960735_2962718_+	hypothetical protein	NA	A0A286S1P0	Klebsiella_phage	27.6	1.2e-26
WP_071854259.1|2962727_2963528_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064172271.1|2963632_2963872_+	hypothetical protein	NA	K7P7N3	Enterobacteria_phage	50.6	1.4e-14
WP_040181238.1|2963871_2964189_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	52.0	1.8e-22
>prophage 4
NZ_CP012561	Klebsiella pneumoniae strain UCLAOXA232KP chromosome, complete genome	5312206	3656682	3667570	5312206		Escherichia_phage(87.5%)	9	NA	NA
WP_040182019.1|3656682_3659790_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
WP_004176258.1|3659844_3661110_+	MFS transporter	NA	NA	NA	NA	NA
WP_040182017.1|3661140_3662229_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	99.7	8.8e-210
WP_004176262.1|3662315_3662576_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	98.8	5.4e-41
WP_001620095.1|3662873_3663734_+	class A broad-spectrum beta-lactamase SHV-1	NA	A0A077SL40	Escherichia_phage	99.7	4.4e-156
WP_002210513.1|3663754_3664516_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_002903955.1|3664777_3665680_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_032423485.1|3665691_3666957_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.3	6.6e-233
WP_002210516.1|3666949_3667570_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 5
NZ_CP012561	Klebsiella pneumoniae strain UCLAOXA232KP chromosome, complete genome	5312206	3842218	3931742	5312206	portal,integrase,head,tail,plate,capsid,protease,holin,terminase,tRNA	Klebsiella_phage(63.46%)	96	3913419:3913434	3936012:3936027
WP_002902422.1|3842218_3843154_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	93.0	3.5e-138
WP_004151591.1|3843199_3844573_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.3	8.6e-53
WP_004148192.1|3845098_3846082_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_023302015.1|3846361_3847105_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.1	1.0e-15
WP_023302016.1|3847067_3848186_+	oxidoreductase	NA	NA	NA	NA	NA
WP_004176404.1|3848422_3848617_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019705261.1|3848729_3849476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004892563.1|3850543_3851212_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002902393.1|3852225_3853032_-	methionine-binding protein	NA	NA	NA	NA	NA
WP_023285056.1|3853252_3854428_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_004179583.1|3854472_3855507_-	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_004179582.1|3855595_3856144_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_020324664.1|3857101_3857971_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_052455031.1|3858667_3858982_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004190483.1|3859001_3859907_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_021440014.1|3860050_3860980_+	aromatic alcohol reductase	NA	NA	NA	NA	NA
WP_004179576.1|3861005_3861212_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_004151595.1|3861262_3862141_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_004151596.1|3862299_3863055_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_021440012.1|3863059_3863653_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023302022.1|3863726_3864440_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_009309032.1|3864506_3865001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040181981.1|3865128_3865671_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_004176418.1|3865648_3866734_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_021440010.1|3866697_3868452_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004183804.1|3868530_3870123_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_021440009.1|3870119_3873569_-	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_021440008.1|3873558_3874740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040181978.1|3874688_3874946_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_040181976.1|3874988_3877388_-	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_023302028.1|3877375_3877906_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_021440005.1|3877930_3878707_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_024623002.1|3878710_3881080_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	33.0	2.4e-18
WP_023302030.1|3881081_3883736_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	33.4	7.7e-98
WP_002902160.1|3884000_3884492_-	type VI secretion system effector Hcp	NA	NA	NA	NA	NA
WP_021440002.1|3884496_3886203_-	OmpA family protein	NA	NA	NA	NA	NA
WP_004176431.1|3886199_3886889_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_004179544.1|3886885_3888229_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_023302033.1|3888238_3889783_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_004176434.1|3889825_3890317_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_019705237.1|3891162_3891411_+	DinI-like family protein	NA	S5MQI1	Escherichia_phage	70.4	1.0e-25
WP_040186352.1|3892512_3893313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048322138.1|3895362_3898431_-	kinase	NA	A0A286S259	Klebsiella_phage	97.2	0.0e+00
WP_004152651.1|3898427_3898808_-	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	99.2	1.8e-72
WP_040182606.1|3898817_3899300_-	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	98.8	6.0e-86
WP_004899614.1|3899286_3899766_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	98.7	1.7e-93
WP_040182604.1|3899765_3902213_-|tail	phage tail tape measure protein	tail	A0A286S1S3	Klebsiella_phage	66.5	5.9e-278
WP_004143894.1|3902257_3902725_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004143895.1|3902790_3903054_-	hypothetical protein	NA	A0A286S1P2	Klebsiella_phage	98.8	5.9e-43
WP_001177591.1|3903086_3903440_-|tail	phage tail assembly chaperone family protein, TAC	tail	A0A286S1N4	Klebsiella_phage	99.1	4.9e-61
WP_000115125.1|3903483_3903975_-	hypothetical protein	NA	A0A286S1Q8	Klebsiella_phage	100.0	2.3e-88
WP_000561415.1|3904030_3904396_-	DUF3168 domain-containing protein	NA	A0A286S1R1	Klebsiella_phage	92.6	3.9e-61
WP_004216814.1|3904392_3904932_-	HK97 gp10 family phage protein	NA	A0A286S249	Klebsiella_phage	99.4	3.0e-94
WP_040186341.1|3904924_3905257_-|head	phage head closure protein	head	A0A286S2A2	Klebsiella_phage	98.2	1.0e-55
WP_004899632.1|3905258_3905456_-	hypothetical protein	NA	A0A286S2A5	Klebsiella_phage	96.9	2.4e-25
WP_040186860.1|3905516_3905843_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A286S294	Klebsiella_phage	99.1	9.8e-56
WP_044067369.1|3905790_3906033_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040186862.1|3906069_3907233_-|capsid	phage major capsid protein	capsid	A0A286S1R4	Klebsiella_phage	99.2	3.8e-211
WP_077255528.1|3907244_3907925_-|head,protease	HK97 family phage prohead protease	head,protease	A0A286S1N1	Klebsiella_phage	99.6	2.7e-124
WP_017880221.1|3907930_3909208_-|portal	phage portal protein	portal	A0A286S1N5	Klebsiella_phage	100.0	6.2e-247
WP_004143904.1|3909210_3910743_-|terminase	terminase	terminase	A0A286S1M9	Klebsiella_phage	100.0	3.9e-296
WP_004143905.1|3910752_3911187_-	hypothetical protein	NA	A0A286S1P9	Klebsiella_phage	100.0	6.2e-74
WP_040182582.1|3911308_3911518_-	hypothetical protein	NA	A0A286N2R4	Klebsiella_phage	84.1	2.4e-23
WP_040182580.1|3911530_3911821_-	HNH endonuclease	NA	A0A286N2R3	Klebsiella_phage	94.8	2.9e-51
WP_071854263.1|3911891_3912098_-	DUF551 domain-containing protein	NA	A0A286N2R2	Klebsiella_phage	97.1	1.1e-33
WP_032408647.1|3912178_3912415_-	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	94.9	1.6e-31
WP_023304730.1|3912739_3913012_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031591489.1|3913144_3913429_+	hypothetical protein	NA	NA	NA	NA	NA
3913419:3913434	attL	ACCTGCAATAGCTCTC	NA	NA	NA	NA
WP_040182576.1|3913664_3913940_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	41.6	9.9e-09
WP_023304728.1|3913947_3914577_-	glycoside hydrolase family 19 protein	NA	G8C7W0	Escherichia_phage	90.9	6.9e-106
WP_019705280.1|3914576_3914858_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	80.6	3.9e-37
WP_017145563.1|3914844_3915240_-|holin	phage holin family protein	holin	K7PHB9	Enterobacterial_phage	98.5	2.6e-63
WP_031280381.1|3915802_3916249_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004184721.1|3916154_3916412_-	hypothetical protein	NA	A0A286N2Q3	Klebsiella_phage	100.0	1.3e-42
WP_040182574.1|3916565_3917348_-	antitermination protein	NA	F1C595	Cronobacter_phage	79.1	6.5e-114
WP_071854264.1|3917344_3918307_-	toprim domain-containing protein	NA	A0A286N2Q0	Klebsiella_phage	98.8	3.1e-182
WP_048322137.1|3918308_3919967_-	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	97.5	0.0e+00
WP_040182571.1|3920008_3920377_-	hypothetical protein	NA	A0A286S263	Klebsiella_phage	82.8	6.7e-53
WP_071854265.1|3921047_3921281_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPK9	Escherichia_phage	63.9	4.9e-17
WP_029602970.1|3921436_3922096_+	LexA family transcriptional regulator	NA	A0A1B5FPF4	Escherichia_phage	79.5	9.4e-98
WP_040182568.1|3922259_3922673_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004177202.1|3922855_3923080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023304721.1|3923080_3923446_+	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	97.5	5.8e-57
WP_040186816.1|3923438_3923693_+	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	89.3	1.4e-36
WP_004177208.1|3923664_3923883_+	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	98.6	6.6e-32
WP_040186814.1|3923879_3924320_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	80.8	7.5e-59
WP_040186812.1|3924360_3924879_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	97.7	9.4e-93
WP_032415174.1|3924884_3925610_+	Rha family transcriptional regulator	NA	A0A286S260	Klebsiella_phage	99.6	1.4e-131
WP_040186810.1|3925599_3925824_+	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	94.6	1.7e-30
WP_103219593.1|3925820_3926705_+	hypothetical protein	NA	A0A2H4FNA9	Salmonella_phage	70.6	5.1e-06
WP_004198245.1|3926777_3926924_+	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	70.8	2.9e-15
WP_077255525.1|3926883_3927126_+	AlpA family transcriptional regulator	NA	A0A0M4RTZ2	Salmonella_phage	73.8	2.2e-20
WP_040186739.1|3927106_3928288_-|integrase	site-specific integrase	integrase	A0A0M4QX09	Salmonella_phage	84.2	1.3e-201
WP_016197745.1|3928484_3929033_+	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_004224331.1|3929231_3930764_-	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	30.0	1.5e-21
WP_023285032.1|3930980_3931742_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.1	3.1e-20
3936012:3936027	attR	GAGAGCTATTGCAGGT	NA	NA	NA	NA
>prophage 6
NZ_CP012561	Klebsiella pneumoniae strain UCLAOXA232KP chromosome, complete genome	5312206	4086290	4132425	5312206	portal,integrase,head,tail,plate,capsid,tRNA	Enterobacteria_phage(51.52%)	54	4091518:4091535	4128691:4128708
WP_004892876.1|4086290_4086791_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_002901080.1|4086907_4087354_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_004140469.1|4087337_4088132_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_020324105.1|4088239_4089415_+	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_004140471.1|4089446_4090139_-	CTP synthase	NA	NA	NA	NA	NA
WP_020802835.1|4090284_4090794_+	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_014343000.1|4090798_4091137_+	DUF488 family protein	NA	NA	NA	NA	NA
WP_004176548.1|4091126_4091366_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
4091518:4091535	attL	CCCGACGGGGCTTTTTTT	NA	NA	NA	NA
WP_004213128.1|4091629_4091881_-	ogr/Delta-like zinc finger family protein	NA	A0A2I8TV89	Erwinia_phage	49.2	3.4e-08
WP_040181406.1|4091924_4093064_-	phage late control D family protein	NA	B9A7A9	Serratia_phage	72.3	9.4e-146
WP_040181409.1|4093218_4094391_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	70.7	5.0e-158
WP_004216461.1|4094390_4094906_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	61.2	2.2e-57
WP_004131585.1|4094951_4095269_+	hypothetical protein	NA	B9A7B2	Serratia_phage	54.8	1.0e-17
WP_071591910.1|4095289_4095427_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	65.9	4.4e-10
WP_040181412.1|4095413_4098389_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	46.4	2.0e-219
WP_040181415.1|4098404_4098878_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	66.9	6.6e-53
WP_040181417.1|4099341_4100004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052450975.1|4100021_4101245_-	DUF262 domain-containing protein	NA	A0A1V0S9I8	Catovirus	27.5	7.8e-05
WP_040181419.1|4101844_4102942_-|tail	phage tail protein	tail	G4KKN6	Yersinia_phage	47.8	5.2e-08
WP_023339950.1|4102941_4103154_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040181424.1|4103150_4106177_-|tail	phage tail protein I	tail	D5LGZ2	Escherichia_phage	40.7	6.4e-24
WP_023300878.1|4106166_4107090_-|plate	baseplate J/gp47 family protein	plate	A0A0A7NPY5	Enterobacteria_phage	43.6	7.6e-53
WP_040181426.1|4107091_4107442_-	GPW/gp25 family protein	NA	A0A0A7NQ90	Enterobacteria_phage	58.2	1.8e-23
WP_009486481.1|4107438_4108026_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	60.5	6.9e-60
WP_020316957.1|4108022_4108658_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	51.9	4.6e-57
WP_040181428.1|4108654_4109122_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	58.8	4.5e-46
WP_158246032.1|4109122_4109458_-	peptidase	NA	B6SD31	Bacteriophage	33.3	2.1e-05
WP_023339943.1|4109644_4110190_-	lysozyme	NA	Q1I0Z1	Pasteurella_virus	43.0	6.3e-31
WP_004213110.1|4110186_4110471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004131559.1|4110461_4110662_-|tail	tail protein X	tail	A0A0A7NV57	Enterobacteria_phage	63.1	1.6e-16
WP_040181431.1|4110661_4111177_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	48.8	2.7e-39
WP_023328071.1|4112195_4113230_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	50.0	3.6e-96
WP_040181436.1|4113239_4114079_-|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	66.3	4.3e-95
WP_040181438.1|4114235_4115963_+	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	67.1	1.0e-228
WP_048289843.1|4115956_4117018_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	68.1	9.1e-143
WP_040181440.1|4117862_4118654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040181442.1|4118653_4120924_+	UvrD-helicase domain-containing protein	NA	NA	NA	NA	NA
WP_162899463.1|4121743_4123795_-	replication endonuclease	NA	A0A0M4RTM8	Salmonella_phage	52.3	6.2e-188
WP_040181444.1|4123812_4124769_-	DNA adenine methylase	NA	A0A0M4QWR0	Salmonella_phage	54.4	1.5e-83
WP_023329528.1|4125001_4125568_-	3'-5' exoribonuclease	NA	D4HTX2	Vibrio_phage	33.2	2.8e-13
WP_004213098.1|4125564_4125789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023329526.1|4125857_4126130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040181449.1|4126145_4126523_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004216643.1|4126538_4126757_-	hypothetical protein	NA	A0A0M5M1I3	Salmonella_phage	49.1	3.6e-06
WP_020806130.1|4126777_4127056_-	regulatory phage cox family protein	NA	Q1JS60	Enterobacteria_phage	88.9	6.2e-43
WP_004213095.1|4127176_4127476_+	helix-turn-helix transcriptional regulator	NA	Q1JS61	Enterobacteria_phage	77.8	6.5e-38
WP_040181453.1|4127591_4128575_+|integrase	tyrosine-type recombinase/integrase	integrase	Q83VS6	Escherichia_phage	79.8	1.4e-150
WP_004176549.1|4128839_4129853_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	29.0	1.9e-12
4128691:4128708	attR	CCCGACGGGGCTTTTTTT	NA	NA	NA	NA
WP_004150782.1|4129910_4130012_+	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_004892898.1|4130011_4130086_+	protein YoaJ	NA	NA	NA	NA	NA
WP_004140488.1|4130203_4130329_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004140489.1|4130388_4130652_-	DUF2534 family protein	NA	NA	NA	NA	NA
WP_004150783.1|4130782_4131421_-	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_023302064.1|4131510_4132425_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	50.4	1.1e-72
>prophage 7
NZ_CP012561	Klebsiella pneumoniae strain UCLAOXA232KP chromosome, complete genome	5312206	4885980	4930926	5312206	head,tail,lysis,coat,terminase,tRNA	Cronobacter_phage(27.66%)	64	NA	NA
WP_040181289.1|4885980_4886220_-	hypothetical protein	NA	K7P7N3	Enterobacteria_phage	51.9	4.2e-16
WP_071854268.1|4886325_4887126_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040186451.1|4889211_4891689_-	MoaD/ThiS family protein	NA	F1C5A7	Cronobacter_phage	45.3	1.4e-197
WP_040181295.1|4891675_4892071_-	C40 family peptidase	NA	F1C5F2	Cronobacter_phage	54.8	4.7e-36
WP_004196571.1|4892067_4892538_-	hypothetical protein	NA	R9TPR6	Aeromonas_phage	40.4	1.2e-27
WP_023283377.1|4892537_4893014_-	hypothetical protein	NA	A0A2P1MXB5	Escherichia_phage	49.0	3.0e-37
WP_071854269.1|4893127_4893541_+	hypothetical protein	NA	G0ZNE8	Cronobacter_phage	89.8	5.0e-65
WP_040181302.1|4893560_4893740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040181305.1|4893780_4896351_-|tail	tail protein (tape measure)	tail	F1C5E9	Cronobacter_phage	40.3	8.5e-94
WP_071854270.1|4896442_4896913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040181307.1|4896968_4897307_-	hypothetical protein	NA	H6WRV3	Salmonella_phage	57.3	1.0e-31
WP_052450973.1|4897402_4897876_-	DUF2335 domain-containing protein	NA	NA	NA	NA	NA
WP_023339090.1|4897844_4898042_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040181310.1|4898188_4898746_-	Rha family transcriptional regulator	NA	A0A088CBJ5	Shigella_phage	88.2	6.7e-89
WP_040181312.1|4898963_4899677_-	hypothetical protein	NA	G0ZNE7	Cronobacter_phage	54.6	2.1e-63
WP_023283367.1|4899745_4900510_-	immunoglobulin domain-containing protein	NA	G0ZNE6	Cronobacter_phage	43.8	2.7e-40
WP_023339086.1|4900568_4900952_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040181318.1|4900948_4901317_-	hypothetical protein	NA	F1C5E3	Cronobacter_phage	82.0	1.9e-47
WP_040181321.1|4901319_4901682_-	hypothetical protein	NA	G0ZNE2	Cronobacter_phage	50.8	1.6e-27
WP_038434988.1|4901681_4901855_-	hypothetical protein	NA	Q5G8X7	Enterobacteria_phage	51.8	1.2e-12
WP_032439723.1|4901854_4902235_-	hypothetical protein	NA	F1C5E2	Cronobacter_phage	54.5	4.1e-29
WP_029884066.1|4902237_4902477_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040027496.1|4902509_4903565_-|coat	phage coat protein	coat	A0A291AXD4	Shigella_phage	53.2	2.2e-101
WP_016529582.1|4903561_4904023_-	hypothetical protein	NA	B1GS72	Salmonella_phage	50.3	5.0e-29
WP_040181327.1|4904022_4905378_-	hypothetical protein	NA	F1C5D9	Cronobacter_phage	53.1	5.1e-130
WP_020804668.1|4905428_4905632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087749279.1|4905628_4906642_-|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	69.7	1.8e-116
WP_040181330.1|4906559_4908008_-	hypothetical protein	NA	F1C5D7	Cronobacter_phage	51.0	2.1e-118
WP_040181332.1|4908019_4909588_-|terminase	terminase	terminase	G8C7P3	Escherichia_phage	91.2	2.4e-301
WP_069377345.1|4909584_4910235_-	hypothetical protein	NA	G8C7P2	Escherichia_phage	89.4	6.2e-102
WP_087749278.1|4910303_4910441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040181192.1|4910443_4910911_-|lysis	lysis protein	lysis	Q76H63	Enterobacteria_phage	73.5	7.5e-57
WP_040181191.1|4910907_4911411_-	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	78.4	5.0e-75
WP_012967717.1|4911413_4911728_-	hypothetical protein	NA	H6WRZ3	Salmonella_phage	86.1	8.3e-44
WP_065807620.1|4912502_4913192_-	antiterminator	NA	I6PDF8	Cronobacter_phage	54.9	1.1e-56
WP_004136182.1|4913188_4913329_-	YlcG family protein	NA	NA	NA	NA	NA
WP_065807619.1|4913325_4913556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065807618.1|4913552_4914161_-	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	65.7	2.3e-50
WP_065807617.1|4914153_4914822_-	metallophosphoesterase	NA	K7P6H8	Enterobacteria_phage	76.0	4.1e-101
WP_071854273.1|4914818_4914986_-	NinE family protein	NA	NA	NA	NA	NA
WP_004191566.1|4914991_4915588_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	54.3	1.2e-56
WP_077269010.1|4915994_4916471_-	DUF551 domain-containing protein	NA	A0A077SK54	Escherichia_phage	35.4	3.0e-13
WP_009308003.1|4916971_4917148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065807615.1|4917147_4917687_-	hypothetical protein	NA	A0A1V0E5L5	Salmonella_phage	37.6	9.3e-19
WP_065807614.1|4917679_4917916_-	hypothetical protein	NA	S4TVX5	Salmonella_phage	50.0	1.5e-13
WP_162899465.1|4917912_4918362_-	hypothetical protein	NA	R9TME7	Aeromonas_phage	31.7	7.5e-06
WP_012542626.1|4918364_4918658_-	protein ren	NA	O48423	Enterobacteria_phage	65.6	2.5e-26
WP_065807612.1|4918654_4919527_-	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	69.4	3.8e-94
WP_001548453.1|4920450_4920672_-	hypothetical protein	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
WP_004194000.1|4920711_4920939_-	Cro/Cl family transcriptional regulator	NA	A0A2I6PIE5	Escherichia_phage	61.2	1.9e-18
WP_032429930.1|4921007_4921730_+	helix-turn-helix transcriptional regulator	NA	E7C9R0	Salmonella_phage	63.2	9.4e-75
WP_004178798.1|4921979_4922453_+	hypothetical protein	NA	K7PLT9	Enterobacteria_phage	58.5	1.1e-52
WP_004178796.1|4922449_4923382_+	hypothetical protein	NA	K7PGT0	Enterobacteria_phage	55.5	1.9e-91
WP_074183191.1|4923765_4923891_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019704100.1|4923883_4924078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040182107.1|4924167_4924452_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	81.9	1.7e-40
WP_040182110.1|4924468_4925215_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	67.7	7.0e-65
WP_040182112.1|4925211_4925835_+	YqaJ viral recombinase family protein	NA	A0A0S2SY31	Pseudomonas_phage	59.2	5.8e-57
WP_040182113.1|4925863_4926391_+	phage N-6-adenine-methyltransferase	NA	Q9ZWX6	Enterobacteria_phage	61.0	1.1e-56
WP_040182114.1|4926387_4926606_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	52.2	4.4e-12
WP_071531921.1|4926607_4926943_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004143017.1|4928414_4929281_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.8	1.3e-30
WP_004143016.1|4929282_4929495_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_004143010.1|4929540_4930926_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	3.5e-46
>prophage 1
NZ_CP012564	Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-3, complete sequence	88800	11158	41752	88800	integrase,transposase	Escherichia_phage(35.71%)	29	25444:25458	42475:42489
WP_000845048.1|11158_12172_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_000237816.1|12344_12797_+	NAD(+)--rifampin ADP-ribosyltransferase Arr-2	NA	NA	NA	NA	NA
WP_022631163.1|12877_14131_-	group II intron reverse transcriptase/maturase	NA	H7BVN7	unidentified_phage	29.7	3.0e-12
WP_022631510.1|14851_15406_+	AAC(6')-Ib family aminoglycoside 6'-N-acetyltransferase	NA	NA	NA	NA	NA
WP_015632396.1|15816_16596_+	16S rRNA (guanine(1405)-N(7))-methyltransferase RmtF1	NA	NA	NA	NA	NA
WP_031281281.1|18244_18877_-	type B chloramphenicol O-acetyltransferase	NA	A0A2R8FE91	Brazilian_cedratvirus	40.9	2.6e-28
WP_000376623.1|19659_20160_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001389365.1|20666_21431_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_004098817.1|21691_22906_+	type II site-specific deoxyribonuclease	NA	E5E3X4	Burkholderia_phage	42.5	1.2e-34
WP_072094655.1|22939_24343_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	9.0e-106
WP_071854279.1|24691_25396_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	4.5e-138
25444:25458	attL	CTCAGTGGAACGAAA	NA	NA	NA	NA
WP_001393253.1|28274_28607_+	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
WP_000239590.1|28653_29529_-	class A extended-spectrum beta-lactamase CTX-M-15	NA	A0A1B0VBP7	Salmonella_phage	82.4	1.1e-125
WP_001067855.1|29761_30466_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001348075.1|30512_30749_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_071854281.1|30822_31239_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_001261282.1|31235_31466_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_165763053.1|31422_31884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015632378.1|32028_32343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024191724.1|32391_32703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016162067.1|32767_33772_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032495756.1|33815_33977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015632375.1|33969_34764_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	88.7	5.5e-52
WP_006788217.1|35235_35415_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004197649.1|35534_36161_-	ParA family plasmid-partitioning AAA ATPase	NA	A0A222YXS3	Escherichia_phage	43.6	2.9e-40
WP_004098982.1|36793_37669_-	RepB family plasmid replication initiator protein	NA	Q71TL8	Escherichia_phage	56.4	5.6e-82
WP_016162068.1|38080_39352_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.0	2.6e-152
WP_015632467.1|39351_39783_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.7	7.2e-30
WP_015632466.1|40726_41752_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
42475:42489	attR	CTCAGTGGAACGAAA	NA	NA	NA	NA
>prophage 1
NZ_CP012565	Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-4, complete sequence	112059	0	107866	112059	integrase,terminase,portal,tail	Salmonella_phage(91.58%)	110	15680:15698	98536:98554
WP_014342073.1|0_1218_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	47.3	1.3e-73
WP_014342074.1|1669_1882_-	hypothetical protein	NA	J9Q7S8	Salmonella_phage	80.0	4.3e-28
WP_019704552.1|1881_2217_-	hypothetical protein	NA	J9Q7Z5	Salmonella_phage	67.6	2.1e-37
WP_014342076.1|2579_2756_-	hypothetical protein	NA	J9Q7G9	Salmonella_phage	68.8	4.7e-12
WP_019704549.1|4005_4272_-	hypothetical protein	NA	J9Q7G8	Salmonella_phage	84.1	1.7e-34
WP_014342079.1|4271_5216_-	exonuclease	NA	J9Q7S6	Salmonella_phage	93.0	1.1e-171
WP_032439699.1|5276_6284_-	hypothetical protein	NA	J9Q7Z3	Salmonella_phage	88.6	5.4e-145
WP_032439785.1|6403_6835_-	hypothetical protein	NA	J9Q6I8	Salmonella_phage	91.4	3.4e-64
WP_032439697.1|6985_7633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032439695.1|7737_8712_+	FRG domain-containing protein	NA	NA	NA	NA	NA
WP_072199362.1|8811_9237_-	hypothetical protein	NA	J9Q7S4	Salmonella_phage	80.9	7.5e-56
WP_060613611.1|9251_12770_-	DNA polymerase III subunit alpha	NA	J9Q7Z2	Salmonella_phage	93.2	0.0e+00
WP_032439780.1|12950_14183_-	AAA family ATPase	NA	J9Q733	Salmonella_phage	86.4	2.2e-212
WP_071854283.1|14279_16559_-	porphyrin biosynthesis protein	NA	J9Q7G6	Salmonella_phage	63.1	5.0e-247
15680:15698	attL	TAGGTATGTACTTACTTAT	NA	NA	NA	NA
WP_014342091.1|17160_17541_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_032439777.1|17535_18636_-|integrase	site-specific integrase	integrase	A0A1P8DTG6	Proteus_phage	30.0	9.4e-18
WP_019704541.1|18985_19345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014342093.1|19409_19820_-	type II toxin-antitoxin system YafO family toxin	NA	NA	NA	NA	NA
WP_014342094.1|19829_20435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026005930.1|20529_20775_-	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	47.4	5.3e-14
WP_014342096.1|20905_21679_-	phosphate starvation-inducible protein PhoH	NA	W8D063	Erwinia_phage	65.0	1.1e-89
WP_014342097.1|21919_23509_+	hypothetical protein	NA	NA	NA	NA	NA
WP_179235152.1|24676_24919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014342103.1|25066_25282_-	hypothetical protein	NA	J9Q6I3	Salmonella_phage	77.1	3.2e-23
WP_014342104.1|25265_25430_-	hypothetical protein	NA	J9Q729	Salmonella_phage	72.5	6.7e-13
WP_014342105.1|25441_26764_-	putative DNA ligase	NA	J9Q7G5	Salmonella_phage	85.2	4.8e-226
WP_050484893.1|26763_27231_-	hypothetical protein	NA	J9Q7R9	Salmonella_phage	63.9	7.5e-49
WP_032439773.1|27310_28099_-	hypothetical protein	NA	J9Q7Z0	Salmonella_phage	51.1	6.9e-71
WP_032439771.1|28387_29554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072196452.1|29596_30721_-	DNA primase	NA	J9Q720	Salmonella_phage	91.6	6.3e-203
WP_014342110.1|30868_32209_-	AAA family ATPase	NA	J9Q7G4	Salmonella_phage	95.7	7.0e-241
WP_014342111.1|32273_32999_-	hypothetical protein	NA	J9Q7R8	Salmonella_phage	88.4	1.3e-127
WP_032439768.1|33181_33592_-	hypothetical protein	NA	J9Q6F2	Salmonella_phage	38.6	9.2e-19
WP_174565794.1|33584_34352_-	hypothetical protein	NA	J9Q719	Salmonella_phage	42.9	6.6e-18
WP_014342115.1|34424_34781_-	hypothetical protein	NA	J9Q7G3	Salmonella_phage	97.9	1.4e-44
WP_014342116.1|34786_35452_-	AAA family ATPase	NA	J9Q7R7	Salmonella_phage	83.3	8.3e-102
WP_072199352.1|35691_36213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032439763.1|36415_36667_-	hypothetical protein	NA	J9Q7R6	Salmonella_phage	74.7	1.2e-24
WP_032439761.1|36669_37362_-	membrane protein	NA	J9Q7Y7	Salmonella_phage	89.1	1.2e-119
WP_004109805.1|37375_37699_-	hypothetical protein	NA	J9Q6E7	Salmonella_phage	95.3	2.3e-49
WP_032439760.1|37794_39240_-|tail	tail fiber domain-containing protein	tail	A0A0H4TGH1	Klebsiella_phage	37.1	1.3e-38
WP_019704527.1|51477_52089_-|tail	tail assembly protein	tail	J9Q7F8	Salmonella_phage	72.1	1.1e-76
WP_004109817.1|52076_52874_-	C40 family peptidase	NA	J9Q7R4	Salmonella_phage	85.3	5.4e-140
WP_071854284.1|52866_53565_-|tail	phage minor tail protein L	tail	J9Q7Y5	Salmonella_phage	87.0	1.2e-122
WP_032439754.1|53651_53987_-|tail	phage tail protein	tail	J9Q6E1	Salmonella_phage	83.6	5.7e-51
WP_048292502.1|54030_58566_-	tape measure protein	NA	J9Q712	Salmonella_phage	69.7	0.0e+00
WP_014342129.1|58573_58798_-	hypothetical protein	NA	J9Q7F7	Salmonella_phage	93.2	2.0e-31
WP_004109835.1|58923_59241_-	hypothetical protein	NA	J9Q7R3	Salmonella_phage	93.3	1.8e-46
WP_004109839.1|59302_60049_-	Ig domain-containing protein	NA	J9Q7Y4	Salmonella_phage	83.0	3.7e-106
WP_014342130.1|60116_60509_-	hypothetical protein	NA	J9Q6D8	Salmonella_phage	69.0	5.3e-48
WP_004109845.1|60510_60984_-	hypothetical protein	NA	J9Q711	Salmonella_phage	93.6	1.9e-76
WP_004109848.1|60974_61319_-	hypothetical protein	NA	J9Q7F6	Salmonella_phage	92.1	7.4e-54
WP_032439750.1|61416_62250_-	hypothetical protein	NA	J9Q7R2	Salmonella_phage	84.1	2.2e-131
WP_021313129.1|62249_62684_-	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	84.0	2.9e-63
WP_014342134.1|62731_63160_-	Ig domain-containing protein	NA	J9Q6D6	Salmonella_phage	71.6	7.9e-29
WP_004109857.1|63238_64117_-	hypothetical protein	NA	J9Q710	Salmonella_phage	94.2	4.7e-153
WP_014342135.1|64143_65043_-	hypothetical protein	NA	J9Q7F4	Salmonella_phage	82.6	1.0e-123
WP_048292499.1|65065_66640_-|portal	phage portal protein	portal	J9Q7R1	Salmonella_phage	88.2	2.8e-273
WP_004109863.1|66672_67929_-|terminase	terminase	terminase	J9Q7Y2	Salmonella_phage	97.4	9.4e-248
WP_004109866.1|67931_68573_-	DNA-binding protein	NA	J9Q6D4	Salmonella_phage	88.2	5.0e-96
WP_004109869.1|68748_69015_-	hypothetical protein	NA	J9Q757	Salmonella_phage	90.9	1.3e-37
WP_004109872.1|69024_69915_-	hypothetical protein	NA	J9Q7I6	Salmonella_phage	97.0	5.4e-165
WP_019704585.1|69920_70175_-	hypothetical protein	NA	J9Q7U0	Salmonella_phage	96.4	2.0e-40
WP_019704584.1|70167_70806_-	ATP-binding cassette domain-containing protein	NA	J9Q807	Salmonella_phage	97.6	1.4e-109
WP_014342142.1|70802_71471_-	ParB N-terminal domain-containing protein	NA	J9Q6L1	Salmonella_phage	91.4	1.9e-106
WP_050484892.1|71470_72175_-	ParB N-terminal domain-containing protein	NA	J9Q756	Salmonella_phage	89.3	2.8e-108
WP_071854285.1|72234_73794_+	DEAD/DEAH box helicase	NA	J9Q7I4	Salmonella_phage	92.5	4.4e-279
WP_014342145.1|73796_74072_+	hypothetical protein	NA	J9Q7T9	Salmonella_phage	68.1	4.0e-26
WP_019704582.1|74122_74560_-	hypothetical protein	NA	A0A1V0E7W1	Vibrio_phage	36.4	9.5e-14
WP_014342147.1|74715_75246_+	transcriptional regulator	NA	J9Q6L0	Salmonella_phage	84.5	3.5e-71
WP_148722482.1|75255_75555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004109892.1|75879_76530_+	hypothetical protein	NA	J9Q754	Salmonella_phage	91.7	8.4e-107
WP_004109904.1|76580_76784_+	hypothetical protein	NA	J9Q7I3	Salmonella_phage	95.5	4.1e-28
WP_021313140.1|77375_77858_-	hypothetical protein	NA	J9Q805	Salmonella_phage	70.6	1.3e-64
WP_032439735.1|78083_78272_+	hypothetical protein	NA	E5FFJ6	Burkholderia_phage	61.1	1.1e-11
WP_032439733.1|78299_78581_-	ABC transporter	NA	J9Q753	Salmonella_phage	83.9	5.3e-42
WP_032439731.1|78707_79115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072199357.1|79234_79534_-	hypothetical protein	NA	J9Q7T7	Salmonella_phage	68.7	5.0e-30
WP_023279445.1|79682_79895_-	hypothetical protein	NA	J9Q804	Salmonella_phage	77.9	4.4e-25
WP_019704577.1|79907_80126_-	hypothetical protein	NA	J9Q6K7	Salmonella_phage	81.9	2.9e-27
WP_019704576.1|81676_82903_-	hypothetical protein	NA	J9Q803	Salmonella_phage	54.2	1.6e-119
WP_019704575.1|83073_83391_-	hypothetical protein	NA	J9Q750	Salmonella_phage	74.3	9.2e-43
WP_019704574.1|84005_84752_+	NYN domain-containing protein	NA	NA	NA	NA	NA
WP_071786700.1|84896_85325_-	GFA family protein	NA	NA	NA	NA	NA
WP_019704573.1|85598_85958_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019704572.1|86204_86468_-	hypothetical protein	NA	J9Q7T5	Salmonella_phage	70.5	1.7e-29
WP_019704571.1|86619_87321_-	hypothetical protein	NA	J9Q6K2	Salmonella_phage	69.7	3.0e-78
WP_071854286.1|87409_89095_-	DUF4942 domain-containing protein	NA	J9Q747	Salmonella_phage	91.1	0.0e+00
WP_019704569.1|89223_89802_-	hypothetical protein	NA	J9Q7H6	Salmonella_phage	57.0	3.9e-55
WP_019704568.1|89929_90085_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	61.2	1.3e-05
WP_019704567.1|90084_90510_-	tellurite/colicin resistance protein	NA	Q71TK7	Escherichia_phage	80.9	9.8e-56
WP_023343110.1|90810_91350_-	hypothetical protein	NA	J9Q6J9	Salmonella_phage	46.0	6.4e-28
WP_019704565.1|91507_92095_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	80.2	3.4e-91
WP_019704564.1|92667_92901_-	hypothetical protein	NA	J9Q7H5	Salmonella_phage	84.2	2.7e-31
WP_071854287.1|93098_93692_-	phage N-6-adenine-methyltransferase	NA	J9Q7T2	Salmonella_phage	83.8	1.2e-96
WP_019704562.1|93876_94710_-	hypothetical protein	NA	J9Q7Z9	Salmonella_phage	53.1	1.2e-62
WP_014342174.1|94835_95393_-	3'-5' exonuclease	NA	J9Q6J8	Salmonella_phage	84.2	1.4e-86
WP_023279504.1|95402_95822_-	hypothetical protein	NA	J9Q743	Salmonella_phage	74.1	6.5e-52
WP_014342176.1|95885_96530_-	AAA family ATPase	NA	J9Q7H4	Salmonella_phage	76.6	6.8e-93
WP_019704561.1|96529_97006_-	dihydrofolate reductase	NA	J9Q7T1	Salmonella_phage	79.0	1.9e-71
WP_162899470.1|97002_97398_-	hypothetical protein	NA	J9Q7Z8	Salmonella_phage	74.8	2.6e-50
WP_014342179.1|97417_98521_-	thymidylate synthase	NA	J9Q6J6	Salmonella_phage	79.8	2.5e-180
WP_014342180.1|98714_99590_-	nucleoside triphosphate pyrophosphohydrolase family protein	NA	J9Q742	Salmonella_phage	84.7	4.5e-140
98536:98554	attR	ATAAGTAAGTACATACCTA	NA	NA	NA	NA
WP_014342181.1|99667_100810_-	ribonucleotide-diphosphate reductase subunit beta	NA	J9Q7H3	Salmonella_phage	95.8	9.0e-213
WP_071854289.1|100940_103244_-	ribonucleoside-diphosphate reductase subunit alpha	NA	J9Q7T0	Salmonella_phage	90.8	0.0e+00
WP_014342183.1|103319_103889_-	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	90.5	3.8e-95
WP_014342184.1|103898_104609_-	hypothetical protein	NA	J9Q6J5	Salmonella_phage	57.6	2.8e-71
WP_019704556.1|104634_106551_-	AAA family ATPase	NA	J9Q741	Salmonella_phage	84.8	3.3e-300
WP_014342187.1|106547_106781_-	hypothetical protein	NA	J9Q7H1	Salmonella_phage	66.1	3.4e-18
WP_014342188.1|106780_107866_-	metallophosphoesterase	NA	J9Q7S9	Salmonella_phage	84.2	2.0e-182
>prophage 1
NZ_CP012566	Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-5, complete sequence	127690	0	12798	127690		Escherichia_phage(37.5%)	15	NA	NA
WP_011977818.1|1720_2926_+	AAA family ATPase	NA	A0A077SL49	Escherichia_phage	69.3	5.3e-163
WP_011977819.1|2925_3900_+	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	53.8	1.4e-86
WP_011977820.1|3981_5253_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.3	1.1e-150
WP_001568036.1|5252_5684_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.3	2.1e-29
WP_011977821.1|5917_6889_+	mediator of plasmid stability	NA	A0A222YXF2	Escherichia_phage	46.8	8.2e-74
WP_032435767.1|6891_7563_+	plasmid partitioning/stability family protein	NA	NA	NA	NA	NA
WP_001568040.1|7625_7856_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011977792.1|8292_8994_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.7	2.4e-27
WP_001568042.1|8993_9215_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001568043.1|9224_9644_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_013214013.1|9697_10465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023279469.1|11144_11573_+	antirestriction protein	NA	NA	NA	NA	NA
WP_011977778.1|11615_12122_+	antirestriction protein ArdA	NA	G9FHQ1	Rhodococcus_virus	31.4	1.2e-07
WP_001568047.1|12164_12356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011977779.1|12543_12798_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	48.8	4.0e-12
>prophage 2
NZ_CP012566	Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-5, complete sequence	127690	15937	26442	127690	transposase	Escherichia_phage(28.57%)	14	NA	NA
WP_004152756.1|15937_16501_+	methyltransferase	NA	M4M9L8	Vibrio_phage	42.0	1.7e-18
WP_023280871.1|17331_17874_+	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	76.7	4.6e-50
WP_001568055.1|17922_18171_+	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_071854292.1|18240_20298_+	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	25.2	3.4e-21
WP_001568057.1|20342_20774_+	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_015065516.1|20770_21499_+	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_001568059.1|21495_21822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020806188.1|22187_23168_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	2.3e-185
WP_019706020.1|23260_23473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014343499.1|23483_23708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152720.1|23788_24109_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	39.5	6.8e-09
WP_004152721.1|24098_24377_+	helix-turn-helix transcriptional regulator	NA	O64356	Escherichia_phage	39.4	2.5e-07
WP_023287139.1|24377_24791_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004152492.1|25620_26442_+	DUF945 domain-containing protein	NA	K4F5L3	Cronobacter_phage	40.1	1.2e-44
>prophage 3
NZ_CP012566	Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-5, complete sequence	127690	55479	64993	127690		Virus_Rctr197k(25.0%)	8	NA	NA
WP_015065542.1|55479_60738_+	conjugative transfer relaxase/helicase TraI	NA	A0A1P8DII4	Virus_Rctr197k	33.8	8.0e-06
WP_015065543.1|60817_61543_+	type-F conjugative transfer system pilin acetylase TraX	NA	A0A1D6ZIU7	Xanthomonas_phage	28.3	1.2e-05
WP_015065544.1|61698_62292_+	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_071854295.1|62411_62633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015065546.1|62682_63327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022631529.1|63382_64033_+	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_015065549.1|64029_64338_+	hypothetical protein	NA	K7PKY8	Enterobacterial_phage	40.4	1.7e-17
WP_023157996.1|64513_64993_+	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	31.7	1.2e-17
>prophage 4
NZ_CP012566	Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-5, complete sequence	127690	71197	95113	127690	transposase,integrase	Escherichia_phage(44.44%)	20	81110:81169	91676:92502
WP_001067855.1|71197_71902_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001247892.1|74590_74881_+	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_001293886.1|74877_75279_+	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_000215515.1|75268_75625_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000091613.1|75879_76194_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000509966.1|77896_78502_-	recombinase family protein	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	5.5e-20
81110:81169	attL	CTGGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGC	NA	NA	NA	NA
WP_001067855.1|81174_81879_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000845048.1|82114_83128_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001749986.1|83300_83753_+	NAD(+)--rifampin ADP-ribosyltransferase Arr-3	NA	NA	NA	NA	NA
WP_000777554.1|83887_84361_+	trimethoprim-resistant dihydrofolate reductase DfrA1	NA	G3MBI7	Bacillus_virus	32.1	3.7e-19
WP_000679427.1|85064_85412_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|85405_86245_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000376623.1|86372_86873_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001389365.1|87379_88144_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_023356273.1|88486_88726_+	ribbon-helix-helix domain-containing protein	NA	NA	NA	NA	NA
WP_022631505.1|88725_89136_+	putative toxin-antitoxin system toxin component, PIN family	NA	NA	NA	NA	NA
WP_001067855.1|90965_91670_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000427623.1|92224_93229_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
91676:92502	attR	GCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCAGCTGGGACGCATCGAGCGCACACTGTTCATCCTGGACTGGCTGCAAAGCGTCGAGCTGCGCCGCCGCGTGCATGCCGGGCTGAACAAAGGCGAGGCGCGCAACGCGCTGGCCCGCGCCGTGTTCTTCAACCGCCTGGGGGAAATCCGCGACCGCAGCTTCGAGCAGCAGCGCTACCGGGCCAGCGGCCTCAACCTGGTGACGGCGGCCATCGTGCTATGGAACACGGTCTATCTGGAGCGGGCCGCGAACGCCTTGCGTGGCCACGGTCAAGCCGTCGATGACGGCCTGTTGCAGTACCTGTCGCCGCTCGGCTGGGAGCACATCAACCTGACCGGCGATTACCTCTGGCGCAGCAGCGCCAAGATCGGCGCGGGCAAGTTCAGGCCGCTACGGCCGCTGCAACCGGCTTAGCGTGCTTTATTTAATGAGATGGTCACTCCCTCCTTCCCGGTATTATGCTGAGGACAGGCTTTCATTCGGAGAACTATCATGGAAAACATTGCGCTCATTGGTATCGATCTGGGTAAAAACTCTTTCCATATTCATTGCCAGGATCGTCGCGGGAAGGCTGTTTACCGTAAAAAATTTACCCGGCCAAAGTTGATCGAATTTTTGGCGACATGCCCCGCTACAACCATCGCAATGGAAGCCTGTGGCGGTTCTCACTTTATGGCACGCAAGTTGGAAGAGTTGGGGCATTCCCCAAAGCTGATATCACCACAATTTGTCCGCCCGTTCGTTAAAAGCAATAAAAACGACTTTGTCGA	NA	NA	NA	NA
WP_022631502.1|93643_93844_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004099053.1|94144_95113_-|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.8	5.1e-185
>prophage 5
NZ_CP012566	Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-5, complete sequence	127690	111409	116302	127690	transposase	Escherichia_phage(40.0%)	5	NA	NA
WP_032441952.1|111409_112432_+|transposase	IS21-like element ISSen3 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	85.6	8.7e-175
WP_001531258.1|112428_113211_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	96.5	6.1e-136
WP_015632382.1|113891_114332_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	60.3	2.6e-19
WP_004189161.1|114328_114679_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	63.8	5.2e-39
WP_014839879.1|114709_116302_+|transposase	IS66-like element ISKox1 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.6	1.2e-175
>prophage 6
NZ_CP012566	Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-5, complete sequence	127690	125562	126342	127690	integrase	Macacine_betaherpesvirus(100.0%)	1	NA	NA
WP_013214009.1|125562_126342_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.0	5.4e-52
>prophage 1
NZ_CP012567	Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-6, complete sequence	196706	0	10150	196706		Macacine_betaherpesvirus(40.0%)	7	NA	NA
WP_000523813.1|1610_2777_+	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	97.7	1.4e-224
WP_004152062.1|2776_3748_+	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	86.6	4.1e-150
WP_014386156.1|6571_7843_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	64.0	2.5e-155
WP_004182047.1|7842_8268_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	50.4	2.9e-31
WP_004118481.1|8482_8713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004118478.1|9233_9659_+	antirestriction protein	NA	NA	NA	NA	NA
WP_004152754.1|9895_10150_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	50.0	1.2e-11
>prophage 2
NZ_CP012567	Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-6, complete sequence	196706	13289	17650	196706		Vibrio_phage(33.33%)	4	NA	NA
WP_004152756.1|13289_13853_+	methyltransferase	NA	M4M9L8	Vibrio_phage	42.0	1.7e-18
WP_071854301.1|14683_15226_+	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	76.7	3.5e-50
WP_014386159.1|15274_15523_+	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_014386160.1|15592_17650_+	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	25.4	9.1e-22
>prophage 3
NZ_CP012567	Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-6, complete sequence	196706	21157	22126	196706	transposase	Salmonella_phage(100.0%)	1	NA	NA
WP_074422984.1|21157_22126_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.8	2.5e-184
>prophage 4
NZ_CP012567	Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-6, complete sequence	196706	42942	43730	196706		Enterobacteria_phage(50.0%)	2	NA	NA
WP_014386179.1|42942_43383_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	62.8	4.0e-20
WP_014386180.1|43379_43730_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	63.8	6.9e-39
>prophage 5
NZ_CP012567	Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-6, complete sequence	196706	50432	51021	196706		Shigella_phage(50.0%)	2	NA	NA
WP_014386190.1|50432_50753_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	39.5	3.0e-09
WP_004152721.1|50742_51021_+	helix-turn-helix transcriptional regulator	NA	O64356	Escherichia_phage	39.4	2.5e-07
>prophage 6
NZ_CP012567	Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-6, complete sequence	196706	82128	91532	196706		Virus_Rctr197k(33.33%)	4	NA	NA
WP_071854302.1|82128_87387_+	conjugative transfer relaxase/helicase TraI	NA	A0A1P8DII4	Virus_Rctr197k	33.3	5.2e-05
WP_014386207.1|87431_88157_+	type-F conjugative transfer system pilin acetylase TraX	NA	A0A1D6ZIU7	Xanthomonas_phage	27.9	3.5e-05
WP_004152380.1|88228_88822_+	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_014386209.1|90008_91532_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	38.7	7.0e-88
>prophage 7
NZ_CP012567	Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-6, complete sequence	196706	95304	98589	196706		Liberibacter_phage(100.0%)	1	NA	NA
WP_040182250.1|95304_98589_+	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	27.4	3.3e-66
>prophage 8
NZ_CP012567	Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-6, complete sequence	196706	104991	186372	196706	transposase,protease,holin,integrase	uncultured_Caudovirales_phage(20.0%)	75	112863:112922	121018:121756
WP_064762441.1|104991_105471_+	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	33.1	5.4e-18
WP_004099069.1|105790_106069_+	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_014386216.1|106284_106362_+	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_004099067.1|106354_107212_+	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_000616807.1|108200_108854_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000557619.1|108946_109204_+	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_001398199.1|109136_109538_+	type II toxin-antitoxin system toxin endoribonuclease PemK	NA	NA	NA	NA	NA
WP_001553819.1|109674_112572_-|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	4.2e-182
WP_001067855.1|112841_113546_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
112863:112922	attL	CATTTTCAGCGTGACATCATTCTGTGGGCCGTACGCTGGTACTGCAAATACGGCATCAGT	NA	NA	NA	NA
WP_000147567.1|115702_116263_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_000454193.1|116388_116739_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000845048.1|116941_117955_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_063840321.1|118246_118801_+	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
WP_001334766.1|118931_119762_+	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
WP_044117068.1|120393_121062_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	99.5	1.9e-130
WP_000427623.1|121353_122358_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
121018:121756	attR	ACTGATGCCGTATTTGCAGTACCAGCGTACGGCCCACAGAATGATGTCACGCTGAAAATGGGGTCCGCTTGGAAAACGGAATCTATGGTCACTCCCGTTTTTGCAACACCGATTTTGACGACAAGTTGGCTTGCTTGAATCTATCCGGCGTCTGAATGGGATTTTATTCCCGCGCCTTGATGAGTTCCGCGCCTGATGAACCTCCAGAAAATATACGGCTTCAATGAGCCTTTCCGTTTTACAGGTTCCTCAACAGGCCGGTGGGCCGTTAGTATCATCAATATCAGTATTCGCAAAACCAGATCAGTAATTCTTTAAACCGGTGTATTTCTGCCGTTATGCTACATAAGTTTGCTGTCGTGCCGTTAGGGCCCAGGCTATTCTGGCCAGCTTGTTTGCCAGAGCACAAGTGACGACAAAGTTGCTTTTCCGGCACAGTAAATCCCTGACCCAATCGGCCAATTTGCCAGACTGGTGTTCCAGTTTTTGTATGAATACCCTGGCACATTGAACCAACAAAGTTCGGATCTTTTTATTACCTCGCTTACTAATTCCCAGCAATGTCGTCCTACCTCCCGTGCTGTACTGCCGAGGTACAAGCCCTGTTGCCGCCGCAAAGTCACGGCTGCTGGCGTACTGCTTCCCGTCGCCAATCTCAGTTGAAATAGTACTCGCTGTCAGTGTTCCGACGCAGGGAATGCTCAGCAAGCGCTGTCCAACCTCATCTTCGTCCAACTTT	NA	NA	NA	NA
WP_004217321.1|123692_124397_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_014386147.1|125252_126080_+	phosphonate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.6	9.0e-21
WP_004152695.1|126076_126940_+	phosphate/phosphite/phosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004152694.1|126948_127776_+	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_004152693.1|127784_128795_+	phosphonate dehydrogenase PtxD	NA	A0A1V0SBV6	Catovirus	25.1	1.4e-15
WP_004152692.1|128788_129658_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014386148.1|130866_131847_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	98.8	2.6e-184
WP_004118209.1|133048_133312_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_004118208.1|133326_133590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152118.1|133833_134115_+	helix-turn-helix domain-containing protein	NA	A0A1B1IUF9	uncultured_Mediterranean_phage	38.2	5.2e-05
WP_004152117.1|134149_134719_+	small heat shock protein sHSP20	NA	NA	NA	NA	NA
WP_004152116.1|134833_137629_+	heat shock survival AAA family ATPase ClpK	NA	K4FB40	Cronobacter_phage	41.0	5.2e-129
WP_004152115.1|137628_137826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009483782.1|138063_138813_+	phosphate-starvation-inducible PsiE family protein	NA	NA	NA	NA	NA
WP_004152113.1|138799_139762_+|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_020314316.1|141604_142951_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_003026803.1|143162_143645_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003026799.1|143632_143899_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_004152108.1|144074_144329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152107.1|144404_144662_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152106.1|144710_144914_-	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_004152105.1|144947_145316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152104.1|145359_145854_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_004152103.1|145884_146460_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152102.1|146447_146717_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152101.1|147074_147425_+	As(III)-sensing metalloregulatory transcriptional repressor ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	1.4e-23
WP_004152100.1|147474_147837_+	arsenite efflux transporter metallochaperone ArsD	NA	NA	NA	NA	NA
WP_004152099.1|147854_149606_+	arsenite efflux transporter ATPase subunit ArsA	NA	NA	NA	NA	NA
WP_004152098.1|149653_150943_+	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	74.0	1.9e-171
WP_004152097.1|150955_151381_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	72.9	2.3e-52
WP_004152096.1|151413_151950_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_004152095.1|153846_154209_-	arsenic metallochaperone ArsD family protein	NA	NA	NA	NA	NA
WP_004182005.1|154284_154830_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_004152093.1|154838_155552_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	77.0	2.9e-92
WP_004152092.1|155548_155875_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004152091.1|156206_156704_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_031944101.1|156753_157263_-	aquaporin	NA	NA	NA	NA	NA
WP_004152086.1|159005_159185_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_004152085.1|159416_159851_-	copper resistance system metallochaperone PcoE	NA	NA	NA	NA	NA
WP_004152084.1|160067_161468_-	copper resistance membrane spanning protein PcoS	NA	W8CYF6	Bacillus_phage	26.3	4.1e-18
WP_001188930.1|161464_162145_-	copper response regulator transcription factor PcoR	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
WP_004118344.1|162199_163129_-	copper resistance inner membrane protein PcoD	NA	NA	NA	NA	NA
WP_000025662.1|163133_163514_-	copper resistance system metallochaperone PcoC	NA	NA	NA	NA	NA
WP_185157552.1|163553_164444_-	copper resistance outer membrane transporter PcoB	NA	NA	NA	NA	NA
WP_000925242.1|164449_166267_-	multicopper oxidase PcoA	NA	NA	NA	NA	NA
WP_001023257.1|166500_166950_+	copper resistance protein	NA	NA	NA	NA	NA
WP_004118669.1|167238_167976_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A2H4JAF5	uncultured_Caudovirales_phage	32.5	1.2e-11
WP_000843497.1|168009_168207_-	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_004098955.1|168247_170695_-	Ag(+)-translocating P-type ATPase SilP	NA	A0A218MNH6	uncultured_virus	35.8	7.6e-84
WP_000758228.1|170821_171262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004098958.1|171348_174495_-	Cu(+)/Ag(+) efflux RND transporter permease subunit SilA	NA	S5VTK5	Leptospira_phage	22.5	4.0e-61
WP_004152079.1|174505_175798_-	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit SilB	NA	NA	NA	NA	NA
WP_001246153.1|175911_176265_-	cation efflux system protein CusF	NA	NA	NA	NA	NA
WP_000475512.1|176293_177679_-	Cu(+)/Ag(+) efflux RND transporter outer membrane channel SilC	NA	NA	NA	NA	NA
WP_001572351.1|177868_178549_+	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	35.6	2.1e-31
WP_003032875.1|178541_180017_+	copper/silver sensor histidine kinase SilS	NA	W8CYF6	Bacillus_phage	30.1	1.0e-27
WP_004178091.1|180267_180699_+	silver-binding protein SilE	NA	NA	NA	NA	NA
WP_085955172.1|182127_183334_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	63.2	1.7e-100
WP_004178088.1|184374_186372_+|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	25.9	9.7e-21
>prophage 9
NZ_CP012567	Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-6, complete sequence	196706	191680	195838	196706	transposase,integrase	Salmonella_phage(33.33%)	4	193777:193788	196533:196544
WP_011977741.1|191680_192649_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.1	2.5e-184
WP_071527918.1|192668_192980_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004152065.1|193006_193954_-	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	30.6	1.8e-12
193777:193788	attL	CATAACATGACT	NA	NA	NA	NA
WP_001515717.1|195097_195838_+|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	58.6	5.4e-25
WP_001515717.1|195097_195838_+|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	58.6	5.4e-25
196533:196544	attR	AGTCATGTTATG	NA	NA	NA	NA
