The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP015750	Pectobacterium wasabiae CFBP 3304 chromosome, complete genome	5043228	211850	256333	5043228	capsid,integrase,tRNA,coat	Cronobacter_phage(20.0%)	37	245717:245739	258058:258080
WP_005969897.1|211850_212702_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_005969898.1|212701_213712_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_005969900.1|213842_214979_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	28.8	3.4e-18
WP_172645132.1|215288_216173_+	EamA family transporter	NA	NA	NA	NA	NA
WP_005969903.1|216259_217525_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_005969904.1|217622_218549_+	alpha/beta hydrolase	NA	A0A2P1EM31	Moumouvirus	33.8	6.9e-30
WP_005969905.1|218653_219871_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_005969906.1|220043_222071_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_005969907.1|222125_222410_-	YfcL family protein	NA	NA	NA	NA	NA
WP_039478207.1|222444_222990_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_005969911.1|223018_223819_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005969913.1|223828_224668_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_005969914.1|224674_225760_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.2	4.7e-86
WP_005969915.1|225834_226767_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_005969916.1|226938_227481_+	endonuclease SmrB	NA	NA	NA	NA	NA
WP_005969918.1|227580_228063_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_005969919.1|228999_229548_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_005969921.1|229724_230261_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_005969922.1|230296_231070_+	molecular chaperone	NA	NA	NA	NA	NA
WP_005969924.1|233498_234512_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_005969927.1|234504_236688_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_005969928.1|236684_237998_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_005969929.1|238242_238539_-	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_005969930.1|238927_240259_+	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_005969932.1|240433_241186_-	SDR family oxidoreductase	NA	A0A0M4JSW6	Mollivirus	26.1	1.0e-07
WP_005969934.1|241328_242231_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005969938.1|244366_245128_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
245717:245739	attL	TCGATTCCAGTCGGGGACACCAT	NA	NA	NA	NA
WP_005969940.1|245899_247066_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	63.2	1.6e-145
WP_039478126.1|248305_249286_-	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_005969943.1|250043_250379_-	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	55.8	2.4e-25
WP_005969945.1|250687_253372_-	DUF927 domain-containing protein	NA	A0A1B0VP75	Pseudomonas_phage	33.3	1.8e-62
WP_005969946.1|253368_253779_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005969947.1|253765_254002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005969948.1|253994_254177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005969949.1|254169_254367_-	host cell division inhibitor Icd-like protein	NA	A0A1W6JPK3	Morganella_phage	61.0	2.6e-11
WP_005969950.1|254816_255326_-|capsid	GPO family capsid scaffolding protein	capsid	Q94MZ5	Haemophilus_virus	49.2	4.2e-29
WP_005969952.1|255334_256333_-|capsid	P2 family phage major capsid protein	capsid	F1BUM2	Cronobacter_phage	49.2	5.4e-81
258058:258080	attR	TCGATTCCAGTCGGGGACACCAT	NA	NA	NA	NA
>prophage 2
NZ_CP015750	Pectobacterium wasabiae CFBP 3304 chromosome, complete genome	5043228	554802	560220	5043228		Mycobacterium_phage(33.33%)	6	NA	NA
WP_005968997.1|554802_555042_+	glutaredoxin-like protein NrdH	NA	V5UN81	Mycobacterium_phage	58.1	3.5e-18
WP_005968995.1|555052_555460_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A220BYR7	Staphylococcus_phage	27.7	1.4e-06
WP_172645152.1|555456_557604_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	51.0	1.4e-203
WP_005968990.1|557628_558591_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	73.9	2.1e-138
WP_005968988.1|558962_559700_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	38.8	1.7e-39
WP_161601946.1|559653_560220_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	55.4	8.5e-47
>prophage 3
NZ_CP015750	Pectobacterium wasabiae CFBP 3304 chromosome, complete genome	5043228	2253826	2262774	5043228	integrase	Enterobacteria_phage(50.0%)	13	2250893:2250906	2264485:2264498
2250893:2250906	attL	AAAATTCATAAAAA	NA	NA	NA	NA
WP_005973640.1|2253826_2254588_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	33.9	9.4e-25
WP_005973638.1|2255127_2255388_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	51.9	1.9e-14
WP_005973635.1|2255384_2255609_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005973632.1|2255970_2256168_+	host cell division inhibitor Icd-like protein	NA	A0A1W6JPK3	Morganella_phage	64.0	1.9e-09
WP_005973630.1|2256160_2256355_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005973627.1|2256351_2256618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005973624.1|2256614_2256956_+	DUF5375 family protein	NA	NA	NA	NA	NA
WP_005973622.1|2256966_2259294_+	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	60.1	1.5e-267
WP_005973620.1|2259347_2259827_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005973618.1|2259817_2260090_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_005973616.1|2260380_2260632_+	prevent-host-death protein	NA	NA	NA	NA	NA
WP_005973612.1|2260621_2260906_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	62.8	7.0e-26
WP_005973610.1|2261520_2262774_+|integrase	tyrosine-type recombinase/integrase	integrase	B7SYF8	Stenotrophomonas_phage	42.9	4.4e-80
2264485:2264498	attR	TTTTTATGAATTTT	NA	NA	NA	NA
>prophage 4
NZ_CP015750	Pectobacterium wasabiae CFBP 3304 chromosome, complete genome	5043228	2499816	2511734	5043228		Morganella_phage(33.33%)	19	NA	NA
WP_005971427.1|2499816_2500263_+	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	55.8	7.7e-27
WP_005971431.1|2500275_2500881_+	hypothetical protein	NA	A0A1W6JPH8	Morganella_phage	57.9	6.9e-55
WP_005971433.1|2500968_2501142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005971436.1|2501334_2501526_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_005971438.1|2501515_2501707_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005971441.1|2501696_2501933_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005971443.1|2501925_2502132_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005971445.1|2502124_2502334_+	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	47.3	2.8e-08
WP_005971447.1|2502330_2502558_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005971449.1|2502557_2505251_+	TOPRIM and DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	57.9	3.9e-299
WP_005971451.1|2505420_2505858_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_005971453.1|2505869_2506304_+	ProQ/FinO family protein	NA	NA	NA	NA	NA
WP_005971455.1|2506296_2507367_+	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	58.3	3.9e-117
WP_005971457.1|2507366_2507720_+	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	44.2	4.4e-17
WP_005971459.1|2507730_2508465_+	hypothetical protein	NA	A0A0M5M1K7	Salmonella_phage	65.6	7.6e-80
WP_005971462.1|2508461_2508644_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174549430.1|2509724_2509919_+	hypothetical protein	NA	H9C185	Pectobacterium_phage	80.6	1.5e-19
WP_005971467.1|2510119_2510578_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152413543.1|2511131_2511734_+	hypothetical protein	NA	A0A0M3ULJ9	Salmonella_phage	47.4	1.1e-07
>prophage 5
NZ_CP015750	Pectobacterium wasabiae CFBP 3304 chromosome, complete genome	5043228	3574957	3678168	5043228	portal,protease,tail,holin,head,lysis,transposase,integrase,terminase,tRNA,capsid,plate	Enterobacteria_phage(15.62%)	117	3637256:3637304	3678280:3678328
WP_005972785.1|3574957_3575890_+|tRNA	tRNA dihydrouridine(16) synthase DusC	tRNA	NA	NA	NA	NA
WP_005972783.1|3576031_3577444_+	S-methylmethionine permease	NA	NA	NA	NA	NA
WP_005972781.1|3577436_3578384_+	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_005972778.1|3578401_3578950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005972777.1|3579287_3579830_+	class IV adenylate cyclase	NA	NA	NA	NA	NA
WP_005972775.1|3579890_3580247_+	FMN-binding protein	NA	NA	NA	NA	NA
WP_005972773.1|3580288_3580798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005972771.1|3580948_3581896_+	D-alanyl-D-alanine endopeptidase	NA	NA	NA	NA	NA
WP_005972769.1|3581970_3582657_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_005972767.1|3582804_3583575_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_005972765.1|3583606_3585259_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_005972763.1|3585255_3586266_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.3	1.7e-29
WP_005972761.1|3586343_3587363_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005972759.1|3587779_3589126_+	aspartate aminotransferase family protein	NA	M9MUV3	Rhodococcus_phage	31.9	4.0e-10
WP_005972757.1|3589479_3591786_+	beta-glucosidase BglX	NA	NA	NA	NA	NA
WP_005972755.1|3591926_3592466_+	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_039477416.1|3592743_3593391_-	LysE family translocator	NA	NA	NA	NA	NA
WP_005972749.1|3593443_3594277_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005972747.1|3594491_3596591_+	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	24.7	2.6e-40
WP_005972743.1|3597222_3598650_+	M10 family metallopeptidase	NA	NA	NA	NA	NA
WP_005972741.1|3598753_3599065_+|protease	protease inhibitor Inh/omp19 family protein	protease	NA	NA	NA	NA
WP_005972740.1|3599082_3600810_+	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	33.5	6.6e-26
WP_005972738.1|3600838_3602167_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005972736.1|3602169_3603537_+	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_005972732.1|3603753_3604083_+|holin	putative holin	holin	A4JWP3	Burkholderia_virus	58.3	1.2e-24
WP_005972729.1|3604084_3604696_+	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	56.5	2.1e-59
WP_005972727.1|3604685_3605360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005972725.1|3605349_3605679_+	hypothetical protein	NA	Q5ZQY8	Pseudomonas_phage	45.8	1.9e-19
WP_005972723.1|3605671_3605983_+	hypothetical protein	NA	Q6QIC3	Burkholderia_phage	46.5	2.8e-20
WP_005972720.1|3606227_3606695_+	Gp37 family protein	NA	NA	NA	NA	NA
WP_005972718.1|3606691_3606889_+	hypothetical protein	NA	A4JWK4	Burkholderia_virus	50.0	8.3e-10
WP_005972716.1|3606878_3608306_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A4JWK5	Burkholderia_virus	72.7	1.4e-202
WP_005972713.1|3608305_3608830_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	66.7	9.5e-69
WP_005972711.1|3608972_3609293_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_086002476.1|3609237_3609381_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_005972710.1|3609603_3611838_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	28.3	2.5e-57
WP_005972708.1|3611837_3612755_+|tail	phage tail protein	tail	Q6QIA4	Burkholderia_phage	45.5	6.0e-50
WP_005972707.1|3612754_3612967_+|tail	tail protein X	tail	A4JWL2	Burkholderia_virus	57.1	2.0e-17
WP_005972706.1|3612954_3614109_+	hypothetical protein	NA	Q6QIA2	Burkholderia_phage	52.1	4.8e-89
WP_005972704.1|3614105_3614687_+|plate	phage baseplate assembly protein V	plate	Q6QIA1	Burkholderia_phage	45.9	3.9e-23
WP_005972702.1|3614746_3615094_+	GPW/gp25 family protein	NA	Q6QIA0	Burkholderia_phage	62.0	9.5e-33
WP_005972692.1|3615084_3616188_+|plate	baseplate J/gp47 family protein	plate	Q6QI99	Burkholderia_phage	54.3	2.5e-103
WP_005972690.1|3616180_3616762_+|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	61.2	9.6e-62
WP_005972688.1|3616764_3618387_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	29.5	6.9e-33
WP_005972686.1|3618386_3619001_+|tail	tail fiber assembly protein	tail	G4KKN5	Yersinia_phage	32.9	2.6e-25
WP_005972683.1|3619149_3620118_+	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_005972681.1|3620204_3622073_+	peptidase M3	NA	NA	NA	NA	NA
WP_005972679.1|3622113_3622836_-	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	42.7	5.0e-36
WP_005972676.1|3622832_3623492_-	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_005972674.1|3623518_3624265_-	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_005972672.1|3624674_3625178_-	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	28.9	1.1e-08
WP_005972670.1|3625515_3626055_+	AAA family ATPase	NA	A0A097BYE2	Leuconostoc_phage	39.2	7.4e-16
WP_005972668.1|3626074_3626956_-	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_005972665.1|3627332_3627848_+	outer membrane protein OmpX	NA	A5LH44	Enterobacteria_phage	34.3	5.4e-16
WP_005972662.1|3628138_3629308_+	MFS transporter	NA	NA	NA	NA	NA
WP_005972659.1|3629355_3630756_-	EmmdR/YeeO family multidrug/toxin efflux MATE transporter	NA	NA	NA	NA	NA
WP_005972657.1|3631129_3631666_+	rhodanese family protein	NA	NA	NA	NA	NA
WP_005972651.1|3631723_3632053_+	DHCW motif cupin fold protein	NA	NA	NA	NA	NA
WP_005972649.1|3632293_3632776_-	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_005972647.1|3633071_3633611_-	DUF2058 domain-containing protein	NA	NA	NA	NA	NA
WP_005972643.1|3633865_3634111_-	YmjA family protein	NA	NA	NA	NA	NA
WP_005972634.1|3634309_3634696_-	lysozyme inhibitor LprI family protein	NA	NA	NA	NA	NA
WP_005972632.1|3635104_3635314_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	48.5	1.6e-11
WP_005972630.1|3635636_3636347_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
3637256:3637304	attL	ATTTGGTCGGCACGAGAGGATTTGAACCTCCGACCCCCGACACCCCATG	NA	NA	NA	NA
WP_005972626.1|3637433_3638615_-|integrase	site-specific integrase	integrase	A0A2H4J1K3	uncultured_Caudovirales_phage	28.7	1.8e-27
WP_005972622.1|3638619_3638826_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152413552.1|3638866_3639202_-	hypothetical protein	NA	A0A222YY67	Escherichia_phage	55.1	1.5e-30
WP_005972619.1|3639203_3639683_-	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	89.5	1.7e-80
WP_005972617.1|3639679_3640495_-	ParB N-terminal domain-containing protein	NA	C7BGF1	Burkholderia_phage	51.4	3.0e-61
WP_069704151.1|3641260_3642136_-	hypothetical protein	NA	A0A077KGZ0	Edwardsiella_phage	67.9	5.2e-27
WP_005967146.1|3642652_3642886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043885402.1|3642863_3643091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005967152.1|3643868_3644102_+	helix-turn-helix domain-containing protein	NA	D0UIL8	Aggregatibacter_phage	55.2	7.3e-13
WP_039477264.1|3644172_3644691_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005967156.1|3644886_3645063_+	DUF4222 domain-containing protein	NA	A0A1W6JP38	Morganella_phage	58.2	2.3e-11
WP_005967158.1|3645059_3646082_+	conserved phage C-terminal domain-containing protein	NA	U5P0A0	Shigella_phage	84.0	5.1e-42
WP_005967160.1|3646078_3646303_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_005967161.1|3646295_3647834_+	phage N-6-adenine-methyltransferase	NA	A0A2H4J5Y9	uncultured_Caudovirales_phage	52.4	9.9e-98
WP_005967162.1|3647830_3648178_+	hypothetical protein	NA	S4TTI6	Salmonella_phage	65.8	2.9e-37
WP_005967163.1|3648174_3648540_+	RusA family crossover junction endodeoxyribonuclease	NA	K7PH72	Enterobacteria_phage	62.3	3.9e-37
WP_005967164.1|3648536_3649562_+	DUF968 domain-containing protein	NA	S5MW46	Escherichia_phage	49.8	6.2e-88
WP_005967165.1|3649554_3649899_+	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	78.8	1.3e-50
WP_005967166.1|3649940_3650351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039477253.1|3650347_3650605_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005967168.1|3650612_3651494_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005967169.1|3652219_3653074_+	DNA/RNA non-specific endonuclease	NA	NA	NA	NA	NA
WP_005967170.1|3653182_3653527_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	57.9	3.3e-30
WP_005967172.1|3653510_3653951_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	73.8	3.3e-54
WP_005967173.1|3653947_3654478_+|lysis	lysis protein	lysis	C5IHR7	Burkholderia_virus	34.8	1.4e-14
WP_005967175.1|3654534_3654939_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152413518.1|3655318_3655645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005967179.1|3655838_3656279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039477231.1|3656343_3656694_+	HNH endonuclease	NA	A0A1W6JP27	Morganella_phage	74.1	4.0e-47
WP_069704160.1|3656950_3657286_+|terminase	P27 family phage terminase small subunit	terminase	A0A1J0GV10	Halomonas_phage	55.3	3.7e-26
WP_005967183.1|3657288_3659010_+|terminase	terminase large subunit	terminase	Q8W631	Enterobacteria_phage	65.1	1.6e-221
WP_005967184.1|3659006_3659165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005967186.1|3659154_3660378_+|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	83.6	1.5e-202
WP_005967188.1|3660370_3660970_+|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	79.0	6.1e-88
WP_005967189.1|3660978_3662205_+|capsid	phage major capsid protein	capsid	A0A1W6JP20	Morganella_phage	72.3	4.1e-163
WP_005967191.1|3662289_3662589_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	56.1	3.0e-27
WP_005967194.1|3662585_3662927_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	63.4	4.9e-34
WP_005967196.1|3662919_3663369_+	HK97 gp10 family phage protein	NA	A0A220NRP5	Escherichia_phage	82.6	2.3e-63
WP_005967198.1|3663365_3663713_+	DUF3168 domain-containing protein	NA	K7P7Q9	Enterobacteria_phage	49.1	3.9e-26
WP_005967200.1|3663773_3664481_+	immunoglobulin domain-containing protein	NA	Q9MCS7	Enterobacteria_phage	69.8	9.8e-85
WP_005967202.1|3664498_3664873_+|tail	phage tail protein	tail	Q9MCS5	Enterobacteria_phage	62.8	4.0e-37
WP_005967204.1|3664896_3665172_+	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	68.9	2.0e-25
WP_005967206.1|3665210_3665447_+	hypothetical protein	NA	K7PH16	Enterobacteria_phage	41.7	6.7e-06
WP_005967208.1|3665491_3668788_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	46.6	2.8e-227
WP_005967210.1|3668787_3669138_+|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	48.2	1.5e-22
WP_005967212.1|3669183_3669594_+	membrane lipoprotein lipid attachment site-containing protein	NA	NA	NA	NA	NA
WP_005967214.1|3669666_3670419_+|tail	phage minor tail protein L	tail	K7PGX3	Enterobacteria_phage	62.9	5.3e-89
WP_005967216.1|3670421_3671150_+	C40 family peptidase	NA	K7PGV2	Enterobacterial_phage	53.6	1.4e-70
WP_005967218.1|3671133_3671733_+|tail	tail assembly protein	tail	F1C572	Cronobacter_phage	58.3	9.9e-54
WP_005967219.1|3671790_3675225_+|tail	phage tail protein	tail	K7P868	Enterobacteria_phage	59.4	8.7e-304
WP_005967221.1|3675217_3676234_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005967223.1|3676299_3677946_+	hypothetical protein	NA	A0A1V0E5M2	Salmonella_phage	29.6	8.2e-42
WP_005967225.1|3677946_3678168_-	hypothetical protein	NA	H9C151	Pectobacterium_phage	87.7	8.1e-30
3678280:3678328	attR	ATTTGGTCGGCACGAGAGGATTTGAACCTCCGACCCCCGACACCCCATG	NA	NA	NA	NA
>prophage 6
NZ_CP015750	Pectobacterium wasabiae CFBP 3304 chromosome, complete genome	5043228	3895364	3996577	5043228	tail,head,lysis,integrase,terminase,tRNA,capsid,plate	Erwinia_phage(20.0%)	100	3931331:3931350	3965660:3965679
WP_005967725.1|3895364_3897095_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L2F0	Tupanvirus	36.0	1.3e-93
WP_005967727.1|3897746_3898295_+	VOC family protein	NA	NA	NA	NA	NA
WP_005967728.1|3898577_3899336_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_005967729.1|3899489_3900476_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_005967730.1|3900472_3901216_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	NA	NA	NA	NA
WP_005967731.1|3901371_3901767_-	MAPEG family protein	NA	NA	NA	NA	NA
WP_005967732.1|3901921_3902734_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	66.9	2.1e-46
WP_005967733.1|3902824_3904042_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_005967735.1|3904578_3906375_+|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	26.2	4.8e-11
WP_005967739.1|3906376_3906820_+	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_005967741.1|3906843_3907587_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_005967743.1|3907650_3908172_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	32.8	1.3e-09
WP_005967745.1|3908263_3908881_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_005967747.1|3908888_3909899_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	24.4	1.2e-06
WP_005967749.1|3909974_3911354_-	carbohydrate porin	NA	NA	NA	NA	NA
WP_005967750.1|3911522_3911828_-	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_005967753.1|3911993_3913322_-	PTS cellobiose transporter subunit IIC	NA	NA	NA	NA	NA
WP_039477173.1|3913779_3914739_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_005967757.1|3914823_3915609_-	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_005967759.1|3915605_3916364_-	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	29.8	1.0e-15
WP_005967760.1|3916440_3917442_+	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_005967762.1|3917454_3918780_+	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.4e-15
WP_005967763.1|3918956_3919934_+	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_005967764.1|3920045_3921488_-	pyruvate kinase	NA	NA	NA	NA	NA
WP_005967766.1|3921881_3922751_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005967769.1|3923118_3924594_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	36.8	5.8e-79
WP_005967771.1|3924760_3925402_+	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_005967772.1|3925581_3926760_-	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_005967773.1|3926958_3929010_+	prolyl oligopeptidase family serine peptidase	NA	NA	NA	NA	NA
WP_005967776.1|3929364_3929595_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	66.2	1.7e-17
WP_005967778.1|3929966_3930473_+	non-heme ferritin	NA	NA	NA	NA	NA
WP_039477172.1|3930755_3931109_+	YebY family protein	NA	NA	NA	NA	NA
3931331:3931350	attL	GTATTCAGTCTTTTTTTATA	NA	NA	NA	NA
WP_005967780.1|3931416_3932472_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4S6G4	Salmonella_phage	62.0	3.9e-130
WP_015841360.1|3932606_3932825_-	DNA-binding transcriptional regulator	NA	Q37973	Salmonella_virus	68.1	9.2e-26
WP_005967781.1|3932912_3934058_-	phage late control D family protein	NA	A0A0M5M5V5	Salmonella_phage	66.1	1.1e-138
WP_005967782.1|3934070_3934556_-|tail	phage tail protein	tail	S4TUC3	Salmonella_phage	59.6	5.4e-50
WP_005967783.1|3934557_3937305_-|tail	phage tail tape measure protein	tail	F1BUT7	Erwinia_phage	52.2	1.2e-162
WP_050512644.1|3937297_3937417_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	84.6	2.2e-13
WP_005967784.1|3937431_3937728_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	67.4	5.1e-27
WP_005967786.1|3937795_3938317_-|tail	phage major tail tube protein	tail	Q37845	Escherichia_phage	74.0	7.8e-71
WP_005967788.1|3938329_3939499_-|tail	phage tail sheath protein	tail	S4TRX2	Salmonella_phage	82.7	5.4e-189
WP_051983880.1|3940511_3940724_-|tail	phage tail assembly chaperone	tail	H2BCU0	Synechococcus_phage	44.1	2.4e-07
WP_005967794.1|3940710_3940932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005967795.1|3940928_3942536_-|tail	phage tail protein	tail	A0A0M3ULH6	Salmonella_phage	66.1	6.1e-74
WP_005967797.1|3942532_3943144_-|tail	phage tail protein I	tail	F1BUP2	Erwinia_phage	68.5	1.4e-76
WP_005967799.1|3943136_3944045_-|plate	baseplate assembly protein	plate	Q858V6	Yersinia_virus	78.1	2.1e-127
WP_005967801.1|3944049_3944391_-	GPW/gp25 family protein	NA	F1BUP4	Erwinia_phage	65.5	5.8e-35
WP_005967805.1|3944387_3945029_-|plate	phage baseplate assembly protein V	plate	Q6K1H6	Salmonella_virus	74.2	2.1e-86
WP_005967809.1|3945131_3945749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005967811.1|3946023_3946473_-	phage virion morphogenesis protein	NA	F1BUP7	Erwinia_phage	62.2	5.3e-44
WP_005967813.1|3946465_3946921_-|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	65.2	1.2e-51
WP_005967815.1|3947010_3947451_-|lysis	LysB family phage lysis regulatory protein	lysis	F1BUQ1	Erwinia_phage	35.3	1.8e-12
WP_005967817.1|3947447_3947957_-	lysozyme	NA	A0A218M4K3	Erwinia_phage	69.5	6.0e-60
WP_039477169.1|3947940_3948162_-	hypothetical protein	NA	A0A218M4L5	Erwinia_phage	50.7	2.8e-14
WP_005967821.1|3948152_3948356_-|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	74.6	1.2e-22
WP_005967823.1|3948355_3948859_-|head	head completion/stabilization protein	head	S4TNY1	Salmonella_phage	59.5	2.3e-51
WP_005967825.1|3948951_3949611_-|terminase	terminase endonuclease subunit	terminase	F1BUQ7	Erwinia_phage	64.5	2.4e-69
WP_005967826.1|3949614_3950730_-|capsid	phage major capsid protein, P2 family	capsid	Q778Y7	Enterobacteria_phage	71.0	1.1e-146
WP_005967828.1|3950779_3951628_-|capsid	GPO family capsid scaffolding protein	capsid	Q6K1I7	Salmonella_virus	65.3	5.3e-93
WP_005967837.1|3954597_3955344_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005967839.1|3955345_3956164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005967841.1|3956408_3956630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005967843.1|3956788_3957127_-	hypothetical protein	NA	H9C172	Pectobacterium_phage	61.7	2.2e-34
WP_005967844.1|3957119_3957317_-	hypothetical protein	NA	Q2P9X3	Enterobacteria_phage	53.7	9.2e-09
WP_005967850.1|3959819_3960833_-	phosphoadenosine phosphosulfate reductase family protein	NA	B7SYG0	Stenotrophomonas_phage	44.9	5.9e-67
WP_005967851.1|3960829_3961054_-	TraR/DksA family transcriptional regulator	NA	Q6K1F5	Salmonella_virus	59.5	2.3e-16
WP_005967852.1|3961053_3961362_-	DUF5405 family protein	NA	NA	NA	NA	NA
WP_005967854.1|3961361_3961610_-	DUF2732 family protein	NA	A0A0F7LBR4	Escherichia_phage	59.3	2.2e-07
WP_005967856.1|3961790_3962222_-	phage regulatory CII family protein	NA	A0A218M4I4	Erwinia_phage	56.4	8.2e-42
WP_005967859.1|3962255_3962660_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043885399.1|3962740_3963628_+	phage repressor protein CI	NA	A0A0M4RE65	Salmonella_phage	48.7	9.2e-72
WP_039477149.1|3963638_3964115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005967863.1|3964139_3964997_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005967865.1|3965199_3965535_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005967869.1|3967086_3967452_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
3965660:3965679	attR	GTATTCAGTCTTTTTTTATA	NA	NA	NA	NA
WP_005967870.1|3967528_3967903_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152413517.1|3968318_3968522_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005967874.1|3968663_3968876_+	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	75.7	7.1e-23
WP_071531091.1|3969106_3969415_-	excalibur calcium-binding domain-containing protein	NA	NA	NA	NA	NA
WP_005967878.1|3969956_3971024_+	malate/lactate/ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_069704152.1|3971250_3972483_-	SEL1-like repeat protein	NA	NA	NA	NA	NA
WP_005968959.1|3972696_3972888_-	YebW family protein	NA	NA	NA	NA	NA
WP_039477127.1|3973012_3974467_-	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_005968953.1|3977236_3978523_-	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_005968951.1|3978802_3979309_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_005968949.1|3979393_3980167_+	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_005968946.1|3980186_3982202_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	34.8	7.6e-90
WP_005968945.1|3982320_3983187_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005968943.1|3983231_3983864_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_005968941.1|3984071_3985115_-	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
WP_005968939.1|3985195_3985972_-	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
WP_005968937.1|3985968_3986829_-	spermidine/putrescine ABC transporter permease PotB	NA	NA	NA	NA	NA
WP_005968935.1|3986812_3987928_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	G3M9Y6	Bacillus_virus	36.4	6.4e-30
WP_005968933.1|3988310_3989543_+	peptidase T	NA	NA	NA	NA	NA
WP_005968932.1|3989621_3990743_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_005968930.1|3990878_3992339_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_005968929.1|3992335_3993025_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_005968927.1|3993259_3994630_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	45.3	1.3e-109
WP_005968926.1|3994778_3995414_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_071531106.1|3995416_3996577_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 7
NZ_CP015750	Pectobacterium wasabiae CFBP 3304 chromosome, complete genome	5043228	4018025	4028021	5043228	tRNA	Tupanvirus(33.33%)	11	NA	NA
WP_005968901.1|4018025_4019954_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.6	6.7e-128
WP_011093973.1|4019956_4020499_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.5	2.8e-15
WP_005968897.1|4020612_4020810_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_005968887.1|4020853_4021210_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_152413530.1|4021282_4021375_+	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_005968885.1|4021538_4022522_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	39.3	4.5e-35
WP_005968883.1|4022536_4024924_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	28.9	3.0e-08
WP_005968881.1|4024928_4025225_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	5.5e-13
WP_039477116.1|4025295_4025754_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005968877.1|4025786_4026164_-	nitrous oxide-stimulated promoter family protein	NA	NA	NA	NA	NA
WP_005968875.1|4026302_4028021_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	31.6	4.5e-59
>prophage 8
NZ_CP015750	Pectobacterium wasabiae CFBP 3304 chromosome, complete genome	5043228	4242066	4312061	5043228	plate,tRNA,transposase	Escherichia_phage(25.0%)	42	NA	NA
WP_005968474.1|4242066_4243323_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_005968472.1|4243554_4244178_+	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_005968470.1|4244181_4245054_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_005968468.1|4245191_4246139_+	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	38.5	3.2e-46
WP_005968462.1|4246308_4246578_-	stress-induced protein YchH	NA	NA	NA	NA	NA
WP_005968460.1|4246891_4247479_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_005968457.1|4247608_4248700_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_086002453.1|4249144_4250313_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	87.5	1.6e-161
WP_005974600.1|4250765_4253426_-	DEAD/DEAH box helicase family protein	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	26.4	3.2e-35
WP_005974598.1|4253422_4260931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005974596.1|4261527_4262247_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005974594.1|4262239_4264117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005974592.1|4264085_4266173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005974590.1|4267282_4268221_+	transcriptional regulator MelR	NA	NA	NA	NA	NA
WP_172645154.1|4268457_4269858_+	Na+/H+ antiporter NhaC	NA	NA	NA	NA	NA
WP_005974584.1|4269893_4271075_+	putative C-S lyase	NA	NA	NA	NA	NA
WP_005974582.1|4271197_4272004_-	DUF2135 domain-containing protein	NA	NA	NA	NA	NA
WP_005974581.1|4272056_4273700_-	DUF2300 domain-containing protein	NA	NA	NA	NA	NA
WP_152413561.1|4273699_4278334_-	alpha-2-macroglobulin family protein	NA	NA	NA	NA	NA
WP_039479317.1|4278916_4280680_-	DUF2138 domain-containing protein	NA	NA	NA	NA	NA
WP_005974568.1|4281458_4282067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005974565.1|4282178_4282778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005974562.1|4283301_4283685_-	DUF2750 domain-containing protein	NA	NA	NA	NA	NA
WP_005974559.1|4283929_4284154_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	59.5	6.1e-17
WP_005974556.1|4284135_4284609_-|transposase	IS5/IS1182 family transposase	transposase	Q9MCT5	Escherichia_phage	66.3	2.6e-25
WP_081503823.1|4284590_4284728_+	type I addiction module toxin, SymE family	NA	NA	NA	NA	NA
WP_005974554.1|4284796_4285144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005974551.1|4285232_4285640_-	DUF2750 domain-containing protein	NA	NA	NA	NA	NA
WP_152413562.1|4290291_4291032_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_172645153.1|4291098_4291842_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_005974533.1|4293149_4294304_-	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
WP_069704154.1|4294306_4296445_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	27.2	5.3e-41
WP_005974613.1|4296492_4296903_-	DUF4150 domain-containing protein	NA	NA	NA	NA	NA
WP_005974616.1|4296912_4297518_-	DUF3540 domain-containing protein	NA	NA	NA	NA	NA
WP_005974619.1|4297530_4298601_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_005974622.1|4298597_4301138_-	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
WP_005974624.1|4301825_4302206_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069704155.1|4302214_4304422_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	26.8	5.5e-41
WP_005974356.1|4305898_4308508_-	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	28.6	7.1e-80
WP_005974354.1|4308562_4309612_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_005974353.1|4309608_4311483_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_005974351.1|4311485_4312061_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
