The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP013675	Xanthomonas oryzae pv. oryzae strain PXO236, complete genome	4968717	7736	50022	4968717	protease,transposase	Ralstonia_phage(33.33%)	38	NA	NA
WP_027704140.1|7736_8573_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_011407165.1|8759_9566_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_011257013.1|9842_11036_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_011257014.1|11189_11861_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_011257015.1|11945_12707_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_010364790.1|12753_13176_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_011257016.1|13179_13593_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_011257017.1|13888_14656_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_019301610.1|14666_14936_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257019.1|15010_16471_-	cardiolipin synthase	NA	NA	NA	NA	NA
WP_011257020.1|17117_18128_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	37.8	9.5e-49
WP_011257021.1|18399_19602_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_011407169.1|19743_21882_+	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	40.9	5.3e-65
WP_012443560.1|22092_22386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153296734.1|22417_22915_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257024.1|23161_24142_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	55.8	1.6e-88
WP_069964706.1|24189_25356_-	FMN-dependent L-lactate dehydrogenase LldD	NA	NA	NA	NA	NA
WP_011257026.1|25502_26069_-	DUF1295 domain-containing protein	NA	NA	NA	NA	NA
WP_011257028.1|27543_28761_+	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_011257029.1|29388_30411_-	sugar kinase	NA	NA	NA	NA	NA
WP_080493590.1|30991_32245_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_155296431.1|32318_33116_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_080493544.1|33103_34081_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_069964708.1|34962_35625_-	DUF938 domain-containing protein	NA	NA	NA	NA	NA
WP_044756160.1|35778_36573_-	peptidase	NA	NA	NA	NA	NA
WP_027704023.1|36740_37214_+	SRPBCC domain-containing protein	NA	NA	NA	NA	NA
WP_041182545.1|39544_40501_-|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_069964709.1|40548_41460_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011257041.1|41946_42345_-	host attachment protein	NA	NA	NA	NA	NA
WP_011257042.1|42436_43129_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027704036.1|43298_43769_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_011407233.1|45235_45547_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044756166.1|45801_46749_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.4	4.3e-43
WP_044756167.1|46889_47948_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011257048.1|48086_48368_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094187709.1|48408_48681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012443587.1|48772_48958_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069959667.1|49071_50022_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.6	4.4e-96
>prophage 2
NZ_CP013675	Xanthomonas oryzae pv. oryzae strain PXO236, complete genome	4968717	92967	135651	4968717	transposase	Acidithiobacillus_phage(33.33%)	29	NA	NA
WP_094187710.1|92967_93730_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011407202.1|93737_95462_-	AarF/ABC1/UbiB kinase family protein	NA	A0A0P0CRE2	Ostreococcus_lucimarinus_virus	28.7	1.7e-34
WP_011257102.1|95702_96644_+	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_041182540.1|96836_98201_+	glycoside hydrolase family 10 protein	NA	NA	NA	NA	NA
WP_011257104.1|98197_99826_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_027703733.1|100299_101883_+	glycogen synthase GlgA	NA	NA	NA	NA	NA
WP_044756187.1|101879_104114_+	1,4-alpha-glucan branching enzyme	NA	NA	NA	NA	NA
WP_011257107.1|104116_105874_+	malto-oligosyltrehalose trehalohydrolase	NA	NA	NA	NA	NA
WP_094187819.1|105930_107820_+	4-alpha-glucanotransferase	NA	NA	NA	NA	NA
WP_027703731.1|107816_110426_+	malto-oligosyltrehalose synthase	NA	NA	NA	NA	NA
WP_011407199.1|110448_110634_+	DUF2934 domain-containing protein	NA	NA	NA	NA	NA
WP_011257110.1|110748_112911_+	glycogen debranching protein GlgX	NA	NA	NA	NA	NA
WP_027703730.1|112927_113560_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_075244499.1|113723_114221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407197.1|114361_115408_-	methylamine utilization protein	NA	NA	NA	NA	NA
WP_041182545.1|116803_117760_+|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_115862254.1|118087_119053_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_155296432.1|120141_122544_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_080256644.1|122659_123118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027704081.1|123117_123450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257122.1|123466_123727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024743401.1|125050_126460_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_011407187.1|126808_127240_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012443638.1|127514_127850_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407184.1|128289_129579_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.2	2.1e-40
WP_012443641.1|130197_131178_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	55.0	1.0e-87
WP_012443642.1|131643_131967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044749647.1|132549_133926_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.8	5.4e-79
WP_069964713.1|134274_135651_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	56.9	8.3e-80
>prophage 3
NZ_CP013675	Xanthomonas oryzae pv. oryzae strain PXO236, complete genome	4968717	163287	217334	4968717	transposase,tRNA	Acidithiobacillus_phage(42.86%)	29	NA	NA
WP_041182661.1|163287_164253_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_115862284.1|165937_167257_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_094187711.1|170129_171197_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_011257175.1|171331_171460_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041181912.1|171402_171930_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012443681.1|172752_174936_-	1,4-alpha-glucan branching protein GlgB	NA	NA	NA	NA	NA
WP_069960129.1|174947_178298_-	maltose alpha-D-glucosyltransferase	NA	NA	NA	NA	NA
WP_069964716.1|178294_181411_-	DUF3416 domain-containing protein	NA	NA	NA	NA	NA
WP_011407587.1|183339_184374_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	32.8	8.0e-43
WP_109181928.1|184480_185446_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_094187821.1|187071_187251_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069964717.1|187270_188647_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.8	5.4e-79
WP_080494036.1|188772_189099_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080494035.1|189114_189282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044756212.1|189364_190840_+|transposase	IS5-like element ISXoo5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	67.1	1.4e-101
WP_069964717.1|191071_192448_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.8	5.4e-79
WP_012443690.1|193967_195488_-	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_011257185.1|195504_195783_-	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_011257186.1|195972_196311_+	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_012443692.1|196923_198909_+	beta-N-acetylglucosaminidase	NA	NA	NA	NA	NA
WP_011409560.1|199540_200503_+|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_011257188.1|200908_201721_+	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_011257189.1|201913_202525_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257190.1|202941_203799_-	polyamine aminopropyltransferase	NA	A0A1C9C533	Heterosigma_akashiwo_virus	31.5	2.9e-14
WP_012443696.1|204036_205923_+	arginine decarboxylase	NA	NA	NA	NA	NA
WP_044756215.1|208261_210985_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	30.2	6.3e-71
WP_155296433.1|210926_213206_+	DUF3274 domain-containing protein	NA	A0A077K801	Ralstonia_phage	28.0	1.6e-27
WP_044756216.1|213202_214894_+	DUF2875 domain-containing protein	NA	NA	NA	NA	NA
WP_012443704.1|215429_217334_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
>prophage 4
NZ_CP013675	Xanthomonas oryzae pv. oryzae strain PXO236, complete genome	4968717	253921	310897	4968717	tail,transposase	Arthrobacter_phage(25.0%)	44	NA	NA
WP_082323223.1|253921_255106_-|transposase	IS256-like element IS1113 family transposase	transposase	A0A218MNI5	uncultured_virus	45.4	1.0e-41
WP_075243816.1|255156_255828_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_044756239.1|255824_256367_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_069964721.1|256363_257167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041182545.1|257141_258098_-|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_069964722.1|258150_258984_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_011409779.1|259844_260882_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_011409777.1|262575_263421_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	26.7	3.7e-06
WP_011260788.1|263580_264786_+	aminotransferase	NA	NA	NA	NA	NA
WP_011409775.1|264838_265171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409774.1|265219_265957_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	31.1	1.5e-19
WP_042465359.1|265953_267426_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_011260784.1|267712_268894_-	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_011409772.1|268965_270249_+	ergothioneine biosynthesis protein EgtB	NA	NA	NA	NA	NA
WP_011260782.1|270245_271232_+	L-histidine N(alpha)-methyltransferase	NA	NA	NA	NA	NA
WP_011260781.1|271276_272554_-	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_011260780.1|272550_273171_-	helix-turn-helix transcriptional regulator	NA	A0A0K1LLP9	Caulobacter_phage	41.9	1.9e-07
WP_012443733.1|273313_277021_-	indolepyruvate ferredoxin oxidoreductase family protein	NA	NA	NA	NA	NA
WP_033013610.1|277215_277578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012443735.1|277674_277851_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069964724.1|278112_279030_+	AEC family transporter	NA	NA	NA	NA	NA
WP_069964725.1|279382_280015_+	ParA family protein	NA	A0A142F1W4	Mycobacterium_phage	35.4	1.2e-09
WP_011409767.1|280030_280507_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_011260773.1|280510_281083_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069964726.1|281079_283095_+	phospholipase D family protein	NA	NA	NA	NA	NA
WP_011260771.1|283386_283815_+	hotdog fold thioesterase	NA	NA	NA	NA	NA
WP_011409766.1|283934_284738_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_011260769.1|284797_285787_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_069964727.1|286200_288273_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_011409764.1|288467_289079_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_011260766.1|290232_291039_-	META domain-containing protein	NA	NA	NA	NA	NA
WP_011260765.1|291175_291973_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_011260764.1|292194_293604_+	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_011260763.1|293881_294220_+	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_094187712.1|294209_295685_+	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	32.2	2.0e-31
WP_011260761.1|295955_297011_+	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_011409760.1|297003_298431_+	nitrogen regulation protein NR(I)	NA	NA	NA	NA	NA
WP_011409759.1|299052_299532_+	superoxide dismutase family protein	NA	I3XM75	Mamestra_brassicae_nuclear_polyhedrosis_virus	40.6	6.1e-14
WP_027704180.1|299602_300235_+	superoxide dismutase family protein	NA	M1ICI8	Paramecium_bursaria_Chlorella_virus	41.0	7.8e-17
WP_109182045.1|300517_301483_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011260755.1|301570_302107_-|tail	phage tail protein	tail	A0A0U4JYA4	Arthrobacter_phage	32.1	1.2e-10
WP_011260754.1|302165_302693_-|tail	phage tail protein	tail	A0A218M5J0	Arthrobacter_phage	33.1	1.2e-15
WP_011409756.1|302761_303307_-|tail	phage tail protein	tail	A0A0U4JXW2	Arthrobacter_phage	32.9	1.9e-11
WP_044756255.1|309661_310897_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP013675	Xanthomonas oryzae pv. oryzae strain PXO236, complete genome	4968717	335928	403825	4968717	transposase,tRNA	Staphylococcus_prophage(14.29%)	43	NA	NA
WP_041182856.1|335928_336885_-|transposase	IS30-like element IS1112 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.3	6.9e-41
WP_109182069.1|336987_338307_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_155296434.1|338435_339233_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011260727.1|339266_339947_-	HTH-type transcriptional repressor FabR	NA	NA	NA	NA	NA
WP_094187714.1|340021_341116_+	ferredoxin reductase	NA	NA	NA	NA	NA
WP_011260725.1|341125_342247_+	acyl-CoA desaturase	NA	NA	NA	NA	NA
WP_113090107.1|342312_343302_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_094187715.1|343430_344194_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_082324403.1|345113_345251_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044749647.1|346208_347585_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.8	5.4e-79
WP_155296435.1|347690_348444_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011260718.1|348860_349895_-	family 43 glycosylhydrolase	NA	NA	NA	NA	NA
WP_011409728.1|349926_351414_-	MFS transporter	NA	NA	NA	NA	NA
WP_094187822.1|351512_354386_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_094187717.1|354727_356209_+	MFS transporter	NA	NA	NA	NA	NA
WP_044756273.1|357625_358603_+	endo-1,4-beta-xylanase	NA	NA	NA	NA	NA
WP_044756275.1|358643_360062_+	glucuronate isomerase	NA	NA	NA	NA	NA
WP_012443777.1|360288_361344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260709.1|362321_363794_-	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	32.1	4.5e-47
WP_011260708.1|364016_366731_-	glycoside hydrolase family 3 protein	NA	NA	NA	NA	NA
WP_011260707.1|366733_368434_-	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_011409724.1|368433_369693_-	D-galactonate dehydratase family protein	NA	Q6A202	Oenococcus_phage	26.0	3.5e-40
WP_041182560.1|369704_371669_-	9-O-acetylesterase	NA	NA	NA	NA	NA
WP_011409722.1|371665_373861_-	alpha-glucuronidase	NA	NA	NA	NA	NA
WP_011409721.1|374036_375104_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_011259480.1|375329_376667_-	xylose isomerase	NA	NA	NA	NA	NA
WP_011260702.1|377270_378188_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	62.5	3.1e-83
WP_011260701.1|378251_379157_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	32.9	3.1e-43
WP_011409719.1|379783_380569_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_011409718.1|380839_381298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075240508.1|381378_382134_-	alpha/beta hydrolase	NA	G1DB77	Mycobacterium_phage	35.2	9.7e-06
WP_011409716.1|382231_383197_-	ferrochelatase	NA	NA	NA	NA	NA
WP_011409715.1|383351_384254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003484969.1|384326_384554_+	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_044756277.1|384569_385211_+	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
WP_011260694.1|385207_385963_+	twin-arginine translocase subunit TatC	NA	NA	NA	NA	NA
WP_012443793.1|386114_387014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409712.1|387073_387826_-	glutamine amidotransferase	NA	NA	NA	NA	NA
WP_109182038.1|388369_389168_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_069964729.1|389308_398092_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260689.1|398485_400300_-	type II/IV secretion system protein	NA	NA	NA	NA	NA
WP_012443796.1|400389_401298_+|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_011260687.1|401587_403825_+|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
>prophage 6
NZ_CP013675	Xanthomonas oryzae pv. oryzae strain PXO236, complete genome	4968717	538926	574657	4968717	integrase,transposase	uncultured_virus(28.57%)	20	563693:563712	574755:574774
WP_011409629.1|538926_539439_+|transposase	transposase	transposase	Q8W6R2	Burkholderia_virus	68.8	1.6e-44
WP_069964738.1|541127_545057_-	avirulence protein	NA	NA	NA	NA	NA
WP_011409622.1|548378_551066_+	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
WP_125168769.1|551255_552161_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409620.1|552157_552892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082323223.1|553116_554301_+|transposase	IS256-like element IS1113 family transposase	transposase	A0A218MNI5	uncultured_virus	45.4	1.0e-41
WP_155296436.1|554290_555413_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.5	6.9e-40
WP_011409617.1|555771_556062_-	DUF2782 domain-containing protein	NA	NA	NA	NA	NA
WP_044756337.1|556138_558940_+	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	30.4	2.4e-65
WP_011260560.1|559887_560787_-	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_011409614.1|561913_563056_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.8	5.3e-96
WP_103057293.1|563087_563351_+	xanthomonadin biosynthesis protein	NA	NA	NA	NA	NA
563693:563712	attL	AGTCGCCCCTGAAAAACCCC	NA	NA	NA	NA
WP_044756339.1|565174_566050_+|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	48.2	1.2e-55
WP_044756340.1|566280_568119_-	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
WP_011409612.1|568293_568560_+	proteinase inhibitor	NA	NA	NA	NA	NA
WP_011409611.1|568585_569131_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_012443910.1|569602_570910_+	MFS transporter	NA	NA	NA	NA	NA
WP_011409609.1|571048_572308_+	HD-GYP domain-containing protein	NA	NA	NA	NA	NA
WP_027703952.1|572736_573270_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_044756341.1|573280_574657_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	54.8	8.6e-77
574755:574774	attR	GGGGTTTTTCAGGGGCGACT	NA	NA	NA	NA
>prophage 7
NZ_CP013675	Xanthomonas oryzae pv. oryzae strain PXO236, complete genome	4968717	587524	706128	4968717	transposase,tRNA	Staphylococcus_prophage(18.18%)	97	NA	NA
WP_011260538.1|587524_588001_+|tRNA	tRNA (cytidine(34)-2'-O)-methyltransferase	tRNA	NA	NA	NA	NA
WP_011260537.1|588342_589566_-	MFS transporter	NA	NA	NA	NA	NA
WP_011260536.1|589670_590282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012443920.1|590383_591127_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260534.1|591317_592664_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_011260533.1|592648_594091_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_033013306.1|594140_595868_-	ubiquinone-dependent pyruvate dehydrogenase	NA	NA	NA	NA	NA
WP_011260531.1|596225_596822_+	Ax21 family protein	NA	NA	NA	NA	NA
WP_011409602.1|597144_598170_-	NAD(P)-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_011260529.1|598185_598701_-	protein-export chaperone SecB	NA	NA	NA	NA	NA
WP_011260528.1|598810_599245_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_011409601.1|599320_599743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027703675.1|599771_600242_-	thioesterase	NA	NA	NA	NA	NA
WP_151420494.1|600704_601670_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_075240018.1|602194_602404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027703859.1|602413_603781_+	VOC family protein	NA	NA	NA	NA	NA
WP_011409597.1|604070_607211_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_011260521.1|607344_610593_-	MMPL family transporter	NA	NA	NA	NA	NA
WP_012443931.1|610685_611930_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_011409596.1|612189_613506_+	amidohydrolase	NA	NA	NA	NA	NA
WP_011260517.1|614264_615080_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	35.8	7.4e-36
WP_082323225.1|615547_616732_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.8	2.9e-41
WP_044756360.1|616873_618109_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011407513.1|618177_618567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069965056.1|618877_620245_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.8	5.4e-79
WP_041182545.1|620312_621269_+|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_109181928.1|621304_622270_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011407516.1|623508_624231_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.6	1.2e-16
WP_027703875.1|624241_625678_+	DUF3526 domain-containing protein	NA	NA	NA	NA	NA
WP_012443983.1|625677_626946_+	DUF3526 domain-containing protein	NA	NA	NA	NA	NA
WP_011407519.1|627035_629177_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_011407520.1|629261_629927_-	DUF2894 domain-containing protein	NA	NA	NA	NA	NA
WP_011257531.1|629923_630598_-	OmpA family protein	NA	NA	NA	NA	NA
WP_027703874.1|630594_633252_-	DUF802 domain-containing protein	NA	NA	NA	NA	NA
WP_011257533.1|633262_634012_-	DUF3348 domain-containing protein	NA	NA	NA	NA	NA
WP_011257534.1|634338_634551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257535.1|634992_635214_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075239431.1|635223_635538_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_155296437.1|635998_637318_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011260472.1|637569_639318_-	DNA primase	NA	A0A1S5RF71	Helicobacter_phage	34.5	4.2e-44
WP_012443989.1|639407_640370_-	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_094187724.1|641132_641895_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011409564.1|642663_643110_-	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	45.2	1.0e-23
WP_002808376.1|643417_643633_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_011260469.1|643912_644977_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	57.1	8.6e-101
WP_011409563.1|645055_645412_+	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_011260467.1|645639_647811_+	beta-glucosidase	NA	NA	NA	NA	NA
WP_109181928.1|648473_649439_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_044756360.1|649954_651190_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_041182297.1|651606_652569_-|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_011409560.1|653348_654311_-|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_041182296.1|655306_656485_-	PQQ-dependent sugar dehydrogenase	NA	NA	NA	NA	NA
WP_041182545.1|656651_657608_-|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_011260461.1|657717_658152_+	membrane protein	NA	NA	NA	NA	NA
WP_011260459.1|658712_658994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094187784.1|659197_659960_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_027704068.1|660019_661336_-	amino acid permease	NA	NA	NA	NA	NA
WP_011260456.1|661332_662109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041182294.1|662785_663748_-|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_094187728.1|663967_664765_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011260454.1|664920_666018_-	dipeptide epimerase	NA	NA	NA	NA	NA
WP_069965058.1|666014_667427_-	NlpC-P60 family protein	NA	NA	NA	NA	NA
WP_011260452.1|667647_668454_+	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_011260451.1|668546_669293_+	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_011260450.1|669599_669797_+	CPXCG motif-containing cysteine-rich protein	NA	NA	NA	NA	NA
WP_011260449.1|670007_670385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409547.1|670610_670952_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260447.1|671158_671599_+	EF-hand domain-containing protein	NA	NA	NA	NA	NA
WP_069964743.1|671636_672386_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_011409543.1|672523_673099_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094187851.1|673193_673841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099051302.1|673883_674681_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011260442.1|674689_675499_-	glycosyltransferase family 25 protein	NA	NA	NA	NA	NA
WP_075245927.1|675674_676478_+	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_069964745.1|676581_677559_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260439.1|677555_678821_+	porphyrin biosynthesis protein	NA	NA	NA	NA	NA
WP_041182291.1|679246_679771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260437.1|679886_681182_-	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_103073472.1|681250_682156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260435.1|682358_682739_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109182013.1|683271_684237_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_075242274.1|684869_685535_-	pyruvate dehydrogenase E1 subunit alpha	NA	NA	NA	NA	NA
WP_011260428.1|686893_687787_+	tryptophan 2,3-dioxygenase	NA	NA	NA	NA	NA
WP_011409531.1|688229_689738_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	33.6	2.9e-62
WP_011409530.1|689749_690340_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_044756380.1|690696_691185_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011409529.1|691355_692426_+	4-hydroxyphenylpyruvate dioxygenase	NA	NA	NA	NA	NA
WP_011260423.1|692790_694116_+	homogentisate 1,2-dioxygenase	NA	NA	NA	NA	NA
WP_103057261.1|694539_694878_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260422.1|695325_695679_-	Na+/H+ antiporter subunit G	NA	NA	NA	NA	NA
WP_011260421.1|695675_695960_-	K+/H+ antiporter subunit F	NA	NA	NA	NA	NA
WP_011260420.1|695956_696463_-	Na+/H+ antiporter subunit E	NA	NA	NA	NA	NA
WP_069964747.1|696459_698004_-	monovalent cation/H+ antiporter subunit D	NA	NA	NA	NA	NA
WP_041182289.1|698000_698375_-	Na+/H+ antiporter subunit C	NA	NA	NA	NA	NA
WP_069964748.1|698374_701203_-	monovalent cation/H+ antiporter subunit A	NA	NA	NA	NA	NA
WP_069964750.1|701741_702227_-	DUF962 domain-containing protein	NA	NA	NA	NA	NA
WP_011407587.1|705093_706128_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	32.8	8.0e-43
>prophage 8
NZ_CP013675	Xanthomonas oryzae pv. oryzae strain PXO236, complete genome	4968717	745344	801184	4968717	transposase,protease	Erwinia_phage(25.0%)	43	NA	NA
WP_109181887.1|745344_746107_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011409494.1|746350_747355_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044756399.1|747393_748323_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_044756400.1|748870_751759_-	insulinase family protein	NA	NA	NA	NA	NA
WP_044756401.1|752013_754638_+	PAS domain S-box protein	NA	G3MA91	Bacillus_virus	28.6	1.9e-08
WP_075240061.1|755163_755391_-	chemotaxis protein	NA	NA	NA	NA	NA
WP_012444068.1|755390_755711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069965059.1|755872_757357_-	cellulase family glycosylhydrolase	NA	H2DE45	Erwinia_phage	32.3	7.7e-47
WP_011409489.1|757564_759052_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	56.7	1.0e-123
WP_155296438.1|760326_761124_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011260378.1|761304_762954_+	M28 family peptidase	NA	NA	NA	NA	NA
WP_075240244.1|762881_763142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094187780.1|763267_764031_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_033013308.1|764757_766695_+	glucans biosynthesis glucosyltransferase MdoH	NA	NA	NA	NA	NA
WP_044756406.1|766846_767515_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_011260375.1|767519_768572_+	histidine kinase	NA	Q9EYF3	Enterobacteria_phage	33.6	1.8e-18
WP_011409485.1|768602_769340_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_011409484.1|769370_770285_+	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_011260372.1|770835_771636_-	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_011260371.1|772194_773160_+	YafY family transcriptional regulator	NA	NA	NA	NA	NA
WP_011260370.1|773268_773838_-	lipocalin family protein	NA	NA	NA	NA	NA
WP_011409482.1|774225_774537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409481.1|774604_776698_+	S9 family peptidase	NA	NA	NA	NA	NA
WP_011409480.1|776780_777212_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409479.1|777537_778722_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_027703683.1|778845_780981_+	oligopeptidase B	NA	F2Y2Z7	Organic_Lake_phycodnavirus	26.1	2.1e-29
WP_011409478.1|781353_781752_+	DUF454 domain-containing protein	NA	NA	NA	NA	NA
WP_011409477.1|781809_782046_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260363.1|782035_782890_+	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_011260362.1|782877_783558_+	DUF484 family protein	NA	NA	NA	NA	NA
WP_011409475.1|783757_784675_+	tyrosine recombinase XerC	NA	A0A142F2H8	Mycobacterium_phage	27.7	2.2e-12
WP_011260360.1|785190_785742_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_011260359.1|785889_787257_+|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A2H5BJT2	Erwinia_phage	29.1	6.2e-43
WP_011260358.1|787430_788054_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_011409473.1|788353_789073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012444089.1|789244_791257_-	M1 family metallopeptidase	NA	NA	NA	NA	NA
WP_011409471.1|791378_792269_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_011409470.1|792441_793203_-	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
WP_011409467.1|794941_796018_+	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_069964753.1|797268_797769_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011260350.1|797765_798221_+	nucleoside deaminase	NA	NA	NA	NA	NA
WP_094187721.1|799361_800160_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011257031.1|800215_801184_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
>prophage 9
NZ_CP013675	Xanthomonas oryzae pv. oryzae strain PXO236, complete genome	4968717	815275	896422	4968717	transposase	Ralstonia_phage(26.67%)	52	NA	NA
WP_011409552.1|815275_816238_-|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_044756425.1|816944_818321_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	63.2	1.9e-79
WP_109182069.1|818684_820004_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011258802.1|820140_821109_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_155296439.1|821308_822697_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011260336.1|824127_825267_+	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_011260335.1|825263_826679_+	septal ring lytic transglycosylase RlpA family protein	NA	F5B3X9	Synechococcus_phage	50.6	4.3e-15
WP_069964757.1|827179_828385_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	41.2	2.7e-66
WP_011409453.1|829450_829729_+	YbeD family protein	NA	NA	NA	NA	NA
WP_027703467.1|829716_830415_+	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_027703466.1|830429_831443_+	lipoyl synthase	NA	NA	NA	NA	NA
WP_011260328.1|831842_834026_+	PDZ domain-containing protein	NA	A0A0R6PIZ1	Moraxella_phage	31.6	2.8e-82
WP_094187848.1|834317_835172_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_011260326.1|835344_836400_+	bifunctional nicotinamide-nucleotide adenylyltransferase/Nudix hydroxylase	NA	A0A1B0V161	Roseobacter_phage	47.1	1.3e-80
WP_011409450.1|836522_837926_+	nicotinate phosphoribosyltransferase	NA	A0A218M332	Acidovorax_phage	51.5	8.1e-131
WP_012444115.1|840183_840945_+	DUF2242 domain-containing protein	NA	NA	NA	NA	NA
WP_011409446.1|841069_841450_+	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_075239460.1|841621_842959_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069964758.1|842979_843921_+	decarboxylating 6-phosphogluconate dehydrogenase	NA	M4SJX8	Cyanophage	44.6	1.7e-68
WP_011260318.1|844260_845313_-	oxidoreductase	NA	NA	NA	NA	NA
WP_011409444.1|845472_845835_+	BON domain-containing protein	NA	NA	NA	NA	NA
WP_011409443.1|846120_847932_+	PAS domain S-box protein	NA	A0A2K9L0Z8	Tupanvirus	28.3	3.5e-09
WP_011260315.1|847928_848369_+	response regulator	NA	NA	NA	NA	NA
WP_011260314.1|848372_849875_+	hybrid sensor histidine kinase/response regulator	NA	A0A2K9L5I4	Tupanvirus	26.2	1.1e-08
WP_011260313.1|849966_850482_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_011409442.1|850650_851388_-	pteridine reductase	NA	NA	NA	NA	NA
WP_011260311.1|851455_852640_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_069964760.1|854719_857410_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011260306.1|857560_860458_+	glycoside hydrolase family 2 protein	NA	L0N6M2	Herpes_simplex_virus	25.2	8.8e-23
WP_069964761.1|860454_862902_+	alpha-N-acetylglucosaminidase	NA	NA	NA	NA	NA
WP_011409433.1|863059_864226_+	DUF1624 domain-containing protein	NA	NA	NA	NA	NA
WP_044756432.1|864440_865208_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_027703724.1|865252_866530_+	sugar MFS transporter	NA	NA	NA	NA	NA
WP_012444129.1|866570_867638_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_011260300.1|867644_868673_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_044756434.1|868675_869830_+	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
WP_069959998.1|870249_870855_-	poly-beta-1,6-N-acetyl-D-glucosamine biosynthesis protein PgaD	NA	NA	NA	NA	NA
WP_011260297.1|870851_872105_-	poly-beta-1,6 N-acetyl-D-glucosamine synthase	NA	NA	NA	NA	NA
WP_011409429.1|872106_874005_-	poly-beta-1,6-N-acetyl-D-glucosamine N-deacetylase PgaB	NA	NA	NA	NA	NA
WP_011409428.1|874006_876049_-	poly-beta-1,6 N-acetyl-D-glucosamine export porin PgaA	NA	NA	NA	NA	NA
WP_012444134.1|876672_876903_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109182013.1|877364_878330_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_094187715.1|882338_883101_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011260292.1|883934_885167_-	multifunctional CCA addition/repair protein	NA	K4IEX3	Salmonella_phage	41.7	2.0e-72
WP_144408318.1|885731_886076_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_094187777.1|886813_887611_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_094187763.1|887665_888463_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_012444143.1|889395_889662_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_011259046.1|889881_890850_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.9e-99
WP_011258802.1|891555_892524_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_044756446.1|892736_895310_-	pyridoxal-phosphate dependent enzyme	NA	NA	NA	NA	NA
WP_011409419.1|895432_896422_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.2	7.5e-99
>prophage 10
NZ_CP013675	Xanthomonas oryzae pv. oryzae strain PXO236, complete genome	4968717	1167040	1238496	4968717	transposase	Leptospira_phage(13.33%)	56	NA	NA
WP_044757331.1|1167040_1168099_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	42.6	2.7e-70
WP_082322974.1|1168916_1169873_+|transposase	IS30-like element IS1112 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.4	3.1e-41
WP_011409252.1|1171273_1172359_-	DUF3396 domain-containing protein	NA	E5E3X8	Burkholderia_phage	37.9	4.0e-61
WP_044756504.1|1172355_1173426_-	DUF3396 domain-containing protein	NA	E5E3X8	Burkholderia_phage	36.6	9.7e-60
WP_011260011.1|1173433_1174129_-	VRR-NUC domain-containing protein	NA	Q8W6S1	Burkholderia_virus	46.1	2.8e-36
WP_011260010.1|1174125_1174575_-	hypothetical protein	NA	A4JWV5	Burkholderia_virus	34.1	3.3e-09
WP_069965063.1|1174904_1177859_-	aminomethyl-transferring glycine dehydrogenase	NA	M4QFZ1	Prochlorococcus_phage	50.1	8.1e-258
WP_027703308.1|1178326_1178509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027703307.1|1178939_1179743_+	sulfotransferase	NA	M4QPS9	Synechococcus_phage	27.3	4.5e-25
WP_033013179.1|1179831_1181043_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_011409245.1|1181039_1183199_+	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	28.0	5.7e-35
WP_011260005.1|1184540_1184945_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012444312.1|1185026_1187045_-	M2 family metallopeptidase	NA	NA	NA	NA	NA
WP_011409242.1|1187156_1188827_-	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_011409241.1|1188823_1189588_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_027703306.1|1189687_1191421_-	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_011409239.1|1191639_1192356_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	33.9	1.4e-22
WP_027703305.1|1192348_1193641_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_027703304.1|1193792_1194284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003484370.1|1194352_1194610_-	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_012444318.1|1194612_1195422_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_027703303.1|1195457_1196198_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_011259995.1|1196202_1196799_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_094187763.1|1197042_1197841_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011259994.1|1197895_1199092_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_010371538.1|1199091_1199733_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_011259992.1|1200083_1201265_+	polyketide cyclase	NA	NA	NA	NA	NA
WP_011259991.1|1201328_1201733_+	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_011259990.1|1201735_1202410_+	DNA-3-methyladenine glycosylase 2 family protein	NA	NA	NA	NA	NA
WP_011259989.1|1202473_1203271_-	D-alanyl-D-alanine carboxypeptidase family protein	NA	NA	NA	NA	NA
WP_011259988.1|1203401_1203581_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_011259987.1|1203577_1203862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409230.1|1204478_1205681_+	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_011259984.1|1205880_1206417_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_153303321.1|1206504_1206660_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409229.1|1206697_1207438_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259982.1|1207637_1208516_+	M15 family metallopeptidase	NA	A8ATW4	Listeria_phage	35.5	1.3e-06
WP_011409228.1|1208625_1208886_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_059317431.1|1208945_1210427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069964588.1|1210442_1214180_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_011259979.1|1214176_1215160_+	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
WP_069964784.1|1215156_1215975_+	OmpA family protein	NA	NA	NA	NA	NA
WP_011409224.1|1216027_1217101_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_069965064.1|1218086_1221026_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	28.8	1.5e-54
WP_069964785.1|1221012_1224078_+	DNA repair protein	NA	NA	NA	NA	NA
WP_044756518.1|1224225_1225185_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	NA	NA	NA	NA
WP_082323229.1|1225252_1225819_+	DNA repair protein	NA	NA	NA	NA	NA
WP_059317432.1|1225875_1226832_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A075BSL8	Microcystis_phage	33.7	8.2e-18
WP_069964787.1|1227017_1229687_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	28.3	3.9e-41
WP_044756525.1|1229683_1230508_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_069964788.1|1230500_1231115_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_094187763.1|1231588_1232386_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_044757342.1|1232976_1233525_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_069964789.1|1233524_1235756_+	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_011259961.1|1235736_1236126_+	DUF2345 domain-containing protein	NA	NA	NA	NA	NA
WP_113090160.1|1237393_1238496_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.9	4.5e-44
>prophage 11
NZ_CP013675	Xanthomonas oryzae pv. oryzae strain PXO236, complete genome	4968717	1258741	1507185	4968717	plate,transposase,protease,tRNA	Ralstonia_phage(11.76%)	177	NA	NA
WP_011409203.1|1258741_1259230_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_069959967.1|1259232_1261068_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_011259940.1|1261031_1262123_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_069964791.1|1262208_1264938_+	type VI secretion system ATPase TssH	NA	A0A223W0B1	Agrobacterium_phage	29.5	1.6e-90
WP_011259938.1|1264968_1265322_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069964792.1|1265414_1268177_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	27.2	8.1e-42
WP_080493966.1|1268118_1269024_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_069964794.1|1269042_1271901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069964795.1|1271909_1272941_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082323163.1|1272852_1274796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069970072.1|1275130_1276087_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	4.8e-42
WP_155296468.1|1276178_1276883_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082323231.1|1277367_1279380_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069963889.1|1279382_1280408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082323164.1|1280319_1282263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069964798.1|1282271_1283306_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082323165.1|1283217_1285161_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069964799.1|1285172_1286189_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082323166.1|1286482_1287238_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_047340450.1|1287960_1288224_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069964800.1|1288230_1288539_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_069965068.1|1288572_1289976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069960250.1|1289965_1291510_-	type I restriction-modification system subunit M	NA	A0A220A2U5	Liberibacter_phage	23.9	1.5e-13
WP_041182233.1|1291556_1292555_-	Abi family protein	NA	NA	NA	NA	NA
WP_069965069.1|1292694_1296168_-	type I restriction-modification system endonuclease	NA	A0A1B1IW48	uncultured_Mediterranean_phage	22.1	8.7e-09
WP_044756557.1|1296748_1297057_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_011409181.1|1297109_1298102_+	restriction endonuclease	NA	A0A1B1IUE7	uncultured_Mediterranean_phage	29.2	1.5e-30
WP_069960304.1|1298404_1299934_+	SAM-dependent DNA methyltransferase	NA	A0A2H4PQP4	Staphylococcus_phage	29.1	1.3e-44
WP_044756558.1|1299944_1300379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113090122.1|1300794_1301946_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_069964801.1|1301945_1305125_+	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	30.8	1.7e-75
WP_011409172.1|1305403_1305670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069964802.1|1305918_1307493_-	serine/threonine protein kinase	NA	NA	NA	NA	NA
WP_041182227.1|1307901_1308678_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027704159.1|1309006_1309762_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409168.1|1309822_1310452_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011409167.1|1310666_1311446_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_143690655.1|1312372_1312567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409165.1|1312960_1313386_-	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A1B3AYM0	Gordonia_phage	48.5	5.8e-08
WP_011259911.1|1313395_1313617_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_011259910.1|1313766_1314372_+	repressor LexA	NA	A0A1W6JNS2	Morganella_phage	39.2	8.6e-13
WP_082348427.1|1314421_1315024_+	translesion DNA synthesis-associated protein ImuA	NA	NA	NA	NA	NA
WP_011259908.1|1315033_1316452_+	DNA polymerase Y family protein	NA	NA	NA	NA	NA
WP_094187840.1|1316687_1319885_+	error-prone DNA polymerase	NA	A0A1B1PA77	Streptomyces_phage	24.8	1.7e-80
WP_027704156.1|1320195_1321014_+	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_011259904.1|1321126_1322524_-	endoproteinase ArgC	NA	NA	NA	NA	NA
WP_011259903.1|1322952_1324923_+	oligopeptide transporter, OPT family	NA	NA	NA	NA	NA
WP_027704154.1|1326047_1326893_+	transporter	NA	NA	NA	NA	NA
WP_027704153.1|1327159_1329280_+	S9 family peptidase	NA	NA	NA	NA	NA
WP_011409154.1|1331394_1331856_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259895.1|1331987_1332713_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_011259894.1|1333559_1335701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069964803.1|1335817_1337950_+	outer protein P	NA	NA	NA	NA	NA
WP_042465674.1|1338177_1339416_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259891.1|1340241_1342347_-	catalase	NA	A0A2K9L572	Tupanvirus	48.1	5.1e-137
WP_155296440.1|1343460_1344780_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011258802.1|1344929_1345898_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_082323169.1|1346031_1347012_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_044756568.1|1347149_1349990_+	DUF2339 domain-containing protein	NA	NA	NA	NA	NA
WP_011409146.1|1349986_1351345_+	DUF3999 domain-containing protein	NA	NA	NA	NA	NA
WP_027704219.1|1351678_1352854_+	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_011259886.1|1352850_1353495_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_011409145.1|1353751_1355218_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_011259884.1|1355807_1356812_+	fructose-bisphosphate aldolase class I	NA	A0A0K0KVJ8	Prochlorococcus_phage	48.2	3.9e-79
WP_041182225.1|1357013_1357553_-	O-acetyl-ADP-ribose deacetylase	NA	A0A0K1L687	Scale_drop_disease_virus	42.6	9.9e-29
WP_011259882.1|1357748_1358255_-	isoprenylcysteine carboxylmethyltransferase family protein	NA	NA	NA	NA	NA
WP_011259881.1|1358561_1359521_-	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	49.0	3.8e-79
WP_075240596.1|1359537_1360743_-	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_044756573.1|1360910_1361894_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_044756574.1|1361904_1362186_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012445617.1|1363255_1364452_-	GAF domain-containing sensor histidine kinase	NA	NA	NA	NA	NA
WP_012445616.1|1364774_1365212_+	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
WP_011259875.1|1365349_1367410_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_012445614.1|1367409_1369002_+	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_044756578.1|1369137_1369863_-	phosphoadenylyl-sulfate reductase	NA	NA	NA	NA	NA
WP_075240493.1|1369859_1371581_-	assimilatory sulfite reductase (NADPH) hemoprotein subunit	NA	NA	NA	NA	NA
WP_011409142.1|1371689_1373537_-	assimilatory sulfite reductase (NADPH) flavoprotein subunit	NA	NA	NA	NA	NA
WP_011259870.1|1373717_1374626_+	sulfate adenylyltransferase subunit CysD	NA	NA	NA	NA	NA
WP_011409141.1|1374625_1376602_+	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	30.6	5.6e-29
WP_011409140.1|1377036_1378107_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_011259867.1|1378103_1381229_+	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.8	7.0e-74
WP_041182725.1|1381580_1384250_+	M1 family metallopeptidase	NA	A0A0P0IY26	Acinetobacter_phage	48.3	1.8e-240
WP_033013519.1|1386789_1386927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069964805.1|1387442_1388354_+	RNA methyltransferase	NA	NA	NA	NA	NA
WP_069964806.1|1390815_1391781_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_012445603.1|1392583_1393006_-	large-conductance mechanosensitive channel protein MscL	NA	NA	NA	NA	NA
WP_011259859.1|1393066_1393780_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_011407237.1|1395176_1396133_-|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
WP_011259856.1|1397741_1398017_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409127.1|1398276_1398618_+	Rieske (2Fe-2S) protein	NA	NA	NA	NA	NA
WP_011259854.1|1398675_1400538_-	SLC13 family permease	NA	NA	NA	NA	NA
WP_011259853.1|1400613_1401372_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_011409125.1|1401673_1402468_-	thiazole synthase	NA	NA	NA	NA	NA
WP_011259851.1|1403003_1403204_-	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_012445601.1|1403394_1405179_+	autotransporter domain-containing esterase	NA	NA	NA	NA	NA
WP_027704094.1|1409644_1410037_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409118.1|1410127_1410520_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_094187763.1|1410552_1411351_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_094187715.1|1412222_1412985_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_082323171.1|1412982_1413366_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011409560.1|1413369_1414332_-|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_115840192.1|1414441_1415407_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011258803.1|1415551_1416520_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.5e-99
WP_011409116.1|1417070_1419203_-	glycogen debranching protein GlgX	NA	NA	NA	NA	NA
WP_094187771.1|1419512_1420276_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_155296441.1|1420400_1421366_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011258802.1|1421891_1422860_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011407913.1|1423196_1424411_+|transposase	IS4-like element ISXo14 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	1.8e-54
WP_115862264.1|1424498_1425818_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011259831.1|1425908_1426100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409111.1|1426067_1427081_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_011259829.1|1427114_1427348_-	DUF378 domain-containing protein	NA	NA	NA	NA	NA
WP_044756598.1|1427821_1428115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094187715.1|1428724_1429488_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_109181988.1|1429612_1430578_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011409108.1|1430877_1431327_-	DUF4442 domain-containing protein	NA	NA	NA	NA	NA
WP_012445586.1|1431582_1432440_-	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	41.8	1.3e-11
WP_011259826.1|1432644_1433256_+	DUF998 domain-containing protein	NA	NA	NA	NA	NA
WP_011259825.1|1433328_1435971_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	39.7	2.7e-172
WP_011409105.1|1436484_1437120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259823.1|1437142_1438171_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_027703805.1|1438167_1439067_+	nicotinate-nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_011259822.1|1439123_1439540_+	ribosome silencing factor	NA	NA	NA	NA	NA
WP_011259821.1|1439551_1440667_+	J domain-containing protein	NA	NA	NA	NA	NA
WP_011259820.1|1440992_1441202_-	DUF839 domain-containing protein	NA	NA	NA	NA	NA
WP_011409102.1|1441756_1442227_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_103073422.1|1442516_1443332_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_012445578.1|1443642_1446756_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_094187763.1|1447054_1447853_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011258802.1|1448137_1449106_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_155296442.1|1449305_1450622_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011259816.1|1450713_1451448_-	SIMPL domain-containing protein	NA	NA	NA	NA	NA
WP_011409098.1|1451586_1452159_+	Maf-like protein	NA	NA	NA	NA	NA
WP_011259814.1|1452158_1453658_+	ribonuclease G	NA	NA	NA	NA	NA
WP_044756607.1|1453805_1457726_+	TIGR02099 family protein	NA	NA	NA	NA	NA
WP_044749647.1|1458143_1459520_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.8	5.4e-79
WP_011259808.1|1460101_1461547_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_044756609.1|1461803_1462385_-	ribosome-associated protein	NA	NA	NA	NA	NA
WP_012445571.1|1462530_1463898_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_069959944.1|1463894_1464215_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012445570.1|1464187_1464376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027704198.1|1464427_1464892_+	DUF4870 domain-containing protein	NA	NA	NA	NA	NA
WP_011259803.1|1466738_1467614_-	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_011259802.1|1467615_1467876_-	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_011259801.1|1467907_1469212_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_011259800.1|1469245_1470952_-	alkaline phosphatase	NA	NA	NA	NA	NA
WP_041182214.1|1471095_1472415_+	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_011259797.1|1473528_1474020_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_011259796.1|1474227_1474977_-	C40 family peptidase	NA	A0A0K2SUC1	Clostridium_phage	38.5	1.2e-19
WP_027704197.1|1475086_1475623_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	40.5	3.2e-19
WP_011259794.1|1475733_1476213_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_011409085.1|1476440_1477685_+	DUF418 domain-containing protein	NA	NA	NA	NA	NA
WP_011409084.1|1477692_1478943_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_044756618.1|1480226_1481189_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011409081.1|1481626_1482034_+	methylated-DNA--protein-cysteine methyltransferase	NA	NA	NA	NA	NA
WP_012445555.1|1482074_1482773_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_011259787.1|1483043_1485059_-	M13 family metallopeptidase	NA	NA	NA	NA	NA
WP_011259785.1|1486446_1487298_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_011259784.1|1487390_1487960_+	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	70.1	2.6e-72
WP_011259783.1|1487994_1488180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259782.1|1488796_1488964_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409078.1|1488991_1489426_-	HIT family protein	NA	NA	NA	NA	NA
WP_011409077.1|1489422_1489998_-	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_044756621.1|1490260_1491661_+	30S ribosomal protein S12 methylthiotransferase RimO	NA	NA	NA	NA	NA
WP_029217681.1|1491782_1492289_-	transcription elongation factor GreB	NA	NA	NA	NA	NA
WP_153296738.1|1492399_1492687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082323175.1|1493204_1494068_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.6	6.5e-30
WP_041182211.1|1495278_1496862_+	transglycosylase SLT domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	31.5	4.2e-11
WP_011409071.1|1497412_1498261_-	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_011259773.1|1498257_1498908_-	SCO family protein	NA	NA	NA	NA	NA
WP_011259772.1|1498988_1499915_+	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_011259771.1|1499925_1501029_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	40.4	1.6e-73
WP_011409070.1|1501021_1502095_+	D-glycerate dehydrogenase	NA	M1HTA3	Paramecium_bursaria_Chlorella_virus	23.2	2.1e-14
WP_011259769.1|1502179_1503205_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_113085532.1|1503771_1505838_+	ferrous iron transporter B	NA	NA	NA	NA	NA
WP_053502465.1|1505834_1506242_+	VOC family protein	NA	NA	NA	NA	NA
WP_053502464.1|1506411_1507185_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
>prophage 12
NZ_CP013675	Xanthomonas oryzae pv. oryzae strain PXO236, complete genome	4968717	1577563	1664651	4968717	transposase,tRNA	Geobacillus_virus(14.29%)	60	NA	NA
WP_011259703.1|1577563_1579942_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_002811076.1|1579963_1580263_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	38.9	4.7e-12
WP_005995911.1|1580243_1580600_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_094187838.1|1581265_1581907_+	polysaccharide export protein	NA	NA	NA	NA	NA
WP_027704192.1|1581888_1583328_+	GumC family protein	NA	NA	NA	NA	NA
WP_011409041.1|1583571_1585026_+	undecaprenyl-phosphate glucose phosphotransferase	NA	NA	NA	NA	NA
WP_011259699.1|1585108_1586410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259698.1|1586406_1587498_+	acyltransferase family protein	NA	NA	NA	NA	NA
WP_094187837.1|1587514_1588591_+	acyltransferase family protein	NA	NA	NA	NA	NA
WP_011259696.1|1588658_1589801_+	GDP-mannose:cellobiosyl-diphosphopolyprenol alpha-mannosyltransferase	NA	NA	NA	NA	NA
WP_011259695.1|1589797_1590847_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_011409038.1|1590864_1592358_+	lipopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_011259693.1|1592422_1593619_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_011259692.1|1593655_1594450_+	polysaccharide pyruvyl transferase family protein	NA	A0A1V0SAR6	Catovirus	36.0	6.0e-22
WP_012445463.1|1594457_1595249_+	WecB/TagA/CpsF family glycosyltransferase	NA	NA	NA	NA	NA
WP_011259690.1|1595283_1595745_+	cupin domain-containing protein	NA	A0A291AU44	Pandoravirus	40.0	6.3e-16
WP_011259689.1|1595854_1596835_+	TraB/GumN family protein	NA	NA	NA	NA	NA
WP_041182468.1|1596952_1598035_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_153296739.1|1598293_1598449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024743012.1|1600825_1601362_-	lipocalin family protein	NA	A0A2I2L3Z7	Orpheovirus	33.8	4.0e-14
WP_094187768.1|1602875_1603901_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_094187763.1|1604044_1604842_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_044756654.1|1604829_1605318_-	BrxE family protein	NA	NA	NA	NA	NA
WP_011259682.1|1605349_1605670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409027.1|1606004_1606604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259680.1|1606600_1607524_+	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_033013473.1|1607603_1607852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259679.1|1608539_1608782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259678.1|1609206_1609716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409018.1|1612622_1614245_+	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_027703322.1|1614609_1614888_-	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_011259671.1|1614911_1615985_-	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_027703321.1|1616463_1618080_-	signal recognition particle-docking protein FtsY	NA	NA	NA	NA	NA
WP_011409015.1|1618284_1619001_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_011409014.1|1619158_1620097_+	hydroxyproline-2-epimerase	NA	NA	NA	NA	NA
WP_011259667.1|1620096_1621359_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011259666.1|1621355_1621601_+	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_011259665.1|1621572_1622907_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_044756657.1|1622903_1623812_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_044756659.1|1624022_1625639_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_044756660.1|1625635_1626835_+	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_069964818.1|1626952_1628785_+	DUF885 family protein	NA	NA	NA	NA	NA
WP_044756662.1|1628781_1630647_+	DUF885 family protein	NA	NA	NA	NA	NA
WP_044757373.1|1630709_1632296_+	amino acid permease	NA	NA	NA	NA	NA
WP_044756663.1|1632285_1634625_+	S9 family peptidase	NA	NA	NA	NA	NA
WP_027703320.1|1634621_1634909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044756665.1|1634964_1635156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_147212893.1|1635152_1635362_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044756671.1|1635998_1636343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409006.1|1636339_1636636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069960239.1|1636842_1638414_-	S8/S53 family peptidase	NA	A0A1V0SLL0	Klosneuvirus	37.6	2.3e-70
WP_069965074.1|1638877_1641235_+	Tat pathway signal protein	NA	NA	NA	NA	NA
WP_094187767.1|1641735_1644573_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	26.1	2.4e-49
WP_069964819.1|1644811_1649176_+	carbohydrate-binding protein	NA	NA	NA	NA	NA
WP_033013184.1|1649172_1650759_+	family 43 glycosylhydrolase	NA	NA	NA	NA	NA
WP_011259647.1|1651072_1653418_+	S9 family peptidase	NA	NA	NA	NA	NA
WP_044756683.1|1658266_1660642_+	glycoside hydrolase family 127 protein	NA	NA	NA	NA	NA
WP_094187766.1|1660756_1661555_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_115862265.1|1662394_1663360_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_041182545.1|1663694_1664651_+|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
>prophage 13
NZ_CP013675	Xanthomonas oryzae pv. oryzae strain PXO236, complete genome	4968717	1672346	1732364	4968717	plate,transposase	Ralstonia_phage(50.0%)	47	NA	NA
WP_129215594.1|1672346_1673312_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_041182195.1|1673676_1673856_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044756692.1|1674295_1675258_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011408980.1|1675510_1676494_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.2	7.5e-99
WP_011408979.1|1676933_1677191_+	stress-induced protein	NA	NA	NA	NA	NA
WP_012443979.1|1678489_1679725_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_069964822.1|1680481_1681252_-	4'-phosphopantetheinyl transferase superfamily protein	NA	NA	NA	NA	NA
WP_044756695.1|1681621_1682914_+	nucleotide sugar dehydrogenase	NA	NA	NA	NA	NA
WP_011259625.1|1682897_1684160_-	TIGR03862 family flavoprotein	NA	NA	NA	NA	NA
WP_011408975.1|1684171_1684603_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_011408974.1|1684661_1685027_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408973.1|1685126_1685888_+	sulfurtransferase	NA	NA	NA	NA	NA
WP_012445389.1|1686109_1686757_+	response regulator	NA	NA	NA	NA	NA
WP_094187765.1|1686860_1687623_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_069964823.1|1688149_1691869_-	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
WP_011259619.1|1692279_1693266_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_041182194.1|1693298_1695089_-	DUF3300 domain-containing protein	NA	NA	NA	NA	NA
WP_011408968.1|1695437_1695698_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408967.1|1695724_1695958_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259617.1|1695973_1696396_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_011408966.1|1696392_1696749_-	4a-hydroxytetrahydrobiopterin dehydratase	NA	NA	NA	NA	NA
WP_011408965.1|1696837_1697437_+	NfuA family Fe-S biogenesis protein	NA	NA	NA	NA	NA
WP_069964824.1|1697450_1699280_+	transmembrane repetitive protein	NA	NA	NA	NA	NA
WP_044756697.1|1699937_1702772_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042465604.1|1702802_1703546_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069964825.1|1703572_1705915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069965075.1|1705943_1706690_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069964826.1|1706707_1708699_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041182545.1|1708751_1709708_+|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_012443979.1|1709727_1710963_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011257031.1|1711111_1712080_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_109182069.1|1712279_1713599_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_024711387.1|1714915_1715422_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_069964827.1|1715414_1716929_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_014503451.1|1717028_1717532_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_011259604.1|1717567_1718401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259603.1|1718388_1718892_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_012444494.1|1718895_1720773_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_044756708.1|1720736_1721747_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_014503448.1|1721779_1724485_+	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	29.3	1.5e-80
WP_027703476.1|1724673_1725171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041182719.1|1725211_1726168_-|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.8	3.7e-42
WP_011408952.1|1726400_1726859_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012444497.1|1727123_1729061_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	28.6	3.4e-39
WP_011408951.1|1729069_1729609_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069964828.1|1729605_1731030_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_027703478.1|1731026_1732364_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 14
NZ_CP013675	Xanthomonas oryzae pv. oryzae strain PXO236, complete genome	4968717	1841134	1851339	4968717	tRNA	Pseudomonas_phage(28.57%)	10	NA	NA
WP_011408886.1|1841134_1842811_+	2-polyprenylphenol 6-hydroxylase	NA	E5EQ95	Micromonas_sp._RCC1109_virus	27.2	3.3e-38
WP_011408885.1|1842899_1843541_+	transcriptional repressor LexA	NA	A0A1W6JNS2	Morganella_phage	40.2	2.4e-13
WP_011408884.1|1843713_1844748_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	60.7	6.2e-112
WP_012444556.1|1845050_1845539_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_011259507.1|1845640_1848289_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	39.6	3.7e-84
WP_003481884.1|1848428_1848641_+	carbon storage regulator CsrA	NA	J7I430	Pseudomonas_phage	76.5	1.3e-13
WP_103057240.1|1849366_1849771_+	helix-turn-helix domain-containing protein	NA	A0A1W6JTD5	Pseudomonas_phage	56.6	1.1e-32
WP_012444559.1|1850158_1850458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109181974.1|1850480_1850708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408881.1|1850643_1851339_+	hypothetical protein	NA	E5DV83	Deep-sea_thermophilic_phage	41.0	5.6e-16
>prophage 15
NZ_CP013675	Xanthomonas oryzae pv. oryzae strain PXO236, complete genome	4968717	1878851	1938203	4968717	transposase,tRNA	Staphylococcus_prophage(23.08%)	44	NA	NA
WP_069964837.1|1878851_1879826_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.3	6.4e-34
WP_069960338.1|1879894_1880260_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259476.1|1881152_1881719_-	elongation factor P-like protein YeiP	NA	NA	NA	NA	NA
WP_011259475.1|1881840_1882611_-	SDR family NAD(P)-dependent oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.5	3.4e-14
WP_011408867.1|1882749_1883646_-	hydroxymethylglutaryl-CoA lyase	NA	A0A1V0SKU2	Klosneuvirus	32.7	8.5e-33
WP_011259473.1|1883716_1884106_-	VOC family protein	NA	NA	NA	NA	NA
WP_011259472.1|1884102_1884900_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_011408865.1|1885014_1885263_+	ferrous iron transport protein A	NA	NA	NA	NA	NA
WP_011408864.1|1885259_1887119_+	ferrous iron transporter B	NA	NA	NA	NA	NA
WP_011259469.1|1887120_1887375_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408863.1|1887434_1887659_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259467.1|1887686_1887995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259466.1|1888228_1889431_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_011259465.1|1889427_1890147_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_094187715.1|1890199_1890962_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_059317447.1|1891372_1892089_+	4-hydroxy-tetrahydrodipicolinate reductase	NA	NA	NA	NA	NA
WP_011259464.1|1892328_1893453_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.2	7.8e-44
WP_012444585.1|1893452_1893896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259463.1|1893904_1897147_+	carbamoyl-phosphate synthase large subunit	NA	NA	NA	NA	NA
WP_011408858.1|1897143_1897620_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_069964838.1|1897636_1898566_+	phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_069964839.1|1898562_1900302_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	27.8	1.0e-42
WP_011407237.1|1902354_1903311_+|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
WP_011408855.1|1903420_1903798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259457.1|1903958_1904660_-|transposase	DDE transposase	transposase	A9YX10	Burkholderia_phage	32.9	1.9e-16
WP_027703619.1|1907467_1908415_+	LytTR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014503214.1|1908668_1909793_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.7	9.4e-05
WP_044756749.1|1909997_1911515_+|tRNA	lysine--tRNA ligase	tRNA	A0A2K9KZX5	Tupanvirus	39.9	2.3e-86
WP_011408849.1|1911656_1912793_+	two-component system response regulator	NA	NA	NA	NA	NA
WP_011259451.1|1913157_1915335_+	response regulator	NA	A0A1V0SGX0	Hokovirus	32.8	3.0e-47
WP_011408848.1|1915346_1916216_-	crotonase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_011259449.1|1916392_1918075_-	long-chain fatty acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	26.8	7.1e-33
WP_011259446.1|1918724_1921493_-	aconitate hydratase AcnA	NA	NA	NA	NA	NA
WP_003486316.1|1921640_1921889_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_011259444.1|1921885_1922296_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_012444596.1|1922361_1924953_+	bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase	NA	NA	NA	NA	NA
WP_011259442.1|1925306_1926122_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_011408846.1|1926777_1929021_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_011259440.1|1929129_1930206_-	chemotaxis response regulator protein-glutamate methylesterase	NA	NA	NA	NA	NA
WP_011259439.1|1930202_1930799_-	chemoreceptor glutamine deamidase CheD	NA	NA	NA	NA	NA
WP_011408845.1|1930795_1931662_-	chemotaxis protein CheR	NA	NA	NA	NA	NA
WP_082323233.1|1934206_1935241_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	32.6	5.2e-42
WP_011408843.1|1935497_1935803_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041182545.1|1937246_1938203_-|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
>prophage 16
NZ_CP013675	Xanthomonas oryzae pv. oryzae strain PXO236, complete genome	4968717	1955900	2020050	4968717	transposase	uncultured_Caudovirales_phage(14.29%)	42	NA	NA
WP_109182116.1|1955900_1956866_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011408834.1|1957362_1959705_-	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	63.2	4.5e-09
WP_011408833.1|1959718_1960480_-	transporter	NA	NA	NA	NA	NA
WP_075244821.1|1960795_1961485_-	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.9	2.2e-12
WP_011408830.1|1963164_1963419_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_011408829.1|1963586_1965596_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_002806565.1|1965629_1965995_-	response regulator	NA	W8CYM9	Bacillus_phage	39.3	2.7e-14
WP_011259421.1|1965991_1966300_-	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_011259420.1|1966400_1967423_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_011259419.1|1967419_1968202_-	ParA family protein	NA	Q8JL10	Natrialba_phage	37.7	1.0e-13
WP_011259418.1|1968317_1969178_-	flagellar motor protein MotD	NA	NA	NA	NA	NA
WP_011259417.1|1969184_1969925_-	flagellar motor protein	NA	NA	NA	NA	NA
WP_027703781.1|1970013_1970367_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075239855.1|1970363_1970879_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011259416.1|1970901_1971294_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_011408824.1|1971445_1972153_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	51.2	1.1e-51
WP_125168759.1|1972228_1972576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044756758.1|1972577_1974383_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_069965079.1|1974637_1975090_-	hypothetical protein	NA	NA	NA	NA	NA
WP_113090205.1|1976139_1979181_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011407913.1|1979372_1980587_+|transposase	IS4-like element ISXo14 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	1.8e-54
WP_069964846.1|1980923_1981676_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044749647.1|1981685_1983062_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.8	5.4e-79
WP_041182545.1|1983314_1984271_+|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_115862268.1|1984515_1985904_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011258803.1|1986103_1987072_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.5e-99
WP_011408800.1|1987738_1988875_-	carbohydrate porin	NA	NA	NA	NA	NA
WP_011259402.1|1989193_1990936_-	PTS fructose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_011259401.1|1991094_1992051_-	1-phosphofructokinase family hexose kinase	NA	NA	NA	NA	NA
WP_059317461.1|1992047_1994564_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	28.5	6.3e-09
WP_011408798.1|1994724_1995720_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_011257851.1|1996426_1997392_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_012444648.1|1998367_2001538_-	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_012444649.1|2001550_2002855_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_027703873.1|2002869_2003529_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_069964847.1|2003806_2008831_+	glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_012445831.1|2009279_2010260_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.5	3.7e-98
WP_027703772.1|2010384_2011371_-	response regulator	NA	W8CYM9	Bacillus_phage	27.6	9.7e-06
WP_027703773.1|2011404_2015499_-	response regulator	NA	A0A1V0SGX0	Hokovirus	28.4	1.1e-55
WP_027703774.1|2015640_2016945_-	DUF445 family protein	NA	NA	NA	NA	NA
WP_012444658.1|2017115_2017970_-	hypothetical protein	NA	A0A1B1INV8	uncultured_Mediterranean_phage	39.8	6.4e-14
WP_094187728.1|2019251_2020050_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 17
NZ_CP013675	Xanthomonas oryzae pv. oryzae strain PXO236, complete genome	4968717	2037779	2102796	4968717	transposase,protease,tRNA	Bacillus_virus(18.18%)	52	NA	NA
WP_133264952.1|2037779_2039099_-|transposase	IS701-like element ISXo15 family transposase	transposase	NA	NA	NA	NA
WP_011408779.1|2039605_2040808_+	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_011259372.1|2040804_2042397_+	multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_011259371.1|2042383_2043895_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_075240820.1|2044040_2045288_+	polyamine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.3	1.2e-24
WP_011259369.1|2045607_2046438_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_041182453.1|2046593_2047004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069965081.1|2047258_2048623_+	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_011259367.1|2048774_2049776_-	magnesium and cobalt transport protein CorA	NA	NA	NA	NA	NA
WP_011259366.1|2049791_2051072_-	DUF4105 domain-containing protein	NA	NA	NA	NA	NA
WP_011408770.1|2051068_2051947_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_011408769.1|2052041_2052560_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259363.1|2052559_2053045_-	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_069964852.1|2053099_2053762_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259361.1|2054173_2055160_-	PhoH family protein	NA	A0A1B2ICF6	Erwinia_phage	48.1	2.8e-45
WP_011259360.1|2055583_2057038_-|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_012444681.1|2058973_2059960_+	lytic transglycosylase domain-containing protein	NA	A0A0H3V0Q1	Geobacillus_virus	56.0	1.3e-29
WP_011259356.1|2060489_2061134_+	ubiquinol-cytochrome c reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_011259355.1|2061133_2062393_+	cytochrome bc complex cytochrome b subunit	NA	NA	NA	NA	NA
WP_012444683.1|2062400_2063144_+	cytochrome c1	NA	NA	NA	NA	NA
WP_011259353.1|2063537_2064173_+	stringent starvation protein A	NA	NA	NA	NA	NA
WP_011259352.1|2064251_2064692_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	46.2	9.3e-25
WP_011408764.1|2064724_2065051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408763.1|2065261_2065678_-	DUF3301 domain-containing protein	NA	NA	NA	NA	NA
WP_041182294.1|2070176_2071139_-|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_011408397.1|2072796_2073981_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.8	5.0e-41
WP_155296443.1|2074392_2075712_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_012445118.1|2075861_2076830_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	1.5e-99
WP_041182545.1|2077231_2078188_+|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_080256628.1|2078448_2078637_+	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_011408759.1|2079121_2079400_+	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_027703932.1|2079387_2079678_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_015463309.1|2080279_2080459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259346.1|2080681_2080816_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_011259345.1|2081322_2081724_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_011408757.1|2082137_2082488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408756.1|2082816_2083908_-	ribonuclease D	NA	NA	NA	NA	NA
WP_041182165.1|2084179_2086015_+	formylglycine-generating enzyme family protein	NA	A0A075BSL8	Microcystis_phage	33.1	5.6e-23
WP_113001983.1|2086331_2087078_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011259340.1|2087295_2088558_+	virulence factor	NA	NA	NA	NA	NA
WP_011408753.1|2088853_2090191_-	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	36.2	1.3e-37
WP_011408752.1|2090336_2091404_-|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_011259337.1|2091428_2092916_+	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_011259336.1|2092912_2093413_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_011408751.1|2093465_2095199_+	N-acetylmuramoyl-L-alanine amidase	NA	A6XML1	Bacillus_virus	28.4	4.1e-15
WP_011259334.1|2095336_2097214_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	35.2	1.4e-85
WP_069964855.1|2097213_2098179_+	DUF1684 domain-containing protein	NA	NA	NA	NA	NA
WP_011408749.1|2098212_2099184_+	TraB/GumN family protein	NA	NA	NA	NA	NA
WP_011259331.1|2099357_2099933_-	polyhydroxyalkanoate synthesis repressor PhaR	NA	NA	NA	NA	NA
WP_011408747.1|2100092_2100833_-	beta-ketoacyl-ACP reductase	NA	NA	NA	NA	NA
WP_044756773.1|2100920_2101820_-|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_011259328.1|2101917_2102796_+|protease	protease HtpX	protease	NA	NA	NA	NA
>prophage 18
NZ_CP013675	Xanthomonas oryzae pv. oryzae strain PXO236, complete genome	4968717	2134537	2201050	4968717	transposase,tRNA	uncultured_Mediterranean_phage(44.44%)	39	NA	NA
WP_155296444.1|2134537_2135857_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011259046.1|2136069_2137038_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.9e-99
WP_011258824.1|2137101_2137686_-	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_011258825.1|2137785_2138799_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_153296780.1|2139489_2139756_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109182103.1|2139999_2140095_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044756873.1|2140168_2143474_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044756872.1|2143697_2143997_-	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	90.2	2.5e-45
WP_012444931.1|2144000_2144195_-	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	79.0	1.3e-18
WP_082323181.1|2144463_2148066_-	Avirulence protein AvrBs3	NA	NA	NA	NA	NA
WP_155296445.1|2151258_2154657_-	avirulence protein	NA	NA	NA	NA	NA
WP_155296446.1|2154861_2156181_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_069964859.1|2156278_2157337_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011408651.1|2157424_2159329_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	36.8	1.0e-112
WP_011259148.1|2159569_2160190_+	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_011259147.1|2160186_2160693_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	41.1	4.8e-25
WP_011408650.1|2160751_2161237_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012444765.1|2161468_2161753_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	57.0	1.4e-18
WP_011408648.1|2161749_2163543_+	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_069964860.1|2163549_2164581_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_094187715.1|2164860_2165624_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011259142.1|2166020_2166653_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_011408645.1|2169531_2170653_+	phytase	NA	NA	NA	NA	NA
WP_011408814.1|2174558_2174873_-	DUF1153 domain-containing protein	NA	NA	NA	NA	NA
WP_011408813.1|2174805_2175765_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_041182637.1|2175919_2176309_+	type VI secretion protein	NA	NA	NA	NA	NA
WP_082323183.1|2176348_2178940_+	avirulence protein	NA	NA	NA	NA	NA
WP_012444637.1|2183284_2184214_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_069964861.1|2184210_2187045_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014503414.1|2187073_2187802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069964862.1|2187826_2190169_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041182545.1|2190782_2191739_+|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_011258529.1|2192359_2193328_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	8.7e-100
WP_011259129.1|2195495_2196203_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408639.1|2196273_2196588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259128.1|2196547_2198044_-	aminotransferase class III-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_011259127.1|2198167_2198599_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_027703908.1|2198764_2199835_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_011259125.1|2199904_2201050_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.2	2.2e-86
>prophage 19
NZ_CP013675	Xanthomonas oryzae pv. oryzae strain PXO236, complete genome	4968717	2293752	2385663	4968717	transposase,protease	Bacillus_phage(25.0%)	50	NA	NA
WP_011258803.1|2293752_2294721_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.5e-99
WP_044749647.1|2295420_2296797_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.8	5.4e-79
WP_082323185.1|2297278_2305417_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259043.1|2305693_2306305_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_027703759.1|2306301_2307324_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_011408577.1|2307442_2308927_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_012444833.1|2308923_2312016_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_069964866.1|2312008_2313124_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_012444836.1|2313640_2316376_-	S8 family serine peptidase	NA	NA	NA	NA	NA
WP_069964867.1|2317207_2318584_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	7.8e-62
WP_011408569.1|2321136_2322315_+	N-acetylmuramoyl-L-alanine amidase	NA	M1IEI0	Bacillus_phage	39.6	1.9e-08
WP_011408568.1|2322352_2323273_+	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_011259034.1|2323888_2325256_+	polynucleotide adenylyltransferase PcnB	NA	A0A1B1IVF3	uncultured_Mediterranean_phage	37.9	9.9e-25
WP_011259033.1|2325259_2325745_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_011408567.1|2325780_2326596_+	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	34.1	1.6e-30
WP_011259031.1|2326592_2327435_+	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_011259030.1|2327613_2327994_+	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_069964869.1|2327990_2329505_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_011259028.1|2329663_2330008_+	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
WP_011408564.1|2330011_2330635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408563.1|2330869_2332825_-	DUF839 domain-containing protein	NA	NA	NA	NA	NA
WP_069965084.1|2333258_2335871_+	glycoside hydrolase family 3 protein	NA	NA	NA	NA	NA
WP_075240030.1|2335863_2336121_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408561.1|2336130_2337693_+	sodium/solute symporter	NA	A0A240F3J2	Aeromonas_phage	39.5	2.7e-87
WP_011259023.1|2337937_2339794_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_041182436.1|2341120_2343310_-	glycosyl hydrolase	NA	NA	NA	NA	NA
WP_069964870.1|2343438_2345217_-	M14 family metallopeptidase	NA	NA	NA	NA	NA
WP_011408557.1|2346418_2347027_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_044756845.1|2347357_2347546_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408556.1|2347729_2348044_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_044756844.1|2348094_2348928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044756843.1|2348994_2349495_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_044757420.1|2349586_2350165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259013.1|2350326_2350827_-	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_044757418.1|2351138_2352239_+	S8 family serine peptidase	NA	NA	NA	NA	NA
WP_044756842.1|2352341_2353055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044756841.1|2353306_2353546_+	HTH domain-containing protein	NA	NA	NA	NA	NA
WP_011259009.1|2356002_2356488_+	glutathione peroxidase	NA	A0A1S7DM81	Molluscum_contagiosum_virus	36.2	2.8e-14
WP_011408551.1|2356638_2357418_-	ferredoxin--NADP reductase	NA	NA	NA	NA	NA
WP_012444869.1|2357606_2359487_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	38.0	2.3e-24
WP_044756840.1|2359820_2361338_+	fumarate hydratase	NA	NA	NA	NA	NA
WP_044756839.1|2361474_2362110_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_044756838.1|2362538_2363672_-	phospholipase A	NA	NA	NA	NA	NA
WP_011259000.1|2367136_2368111_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	39.6	2.0e-19
WP_027704049.1|2368277_2368511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027704112.1|2371732_2372251_+	N-acetyltransferase	NA	A0A2H4J136	uncultured_Caudovirales_phage	40.7	6.8e-27
WP_115862273.1|2373984_2375304_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_012444880.1|2375354_2375759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027704112.1|2382091_2382610_+	N-acetyltransferase	NA	A0A2H4J136	uncultured_Caudovirales_phage	40.7	6.8e-27
WP_115862273.1|2384343_2385663_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 20
NZ_CP013675	Xanthomonas oryzae pv. oryzae strain PXO236, complete genome	4968717	2390122	2455030	4968717	transposase	uncultured_Caudovirales_phage(25.0%)	54	NA	NA
WP_044756833.1|2390122_2391337_-|transposase	IS4 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	1.1e-54
WP_044756832.1|2391587_2393063_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	65.7	4.3e-98
WP_012444885.1|2393113_2394133_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_027703901.1|2394416_2395997_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_027703900.1|2397207_2397555_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012444889.1|2397551_2398082_+	arsenate reductase ArsC	NA	A0A2H4J8A6	uncultured_Caudovirales_phage	42.6	1.8e-27
WP_012444890.1|2398092_2398506_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	68.2	8.6e-41
WP_012444891.1|2398502_2399228_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	68.2	3.1e-86
WP_044756831.1|2399246_2400551_+	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	58.9	2.0e-128
WP_026144156.1|2400814_2401171_+	sulfurtransferase	NA	NA	NA	NA	NA
WP_012444894.1|2402166_2405127_+|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
WP_044756830.1|2406121_2409517_-	PAS domain S-box protein	NA	A0A1V0SGX0	Hokovirus	27.8	2.9e-25
WP_069964873.1|2409731_2410112_-	response regulator	NA	NA	NA	NA	NA
WP_012444899.1|2410379_2410556_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027703995.1|2411127_2411331_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094187715.1|2411373_2412136_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_044756829.1|2412170_2413547_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.5	1.3e-77
WP_011408535.1|2413767_2414427_-	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_011258990.1|2414482_2416399_-	phosphogluconate dehydratase	NA	NA	NA	NA	NA
WP_011258989.1|2416501_2417221_-	6-phosphogluconolactonase	NA	NA	NA	NA	NA
WP_011258988.1|2417217_2418225_-	glucokinase	NA	NA	NA	NA	NA
WP_011408534.1|2418221_2419652_-	glucose-6-phosphate dehydrogenase	NA	A0A222YYZ2	Synechococcus_phage	34.5	2.2e-67
WP_011258986.1|2420083_2421181_+	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	30.1	2.2e-22
WP_011408533.1|2421309_2422182_-	folate-binding protein YgfZ	NA	NA	NA	NA	NA
WP_012444907.1|2422125_2422392_+	DUF1674 domain-containing protein	NA	NA	NA	NA	NA
WP_011258985.1|2422451_2422847_+	succinate dehydrogenase, cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_011258984.1|2422843_2423230_+	succinate dehydrogenase, hydrophobic membrane anchor protein	NA	NA	NA	NA	NA
WP_011258983.1|2423264_2425055_+	succinate dehydrogenase flavoprotein subunit	NA	NA	NA	NA	NA
WP_012444910.1|2425058_2425268_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007963513.1|2425284_2426067_+	succinate dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_011408531.1|2426177_2426426_+	succinate dehydrogenase assembly factor 2	NA	NA	NA	NA	NA
WP_014503500.1|2426376_2426829_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010378794.1|2426852_2428094_+	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_011258980.1|2428086_2428821_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	34.5	1.0e-31
WP_155296447.1|2430214_2431180_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011408527.1|2431433_2433842_+	DNA internalization-related competence protein ComEC/Rec2	NA	NA	NA	NA	NA
WP_011408526.1|2433870_2434533_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_011258975.1|2434536_2435001_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_011258974.1|2434997_2436767_+	lipid A export permease/ATP-binding protein MsbA	NA	W8CYL7	Bacillus_phage	28.0	9.4e-52
WP_011258973.1|2436763_2437804_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_011258972.1|2438095_2438875_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_011258971.1|2438871_2439336_+	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_094187740.1|2439278_2440778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069964876.1|2440774_2442631_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_011258968.1|2442630_2443263_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_012444921.1|2443737_2444244_-	glyoxalase	NA	NA	NA	NA	NA
WP_011409560.1|2446089_2447052_+|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_011408520.1|2448230_2448902_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	38.9	5.2e-27
WP_011258057.1|2448898_2449120_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_069964877.1|2449293_2453313_-	avirulence protein	NA	NA	NA	NA	NA
WP_011408491.1|2453538_2453838_-	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	91.3	1.9e-45
WP_012444931.1|2453841_2454036_-	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	79.0	1.3e-18
WP_153296744.1|2454101_2454248_-	hypothetical protein	NA	Q38057	Xanthomonas_phage	78.4	6.4e-07
WP_094187715.1|2454266_2455030_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 21
NZ_CP013675	Xanthomonas oryzae pv. oryzae strain PXO236, complete genome	4968717	2594416	2628257	4968717	transposase	Bacillus_virus(20.0%)	28	NA	NA
WP_109182067.1|2594416_2595382_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011408430.1|2595402_2596206_-	amidohydrolase	NA	NA	NA	NA	NA
WP_069964889.1|2596345_2597494_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_011408428.1|2597720_2598365_+	heme ABC exporter ATP-binding protein CcmA	NA	G3M9Y6	Bacillus_virus	25.9	3.1e-13
WP_011258853.1|2598361_2599057_+	heme exporter protein CcmB	NA	NA	NA	NA	NA
WP_012445013.1|2599151_2599904_+	heme ABC transporter permease	NA	NA	NA	NA	NA
WP_011258852.1|2599900_2600071_+	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_011258851.1|2600067_2600538_+	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_011408426.1|2600706_2602644_+	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_011258849.1|2602636_2603239_+	DsbE family thiol:disulfide interchange protein	NA	NA	NA	NA	NA
WP_094187828.1|2603256_2603667_+	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_011258847.1|2603660_2604680_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_011258845.1|2604969_2606841_-	DUF4105 domain-containing protein	NA	NA	NA	NA	NA
WP_011258843.1|2607171_2608590_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_011258842.1|2608798_2610040_+	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.4	1.7e-103
WP_011258841.1|2610195_2610783_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_011408420.1|2610919_2612401_+	amino acid permease	NA	NA	NA	NA	NA
WP_012445020.1|2612477_2613908_+	amino acid permease	NA	NA	NA	NA	NA
WP_011258838.1|2613996_2614674_+	methylthioribulose 1-phosphate dehydratase	NA	NA	NA	NA	NA
WP_044756804.1|2614685_2615252_+	acireductone dioxygenase	NA	NA	NA	NA	NA
WP_011258836.1|2615254_2615953_+	acireductone synthase	NA	NA	NA	NA	NA
WP_044756803.1|2616278_2617364_+	peptidase C13	NA	NA	NA	NA	NA
WP_082322996.1|2619117_2620074_-|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.7	2.4e-41
WP_011258802.1|2621124_2622093_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_075239722.1|2622966_2624124_+	molybdopterin-synthase adenylyltransferase MoeB	NA	NA	NA	NA	NA
WP_109181928.1|2624400_2625366_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_155296449.1|2625343_2626819_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	54.1	4.6e-76
WP_115862270.1|2626937_2628257_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 22
NZ_CP013675	Xanthomonas oryzae pv. oryzae strain PXO236, complete genome	4968717	2750809	2903625	4968717	transposase,tRNA	Bacillus_phage(14.81%)	103	NA	NA
WP_041182545.1|2750809_2751766_+|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_144408323.1|2751740_2752031_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044749647.1|2754683_2756060_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.8	5.4e-79
WP_155296450.1|2761028_2765249_-	glutamate synthase	NA	NA	NA	NA	NA
WP_082323188.1|2765519_2766644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409560.1|2766886_2767849_-|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_128415342.1|2770496_2770976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069964899.1|2771184_2774253_-	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.2	1.6e-59
WP_011259260.1|2779109_2779502_+	c-type cytochrome	NA	NA	NA	NA	NA
WP_011259261.1|2779510_2779972_+	cytochrome c	NA	NA	NA	NA	NA
WP_153296779.1|2780392_2780791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_133264955.1|2781267_2781522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115801893.1|2782494_2783460_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_082323190.1|2783466_2784765_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011408708.1|2784933_2786619_-	thiol reductant ABC exporter subunit CydC	NA	W8CYL7	Bacillus_phage	25.2	3.6e-16
WP_075239845.1|2786615_2788352_-	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	26.2	8.2e-16
WP_069959883.1|2788503_2789604_+	cytochrome D ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_011259267.1|2789652_2789916_+	cytochrome d ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_011259269.1|2790294_2790405_+	cytochrome bd-I oxidase subunit CydX	NA	NA	NA	NA	NA
WP_012444741.1|2790625_2791891_+	MFS transporter	NA	NA	NA	NA	NA
WP_044756781.1|2791871_2793785_-	CocE/NonD family hydrolase	NA	NA	NA	NA	NA
WP_011408714.1|2794152_2795397_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	45.1	2.5e-91
WP_011408715.1|2795561_2796716_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	37.8	1.2e-47
WP_011259275.1|2796729_2796990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094187751.1|2796989_2797358_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_011408717.1|2797354_2798650_-	argininosuccinate lyase	NA	NA	NA	NA	NA
WP_044756779.1|2798773_2799724_-	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
WP_011259279.1|2800336_2801680_-	acetylglutamate kinase	NA	NA	NA	NA	NA
WP_011259280.1|2801719_2802820_-	acetylornithine deacetylase	NA	NA	NA	NA	NA
WP_011408722.1|2802825_2803278_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011408723.1|2803519_2804761_-	argininosuccinate synthase	NA	NA	NA	NA	NA
WP_011259283.1|2804832_2805858_-	N-acetylornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_027703614.1|2806170_2806665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259285.1|2806835_2808266_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.5	1.1e-42
WP_011408724.1|2808763_2809201_+	SufE family protein	NA	NA	NA	NA	NA
WP_011259287.1|2809197_2810448_+	MFS transporter	NA	NA	NA	NA	NA
WP_011259288.1|2810515_2811577_-	S41 family peptidase	NA	NA	NA	NA	NA
WP_075239108.1|2811719_2812748_-	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_027703612.1|2812838_2813120_+	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
WP_011259290.1|2813116_2814466_+	dihydroorotase	NA	NA	NA	NA	NA
WP_011259291.1|2814405_2815305_+	M23 family metallopeptidase	NA	A0A075BS18	Microcystis_phage	41.2	2.6e-13
WP_011259294.1|2816176_2816440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012444728.1|2816811_2817300_-	general stress protein	NA	NA	NA	NA	NA
WP_155296451.1|2817523_2818843_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011258529.1|2818979_2819948_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	8.7e-100
WP_094187753.1|2820935_2821733_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_012444725.1|2822678_2823860_+	putative acyl-CoA thioester hydrolase	NA	NA	NA	NA	NA
WP_115862284.1|2824611_2825931_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011258822.1|2826429_2827779_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	51.6	4.5e-94
WP_099051282.1|2827785_2828550_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_027704061.1|2828910_2829378_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_094187738.1|2829564_2830666_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.2	1.6e-36
WP_155296452.1|2832683_2833649_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_069964904.1|2834452_2835667_-|transposase	IS4 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	34.0	2.8e-55
WP_011258800.1|2837488_2838688_+	homoserine O-acetyltransferase	NA	NA	NA	NA	NA
WP_011258799.1|2838836_2839019_+	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_041182545.1|2841026_2841983_-|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_109181957.1|2844178_2845144_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_094187737.1|2845144_2845898_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_012445118.1|2846728_2847697_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	1.5e-99
WP_011258442.1|2847881_2849117_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_012445119.1|2849169_2849937_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_012445121.1|2851164_2853693_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	34.0	3.1e-64
WP_069964905.1|2854259_2855705_-	acetylhydrolase	NA	M1HKG7	Acanthocystis_turfacea_Chlorella_virus	25.8	1.8e-08
WP_011258788.1|2856076_2856217_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_012445123.1|2856216_2857365_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_011258786.1|2857486_2858482_+	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	46.9	3.7e-05
WP_044756882.1|2858478_2859618_+	5-methyltetrahydrofolate--homocysteine methyltransferase	NA	A0A140XBC7	Dickeya_phage	65.0	6.3e-17
WP_012445124.1|2859760_2862514_+	methionine synthase	NA	NA	NA	NA	NA
WP_011258783.1|2862900_2864106_-	AGE family epimerase/isomerase	NA	NA	NA	NA	NA
WP_011258782.1|2864102_2865161_-	carbohydrate kinase	NA	NA	NA	NA	NA
WP_011258781.1|2865085_2866396_-	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
WP_041182423.1|2866409_2867585_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_027703705.1|2867725_2868571_-	transporter	NA	NA	NA	NA	NA
WP_011258778.1|2868904_2869657_-	DUF2058 family protein	NA	NA	NA	NA	NA
WP_011258777.1|2869657_2869894_-	protein SlyX	NA	NA	NA	NA	NA
WP_069964906.1|2869886_2871236_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	40.6	1.4e-79
WP_027703707.1|2871261_2872227_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_011408372.1|2872318_2872876_-	glutathione peroxidase	NA	NA	NA	NA	NA
WP_042464800.1|2873011_2873260_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014502778.1|2873262_2873625_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011258772.1|2873621_2874497_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.9	3.3e-13
WP_011258771.1|2874493_2875480_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258770.1|2875489_2876326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027703710.1|2876958_2877381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408367.1|2877503_2878907_-	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_041182545.1|2879795_2880752_+|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_153296746.1|2881313_2881457_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094187736.1|2881416_2882180_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011258759.1|2885202_2886570_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	48.6	3.3e-113
WP_011258758.1|2886811_2887312_+	DUF3060 domain-containing protein	NA	NA	NA	NA	NA
WP_041182090.1|2887591_2887855_-	PDZ domain-containing protein	NA	NA	NA	NA	NA
WP_011408362.1|2888192_2889692_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_011408361.1|2889688_2890621_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_027703748.1|2890800_2893629_+	2-oxoglutarate dehydrogenase E1 component	NA	NA	NA	NA	NA
WP_027703749.1|2893671_2894874_+	dihydrolipoyllysine-residue succinyltransferase	NA	NA	NA	NA	NA
WP_027703750.1|2895115_2896552_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.1	5.7e-39
WP_044756895.1|2896750_2897344_+	TIGR00730 family Rossman fold protein	NA	A0A2I2L3F0	Orpheovirus	27.5	2.1e-11
WP_103073520.1|2897611_2898205_+	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	41.2	8.1e-16
WP_011408359.1|2898201_2899971_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	30.7	8.0e-59
WP_069964907.1|2900309_2900915_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_044756897.1|2901044_2901971_+	TolC family protein	NA	NA	NA	NA	NA
WP_115862277.1|2902305_2903625_+|transposase	IS701-like element ISXo15 family transposase	transposase	NA	NA	NA	NA
>prophage 23
NZ_CP013675	Xanthomonas oryzae pv. oryzae strain PXO236, complete genome	4968717	2925267	2990742	4968717	coat,transposase,protease	Bacillus_virus(22.22%)	50	NA	NA
WP_109181895.1|2925267_2926233_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011258724.1|2927678_2927927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094187735.1|2928121_2928884_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_027703878.1|2928881_2929616_-	serine hydrolase	NA	NA	NA	NA	NA
WP_011258722.1|2929666_2931247_-	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_027703877.1|2931253_2932447_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_012445166.1|2932457_2933975_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_012445167.1|2933971_2934412_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011258718.1|2934533_2935385_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011258717.1|2935445_2937689_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	34.7	1.1e-81
WP_033013399.1|2938144_2938681_-	bacterioferritin	NA	NA	NA	NA	NA
WP_012445169.1|2938776_2941194_+	penicillin acylase family protein	NA	NA	NA	NA	NA
WP_011258714.1|2942573_2944700_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_094187734.1|2945076_2946183_+	right-handed parallel beta-helix repeat-containing protein	NA	NA	NA	NA	NA
WP_027703365.1|2946251_2947946_-	asparagine synthase B	NA	E5ERH5	Ostreococcus_lucimarinus_virus	38.6	2.5e-86
WP_011408336.1|2948240_2949371_-	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_011408335.1|2949375_2949876_-	GNAT family N-acetyltransferase	NA	A0A1X9I687	Streptococcus_phage	41.7	2.3e-27
WP_011408334.1|2949872_2950229_-	Spx/MgsR family RNA polymerase-binding regulatory protein	NA	NA	NA	NA	NA
WP_012445174.1|2950691_2951888_-	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_069960200.1|2951904_2954514_-	[protein-PII] uridylyltransferase	NA	NA	NA	NA	NA
WP_024744144.1|2954510_2955287_-	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_033003618.1|2955605_2956130_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_044756902.1|2956138_2956909_+	molecular chaperone	NA	NA	NA	NA	NA
WP_044756903.1|2956925_2959277_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_011258703.1|2959273_2960308_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_044756904.1|2960354_2960687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408326.1|2960689_2961415_+	molecular chaperone	NA	NA	NA	NA	NA
WP_011258701.1|2961790_2962594_+	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_011258700.1|2962763_2963642_+	elongation factor Ts	NA	NA	NA	NA	NA
WP_011408325.1|2963769_2964147_+	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_011258698.1|2964203_2964926_+	UMP kinase	NA	NA	NA	NA	NA
WP_011258697.1|2965106_2965664_+	ribosome recycling factor	NA	NA	NA	NA	NA
WP_027703358.1|2965681_2966443_+	di-trans,poly-cis-decaprenylcistransferase	NA	R9W0U9	Flavobacterium_phage	32.6	3.6e-16
WP_011258695.1|2966439_2967267_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_011258694.1|2967269_2968460_+	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
WP_069964910.1|2968486_2969833_+|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_011258692.1|2969829_2972283_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_011258691.1|2972682_2973696_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_011258690.1|2973692_2974154_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_011258689.1|2974177_2974969_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_027703356.1|2975007_2976264_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_041182085.1|2976260_2977001_+	ribonuclease HII	NA	G9E3X7	Emiliania_huxleyi_virus	38.0	1.2e-24
WP_011258686.1|2977458_2981049_+	DNA polymerase III subunit alpha	NA	A0A291AVA6	Streptomyces_phage	36.6	2.0e-181
WP_011258685.1|2981224_2982184_+	acetyl-CoA carboxylase carboxyltransferase subunit alpha	NA	NA	NA	NA	NA
WP_069964911.1|2983023_2985204_+	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_011258682.1|2985203_2985941_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.6	3.5e-08
WP_011258681.1|2985937_2987350_+	DUF3526 domain-containing protein	NA	NA	NA	NA	NA
WP_011258680.1|2987286_2988630_+	DUF3526 domain-containing protein	NA	NA	NA	NA	NA
WP_082323196.1|2988630_2989260_+	hypothetical protein	NA	K4I1H9	Acidithiobacillus_phage	58.5	2.4e-34
WP_044749647.1|2989365_2990742_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.8	5.4e-79
>prophage 24
NZ_CP013675	Xanthomonas oryzae pv. oryzae strain PXO236, complete genome	4968717	3000050	3057360	4968717	transposase,protease,tRNA	Acidithiobacillus_phage(22.22%)	50	NA	NA
WP_069959817.1|3000050_3001526_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	67.5	2.2e-102
WP_011408311.1|3001568_3001964_+	type I toxin-antitoxin system SymE family toxin	NA	NA	NA	NA	NA
WP_069964912.1|3002003_3003380_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	56.5	1.2e-78
WP_011258670.1|3005019_3005694_+	DUF502 domain-containing protein	NA	A0A2I7S9X1	Vibrio_phage	24.5	1.9e-08
WP_011258669.1|3005698_3006475_+	queuosine precursor transporter	NA	R4TNY5	Halovirus	27.2	1.9e-09
WP_011258668.1|3006895_3008833_+	DUF885 family protein	NA	NA	NA	NA	NA
WP_011258667.1|3009014_3009992_-	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_011258666.1|3009988_3011386_-	S-methylmethionine permease	NA	NA	NA	NA	NA
WP_069964913.1|3011656_3012715_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011408302.1|3013478_3013928_+	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_069964914.1|3014152_3016237_+|tRNA	methionine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_041182084.1|3016451_3017048_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_011408301.1|3017049_3017478_+	Rnf electron transport complex subunit RnfB	NA	NA	NA	NA	NA
WP_042464748.1|3018096_3018879_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012445216.1|3018964_3019333_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258659.1|3019391_3019955_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_011258658.1|3019939_3020785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408297.1|3021010_3022009_+	acyl-CoA desaturase	NA	G4YAW5	Emiliania_huxleyi_virus	30.6	2.3e-18
WP_027704227.1|3022005_3023256_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_094187733.1|3023180_3024140_+	DUF1365 domain-containing protein	NA	NA	NA	NA	NA
WP_011258655.1|3024136_3025432_+	class I SAM-dependent methyltransferase	NA	A0A2I2L5L3	Orpheovirus	32.4	3.9e-39
WP_011408293.1|3025428_3025974_+	DUF2878 domain-containing protein	NA	NA	NA	NA	NA
WP_044756918.1|3025970_3026753_+	DUF1295 domain-containing protein	NA	NA	NA	NA	NA
WP_012445221.1|3026770_3027841_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_011408290.1|3028003_3028351_-	RidA family protein	NA	NA	NA	NA	NA
WP_069964915.1|3029331_3031896_+	bifunctional lysylphosphatidylglycerol flippase/synthetase MprF	NA	NA	NA	NA	NA
WP_011258647.1|3032519_3033890_-	virulence factor family protein	NA	NA	NA	NA	NA
WP_011258646.1|3033959_3034154_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258645.1|3034213_3034822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408284.1|3034857_3035460_-	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_011258643.1|3035733_3036189_-	PA2169 family four-helix-bundle protein	NA	NA	NA	NA	NA
WP_094187732.1|3036404_3036581_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258642.1|3036751_3037963_-	MFS transporter	NA	NA	NA	NA	NA
WP_011408282.1|3038183_3039302_+	alkene reductase	NA	NA	NA	NA	NA
WP_075239156.1|3040192_3040483_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408280.1|3040771_3041107_-	alkylphosphonate utilization protein	NA	NA	NA	NA	NA
WP_011408279.1|3041221_3042271_+	cation transporter	NA	NA	NA	NA	NA
WP_011408623.1|3042518_3043754_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_069964916.1|3043929_3044403_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_012445232.1|3044542_3045919_+	Hsp70 family protein	NA	NA	NA	NA	NA
WP_011258635.1|3046108_3046294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094187731.1|3047271_3048070_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_115862279.1|3048186_3049506_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_059317469.1|3049718_3050687_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	3.3e-99
WP_011258631.1|3050943_3051210_-	DksA/TraR family C4-type zinc finger protein	NA	A0A193GYU8	Escherichia_phage	54.5	1.5e-17
WP_011258630.1|3051384_3051639_+	DUF2789 domain-containing protein	NA	NA	NA	NA	NA
WP_011258629.1|3051799_3051973_-	DUF1328 domain-containing protein	NA	NA	NA	NA	NA
WP_041182081.1|3052374_3052902_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_011258627.1|3053370_3054471_+	Glu/Leu/Phe/Val dehydrogenase	NA	NA	NA	NA	NA
WP_069964917.1|3054531_3057360_-|protease	autotransporter serine protease	protease	A0A1V0SBG2	Catovirus	25.2	3.9e-07
>prophage 25
NZ_CP013675	Xanthomonas oryzae pv. oryzae strain PXO236, complete genome	4968717	3181701	3262598	4968717	transposase,tRNA	Staphylococcus_prophage(16.67%)	55	NA	NA
WP_011407237.1|3181701_3182658_-|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
WP_059317522.1|3182809_3183193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044756939.1|3184098_3185343_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_012445311.1|3185339_3185618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082323199.1|3185695_3186097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408199.1|3186379_3186751_-	biotin/lipoyl-binding protein	NA	NA	NA	NA	NA
WP_041183382.1|3186747_3187014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155296453.1|3187185_3187392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041182719.1|3187459_3188416_+|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.8	3.7e-42
WP_011258527.1|3188782_3190246_+	glycoside hydrolase family 125 protein	NA	NA	NA	NA	NA
WP_011408197.1|3190381_3192724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408196.1|3193003_3194845_+	beta-galactosidase	NA	NA	NA	NA	NA
WP_027703763.1|3194894_3197426_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408193.1|3198043_3198244_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012445314.1|3198301_3198622_-	RebB protein	NA	NA	NA	NA	NA
WP_011258521.1|3199001_3200105_+	exo-alpha-sialidase	NA	NA	NA	NA	NA
WP_080493519.1|3200247_3202206_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027703765.1|3202315_3203047_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_027703766.1|3203043_3204108_-	N(4)-(beta-N-acetylglucosaminyl)-L-asparaginase	NA	NA	NA	NA	NA
WP_115862280.1|3208756_3210076_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_041182920.1|3210208_3211291_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_012445323.1|3211302_3211926_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011258512.1|3212176_3212653_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_011408184.1|3212686_3213889_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069964925.1|3213896_3220823_-	response regulator	NA	W8CYM9	Bacillus_phage	31.1	2.9e-11
WP_011258510.1|3220936_3222973_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	42.1	2.1e-23
WP_003482487.1|3223012_3223543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258508.1|3223542_3223905_-	response regulator	NA	A0A220YL79	Alteromonas_virus	26.8	9.0e-10
WP_005913706.1|3223922_3224324_-	response regulator	NA	NA	NA	NA	NA
WP_044756943.1|3224573_3225524_+	glutathione synthase	NA	NA	NA	NA	NA
WP_011258506.1|3225520_3226396_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_069965087.1|3226691_3227642_-	ADP-ribosylglycohydrolase	NA	A0A1S6UB21	Serratia_phage	48.5	2.0e-64
WP_012445327.1|3227604_3228324_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_044756945.1|3228337_3230365_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	33.2	2.7e-95
WP_044756946.1|3230566_3231091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044756947.1|3231103_3233548_-	penicillin-binding protein 1B	NA	NA	NA	NA	NA
WP_044756949.1|3233789_3235892_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_044757459.1|3236224_3237667_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044756951.1|3237942_3240129_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_002812057.1|3240418_3240499_+	pyrroloquinoline quinone precursor peptide PqqA	NA	NA	NA	NA	NA
WP_044756952.1|3240582_3241482_+	pyrroloquinoline quinone biosynthesis protein PqqB	NA	NA	NA	NA	NA
WP_011408174.1|3241478_3242231_+	pyrroloquinoline-quinone synthase PqqC	NA	NA	NA	NA	NA
WP_012445334.1|3242227_3242506_+	pyrroloquinoline quinone biosynthesis peptide chaperone PqqD	NA	NA	NA	NA	NA
WP_012445335.1|3242502_3243621_+	pyrroloquinoline quinone biosynthesis protein PqqE	NA	NA	NA	NA	NA
WP_011408171.1|3243683_3244196_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027703396.1|3244624_3246139_+	PhoPQ-regulated protein	NA	NA	NA	NA	NA
WP_069964926.1|3247580_3250247_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_044756954.1|3250467_3254589_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SDF7	Indivirus	28.5	5.6e-47
WP_011408166.1|3254690_3255236_+	DNA starvation/stationary phase protection protein	NA	A0A2H4N7L5	Lake_Baikal_phage	32.4	1.5e-16
WP_011258487.1|3255793_3257590_+	DNA helicase RecQ	NA	L7RCS0	Acanthamoeba_polyphaga_moumouvirus	35.5	1.5e-81
WP_011408165.1|3257728_3258226_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027703393.1|3258304_3258709_+	response regulator	NA	NA	NA	NA	NA
WP_008578058.1|3259339_3260014_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A088F6S9	Vibrio_phage	34.7	6.4e-25
WP_044756955.1|3260392_3261769_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	1.4e-58
WP_155296454.1|3261835_3262598_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 26
NZ_CP013675	Xanthomonas oryzae pv. oryzae strain PXO236, complete genome	4968717	3379858	3526217	4968717	transposase,tRNA	uncultured_Caudovirales_phage(16.67%)	110	NA	NA
WP_115862282.1|3379858_3381178_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_082322932.1|3381738_3381909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258802.1|3382055_3383024_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_128415435.1|3383075_3383564_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069964935.1|3383563_3388054_-	type IV secretion protein Rhs	NA	NA	NA	NA	NA
WP_011407196.1|3389350_3390670_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_094187715.1|3390712_3391475_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_069964936.1|3391720_3393553_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.5	2.8e-30
WP_011258343.1|3393684_3394275_-	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
WP_069964937.1|3394340_3397397_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_011258341.1|3397393_3398497_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_011258340.1|3398522_3399359_-	MipA/OmpV family protein	NA	NA	NA	NA	NA
WP_069964938.1|3399378_3400848_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_012444424.1|3400953_3401643_+	response regulator transcription factor	NA	Q6XM27	Feldmannia_irregularis_virus	28.3	3.6e-07
WP_011408056.1|3401639_3402833_+	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	23.9	5.2e-22
WP_069964939.1|3402891_3404157_-	potassium transporter	NA	NA	NA	NA	NA
WP_082323202.1|3404303_3405980_-	serine hydrolase	NA	NA	NA	NA	NA
WP_069964941.1|3405921_3406422_-	putative 4-hydroxy-4-methyl-2-oxoglutarate aldolase	NA	NA	NA	NA	NA
WP_069959788.1|3408237_3409185_+	DMT family transporter	NA	NA	NA	NA	NA
WP_059317478.1|3409372_3410095_-	pseudouridine synthase	NA	NA	NA	NA	NA
WP_011408052.1|3410258_3412655_-	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	30.2	3.8e-11
WP_069964510.1|3412918_3414823_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	35.7	2.5e-58
WP_069964942.1|3415505_3416153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041183663.1|3416189_3416432_+	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_014502654.1|3416775_3417177_-	membrane protein	NA	NA	NA	NA	NA
WP_027704130.1|3417202_3417736_-	DUF4019 domain-containing protein	NA	NA	NA	NA	NA
WP_011258323.1|3418138_3418393_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258319.1|3421316_3421862_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A1S5V092	Saudi_moumouvirus	51.9	4.1e-14
WP_044756984.1|3422118_3423417_+	alkaline phosphatase family protein	NA	NA	NA	NA	NA
WP_011258317.1|3423543_3424989_+	chloride channel protein	NA	A0A1X9I5Z9	Streptococcus_phage	31.5	4.9e-14
WP_044756986.1|3425061_3426102_+	zinc-dependent alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_011408042.1|3426234_3426417_-	30S ribosomal protein THX	NA	NA	NA	NA	NA
WP_011258314.1|3426716_3427127_-	MerC domain-containing protein	NA	NA	NA	NA	NA
WP_069964943.1|3429754_3432136_+	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_041182034.1|3432379_3433336_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.8	1.0e-39
WP_011258310.1|3433387_3433798_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_011258309.1|3433896_3434622_-	OmpA family protein	NA	G3M9Z0	Bacillus_virus	33.9	1.4e-09
WP_011258308.1|3435038_3436493_-	deoxyribodipyrimidine photo-lyase	NA	A0A1V0S949	Catovirus	31.7	5.7e-47
WP_011408037.1|3436559_3437990_-	replicative DNA helicase	NA	O80281	Escherichia_phage	53.4	8.5e-120
WP_011258306.1|3438211_3438766_-	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	35.3	1.1e-19
WP_011258305.1|3438982_3440923_-	asparagine synthase (glutamine-hydrolyzing)	NA	A0A1B1ISV2	uncultured_Mediterranean_phage	30.5	4.4e-26
WP_027704133.1|3441098_3441737_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_033013599.1|3443970_3445134_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_011408033.1|3445291_3446083_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_011258299.1|3446228_3446444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258298.1|3446443_3447211_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_011258297.1|3447272_3448103_-|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_027704135.1|3448175_3448604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408030.1|3448735_3449215_+	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_011258294.1|3449465_3449681_-	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	59.7	6.5e-16
WP_011258293.1|3449908_3450394_+	DUF456 domain-containing protein	NA	NA	NA	NA	NA
WP_011258291.1|3451955_3452159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408025.1|3452936_3453395_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_011408024.1|3453800_3454307_-	Fur family transcriptional regulator	NA	NA	NA	NA	NA
WP_011258289.1|3454320_3455724_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_075242217.1|3456913_3457645_-	nitrilase	NA	NA	NA	NA	NA
WP_069964944.1|3457718_3458675_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.9	6.2e-42
WP_011408021.1|3458973_3459561_-	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_011408020.1|3459791_3460604_+	C1 family peptidase	NA	NA	NA	NA	NA
WP_011408019.1|3460634_3461798_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.2	2.6e-98
WP_011408018.1|3461929_3462313_-	membrane protein	NA	NA	NA	NA	NA
WP_011258280.1|3462828_3463641_+	C1 family peptidase	NA	NA	NA	NA	NA
WP_069964945.1|3463701_3464760_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	42.0	3.5e-70
WP_011408015.1|3464754_3465924_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.5	1.1e-96
WP_011408014.1|3466055_3466439_-	membrane protein	NA	NA	NA	NA	NA
WP_011258276.1|3467174_3467987_+	C1 family peptidase	NA	NA	NA	NA	NA
WP_109181900.1|3468006_3469042_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_042464653.1|3469197_3469917_-	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_094187763.1|3470060_3470858_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011408011.1|3471204_3472113_+	23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ	NA	NA	NA	NA	NA
WP_014502625.1|3472524_3473067_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_044756996.1|3473469_3476934_+	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_125168745.1|3477165_3477384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258268.1|3477423_3477753_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_044756997.1|3477771_3479769_+	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_044756998.1|3479836_3481993_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	62.1	2.9e-10
WP_044756999.1|3482003_3482519_+	purine-binding chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_041182609.1|3482545_3483829_+	EAL domain-containing response regulator	NA	NA	NA	NA	NA
WP_011258263.1|3483812_3484640_+	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_044757485.1|3484654_3485776_+	chemotaxis response regulator protein-glutamate methylesterase	NA	NA	NA	NA	NA
WP_044757000.1|3487723_3489781_-	M13 family peptidase	NA	E3T4I7	Cafeteria_roenbergensis_virus	31.6	1.2e-79
WP_103057495.1|3490113_3490368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258259.1|3490716_3491466_-	2,3-diphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_012444354.1|3491569_3492283_+	deoxyribonuclease V	NA	NA	NA	NA	NA
WP_125168744.1|3492354_3492873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069964946.1|3493050_3493941_+	pirin family protein	NA	NA	NA	NA	NA
WP_011407999.1|3494187_3494649_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069959784.1|3494993_3497402_-	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_109182101.1|3497398_3497878_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_011407995.1|3498185_3498773_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_011407994.1|3498975_3499542_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_011258251.1|3499762_3499996_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_011409560.1|3501021_3501984_-|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_155296456.1|3502484_3503051_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_027704078.1|3503002_3503863_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_069964947.1|3503917_3505819_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	32.6	2.9e-30
WP_011407990.1|3505840_3507949_-	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_075245366.1|3507998_3508556_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_041182394.1|3508950_3509499_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_011258248.1|3510492_3511440_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_044757009.1|3511436_3513860_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	29.0	2.4e-37
WP_044757488.1|3513869_3515282_-	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_129593053.1|3515271_3515967_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_027704078.1|3515918_3516779_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_082323236.1|3516833_3519236_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	29.2	4.6e-41
WP_011407980.1|3520271_3521129_-	pirin family protein	NA	NA	NA	NA	NA
WP_011407979.1|3521360_3523433_+	carbon starvation protein A	NA	NA	NA	NA	NA
WP_005926176.1|3523432_3523657_+	putative selenoprotein	NA	NA	NA	NA	NA
WP_011258243.1|3524194_3524872_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_109181897.1|3525251_3526217_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
>prophage 27
NZ_CP013675	Xanthomonas oryzae pv. oryzae strain PXO236, complete genome	4968717	3547672	3604652	4968717	transposase	Staphylococcus_prophage(16.67%)	42	NA	NA
WP_041182545.1|3547672_3548629_-|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_044757021.1|3549302_3550433_-	PilT/PilU family type 4a pilus ATPase	NA	NA	NA	NA	NA
WP_011258220.1|3550546_3551584_-	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_011407962.1|3551947_3552640_+	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_011407961.1|3552683_3553544_+	pyrroline-5-carboxylate reductase	NA	NA	NA	NA	NA
WP_011258216.1|3555578_3556004_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_044757022.1|3556109_3556751_+	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_027703896.1|3556808_3557150_+	DUF3861 domain-containing protein	NA	NA	NA	NA	NA
WP_011258213.1|3557207_3557750_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069964948.1|3557805_3558402_+	DUF1439 domain-containing protein	NA	NA	NA	NA	NA
WP_099051294.1|3558519_3558900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407955.1|3559006_3559225_-	peptidase	NA	NA	NA	NA	NA
WP_003487757.1|3559329_3559797_-	SET domain-containing protein-lysine N-methyltransferase	NA	NA	NA	NA	NA
WP_011258211.1|3559968_3560427_+	SUF system Fe-S cluster assembly regulator	NA	NA	NA	NA	NA
WP_011258210.1|3560442_3561900_+	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_011258209.1|3562157_3562922_+	Fe-S cluster assembly ATPase SufC	NA	W5SAS9	Pithovirus	29.1	9.2e-12
WP_011258208.1|3562921_3564184_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_011258207.1|3564180_3565425_+	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	41.9	2.3e-92
WP_011258206.1|3565638_3566178_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011258205.1|3566174_3566504_+	non-heme iron oxygenase ferredoxin subunit	NA	NA	NA	NA	NA
WP_109181895.1|3568439_3569405_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_125168743.1|3570125_3570392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258802.1|3570699_3571668_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011407949.1|3571829_3572984_+	2-aminoethylphosphonate--pyruvate transaminase	NA	NA	NA	NA	NA
WP_011258200.1|3572983_3574306_+	O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase	NA	NA	NA	NA	NA
WP_041182294.1|3574633_3575596_-|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_011407947.1|3576470_3577331_+	gamma-glutamyl-gamma-aminobutyrate hydrolase family protein	NA	NA	NA	NA	NA
WP_011407946.1|3577365_3577965_+	LysE family translocator	NA	NA	NA	NA	NA
WP_011407945.1|3578031_3578967_+	homoserine O-succinyltransferase	NA	NA	NA	NA	NA
WP_044749647.1|3579303_3580680_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.8	5.4e-79
WP_012445118.1|3581859_3582828_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	1.5e-99
WP_011407609.1|3583155_3584340_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.4	1.0e-41
WP_011407940.1|3587129_3589454_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069964949.1|3589478_3591347_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	21.0	9.7e-15
WP_011258190.1|3591559_3592990_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011407938.1|3593751_3594543_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_069959772.1|3595594_3597070_-|transposase	IS5-like element ISXoo5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	66.8	1.6e-100
WP_033013356.1|3597152_3597971_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_011258183.1|3599081_3599927_+	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	31.7	8.6e-11
WP_027703789.1|3599950_3600376_-	YcxB family protein	NA	NA	NA	NA	NA
WP_041182018.1|3600648_3602565_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	30.7	8.6e-67
WP_011407237.1|3603695_3604652_-|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
>prophage 28
NZ_CP013675	Xanthomonas oryzae pv. oryzae strain PXO236, complete genome	4968717	3700528	3776784	4968717	transposase	Xanthomonas_phage(46.15%)	49	NA	NA
WP_069964958.1|3700528_3701764_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_011258091.1|3702185_3703574_-	amino acid permease	NA	NA	NA	NA	NA
WP_011258090.1|3704329_3705271_-	proline iminopeptidase-family hydrolase	NA	NA	NA	NA	NA
WP_011407882.1|3705584_3706349_-	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011407881.1|3706541_3707924_+	APC family permease	NA	NA	NA	NA	NA
WP_011258087.1|3708363_3709761_+	trypsin-like peptidase domain-containing protein	NA	NA	NA	NA	NA
WP_012445797.1|3710323_3710722_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258085.1|3710866_3711871_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_011258084.1|3711908_3713426_-	tryptophan 7-halogenase	NA	A0A1D7SEI2	Cyanophage	32.3	8.1e-52
WP_012445799.1|3713466_3714513_-	cupin-like domain-containing protein	NA	NA	NA	NA	NA
WP_027703604.1|3714523_3715276_-	SapC family protein	NA	NA	NA	NA	NA
WP_012445802.1|3715607_3718754_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011407873.1|3719812_3721819_-	M1 family metallopeptidase	NA	NA	NA	NA	NA
WP_011258079.1|3722038_3722485_-	redox-sensitive transcriptional activator SoxR	NA	NA	NA	NA	NA
WP_011258077.1|3724500_3725667_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	42.1	5.8e-74
WP_011407870.1|3725668_3726241_-	DUF1190 domain-containing protein	NA	A0A191ZBZ0	Erwinia_phage	27.7	1.1e-09
WP_011407869.1|3726253_3726658_-	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_094187792.1|3726695_3727367_-	YjfK family protein	NA	NA	NA	NA	NA
WP_027703610.1|3727369_3728452_-	potassium channel protein	NA	NA	NA	NA	NA
WP_011258072.1|3728477_3729251_-	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_012445807.1|3729263_3729680_-	YjfI family protein	NA	NA	NA	NA	NA
WP_011258070.1|3729860_3730460_-	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_011258069.1|3730626_3731169_+	shikimate kinase	NA	NA	NA	NA	NA
WP_011258068.1|3731165_3732278_+	3-dehydroquinate synthase	NA	NA	NA	NA	NA
WP_011407864.1|3732579_3732831_+	WGR domain-containing protein	NA	NA	NA	NA	NA
WP_011258066.1|3732845_3733910_+	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
WP_069964959.1|3735381_3739095_+	avirulence protein	NA	NA	NA	NA	NA
WP_012445814.1|3739363_3739558_+	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	80.6	8.8e-20
WP_011407856.1|3739561_3739861_+	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	93.5	9.9e-47
WP_069964960.1|3740084_3744533_+	avirulence protein	NA	NA	NA	NA	NA
WP_042464821.1|3744801_3744996_+	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	82.3	3.9e-20
WP_011407858.1|3744999_3745299_+	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	92.4	1.4e-45
WP_082323206.1|3745438_3748933_+	Avirulence protein AvrBs3	NA	NA	NA	NA	NA
WP_041182763.1|3749201_3749396_+	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	92.2	2.5e-19
WP_011407856.1|3749399_3749699_+	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	93.5	9.9e-47
WP_044757053.1|3749922_3754050_+	avirulence protein	NA	NA	NA	NA	NA
WP_011258057.1|3754223_3754445_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_012445821.1|3754441_3755113_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	36.8	3.1e-24
WP_012445822.1|3755134_3756004_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.0	1.2e-28
WP_082323207.1|3757335_3758292_-|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.7	2.4e-41
WP_027703881.1|3761023_3762313_+	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_011407850.1|3765703_3766153_-	azurin	NA	NA	NA	NA	NA
WP_011407846.1|3767595_3768099_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258050.1|3768123_3768549_-	cytochrome c	NA	NA	NA	NA	NA
WP_094187794.1|3768545_3770129_-	flavin monoamine oxidase family protein	NA	NA	NA	NA	NA
WP_011407842.1|3771689_3772307_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_011258048.1|3772553_3773780_-	acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	25.1	4.0e-17
WP_011258047.1|3773852_3774725_+	ion transporter	NA	NA	NA	NA	NA
WP_094187758.1|3775985_3776784_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 29
NZ_CP013675	Xanthomonas oryzae pv. oryzae strain PXO236, complete genome	4968717	3779938	3840753	4968717	transposase	Ralstonia_phage(14.29%)	51	NA	NA
WP_012445831.1|3779938_3780919_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.5	3.7e-98
WP_011407835.1|3781352_3782240_+	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	32.7	1.2e-31
WP_094187728.1|3782282_3783080_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_027704066.1|3783305_3783695_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407833.1|3783774_3784452_+	response regulator transcription factor	NA	Q6XM27	Feldmannia_irregularis_virus	27.4	7.4e-05
WP_027704076.1|3784914_3786234_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_115801876.1|3786343_3787309_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_094187715.1|3787397_3788161_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011407830.1|3788548_3789550_-	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_153296750.1|3790206_3790347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258442.1|3791424_3792660_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_153296751.1|3792840_3792990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012445839.1|3794740_3795514_+	S1/P1 nuclease	NA	NA	NA	NA	NA
WP_069965091.1|3795527_3796358_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_011407824.1|3796428_3797205_+	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_011258026.1|3797215_3797908_+	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_011407823.1|3797907_3798522_+	molybdenum ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.0	2.1e-19
WP_011407822.1|3798864_3799449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027703579.1|3799445_3800768_-	TonB family protein	NA	NA	NA	NA	NA
WP_011407820.1|3800757_3801123_-	BlaI/MecI/CopY family transcriptional regulator	NA	NA	NA	NA	NA
WP_027703580.1|3801222_3802584_-	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_044757056.1|3802601_3803300_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.0	9.8e-29
WP_044757057.1|3803322_3803985_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_011407815.1|3803965_3804805_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_011407814.1|3804804_3805479_-	iron-containing redox enzyme family protein	NA	NA	NA	NA	NA
WP_069964965.1|3805475_3806975_-	AMP-binding protein	NA	NA	NA	NA	NA
WP_069965092.1|3806914_3807619_-	thermostable hemolysin	NA	NA	NA	NA	NA
WP_011258012.1|3809906_3811082_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027703583.1|3811211_3813926_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_133264561.1|3813986_3814226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407808.1|3814245_3815238_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_011258009.1|3815240_3815957_+	M23 family metallopeptidase	NA	A0A0M5M794	Arthrobacter_phage	34.2	2.7e-05
WP_011258007.1|3816775_3818776_-	transketolase	NA	NA	NA	NA	NA
WP_027703585.1|3819002_3820283_-	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_033013273.1|3820480_3820798_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407804.1|3821093_3822851_-	membrane protein	NA	NA	NA	NA	NA
WP_027703586.1|3822847_3824665_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_011258003.1|3824661_3825669_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_011258002.1|3825665_3826127_-	DUF4381 domain-containing protein	NA	NA	NA	NA	NA
WP_011258001.1|3826129_3827092_-	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_012445859.1|3827112_3828132_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_115862288.1|3828754_3829789_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011258092.1|3829859_3831095_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_094187728.1|3831237_3832035_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011407796.1|3832106_3834056_-	type IV pilus secretin PilQ family protein	NA	NA	NA	NA	NA
WP_011257996.1|3834075_3834609_-	pilus assembly protein PilP	NA	NA	NA	NA	NA
WP_011257995.1|3834605_3835271_-	type 4a pilus biogenesis protein PilO	NA	NA	NA	NA	NA
WP_044757059.1|3835267_3836026_-	PilN domain-containing protein	NA	NA	NA	NA	NA
WP_069964966.1|3836025_3837084_-	pilus assembly protein PilM	NA	NA	NA	NA	NA
WP_094187795.1|3837206_3839729_+	penicillin-binding protein 1A	NA	NA	NA	NA	NA
WP_041182545.1|3839796_3840753_-|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
>prophage 30
NZ_CP013675	Xanthomonas oryzae pv. oryzae strain PXO236, complete genome	4968717	3910336	3974479	4968717	integrase,transposase,protease	Ralstonia_phage(20.0%)	51	3909774:3909833	3972602:3972666
3909774:3909833	attL	CCTAAGAACCTGTTCACGATCTCCTGAGCAGCAGTGCCAGGAACGCCAGGTGGATGAACT	NA	NA	NA	NA
WP_044757070.1|3910336_3911572_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_044757071.1|3912560_3914162_+	rhamnogalacturonase B	NA	NA	NA	NA	NA
WP_041182379.1|3914778_3915525_-	cellulase	NA	NA	NA	NA	NA
WP_103057268.1|3915997_3916756_-	cellulase	NA	NA	NA	NA	NA
WP_011407749.1|3917272_3917788_-	peptide deformylase	NA	NA	NA	NA	NA
WP_027703699.1|3918109_3918532_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	62.2	1.8e-41
WP_069964970.1|3919303_3921172_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407746.1|3921210_3922164_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_011257917.1|3922169_3923126_+	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_011257916.1|3923118_3925071_+	DUF3488 domain-containing transglutaminase family protein	NA	NA	NA	NA	NA
WP_011257915.1|3925067_3925601_+	Slp family lipoprotein	NA	NA	NA	NA	NA
WP_011407744.1|3925720_3926071_-	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
WP_011257913.1|3926172_3926766_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_011257912.1|3926863_3927184_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_011257911.1|3927190_3929287_-	DNA polymerase III subunit gamma/tau	NA	E7DN81	Pneumococcus_phage	40.7	4.1e-46
WP_044757073.1|3929848_3930295_-	molybdenum cofactor biosynthesis protein MoaE	NA	NA	NA	NA	NA
WP_011257909.1|3930291_3930537_-	MoaD/ThiS family protein	NA	NA	NA	NA	NA
WP_011407742.1|3930533_3931031_-	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_011257907.1|3931055_3931415_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_044757074.1|3931432_3932464_-	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
WP_011257905.1|3932463_3933213_-	MBL fold metallo-hydrolase	NA	A0A0A0RUN7	Bacillus_phage	26.0	2.4e-09
WP_011257904.1|3933212_3933962_-	3-deoxy-D-manno-octulosonic acid kinase	NA	NA	NA	NA	NA
WP_011257903.1|3933982_3935032_+	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_011257902.1|3935242_3935647_-	hypothetical protein	NA	A0A1C9C5K8	Heterosigma_akashiwo_virus	35.9	5.0e-17
WP_011407739.1|3935757_3936444_+|integrase	site-specific integrase	integrase	A0A077KET4	Ralstonia_phage	51.8	2.3e-54
WP_155296458.1|3936542_3937508_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011257899.1|3937590_3938148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075239641.1|3938209_3938473_-	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	43.4	7.5e-06
WP_044757075.1|3938469_3940164_-	DUF2875 domain-containing protein	NA	NA	NA	NA	NA
WP_069964972.1|3940160_3942368_-	DUF3274 domain-containing protein	NA	A0A077K801	Ralstonia_phage	29.7	4.5e-19
WP_044757078.1|3942687_3944385_-	DUF2875 domain-containing protein	NA	NA	NA	NA	NA
WP_059317525.1|3944381_3946532_-	DUF3274 domain-containing protein	NA	A0A077K801	Ralstonia_phage	28.2	2.0e-27
WP_069964973.1|3946599_3949323_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	30.2	1.8e-70
WP_012445927.1|3949718_3949919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407730.1|3950811_3951441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012445930.1|3952267_3952972_+	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
WP_011257889.1|3953407_3954142_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	40.4	8.7e-36
WP_011257888.1|3954150_3954603_-	ribonuclease HI	NA	A0A1Q2U2R0	Vibrio_phage	55.4	2.8e-40
WP_011257887.1|3954630_3955287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257886.1|3955299_3956067_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_041182774.1|3956063_3957242_+	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_011407728.1|3957940_3959911_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_002806049.1|3960742_3961015_-	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	64.0	2.2e-21
WP_012445937.1|3961228_3963700_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.2	1.7e-224
WP_011257881.1|3963843_3965130_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	59.9	9.0e-137
WP_002806026.1|3965254_3965881_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	57.4	1.0e-56
WP_012445939.1|3965973_3967266_-	trigger factor	NA	NA	NA	NA	NA
WP_011257875.1|3970583_3971345_+	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_011257874.1|3971488_3972496_-	isocitrate dehydrogenase	NA	NA	NA	NA	NA
WP_148648659.1|3972759_3973725_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
3972602:3972666	attR	CCTAAGAACCTGTTCACGATCTCCTGAGCAGCAGTGCCAGGAACGCCAGGTGGATGAACTGCAAG	NA	NA	NA	NA
WP_094187737.1|3973725_3974479_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 31
NZ_CP013675	Xanthomonas oryzae pv. oryzae strain PXO236, complete genome	4968717	4018852	4134233	4968717	transposase,protease	Staphylococcus_prophage(15.0%)	82	NA	NA
WP_094187715.1|4018852_4019615_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011409312.1|4021234_4021876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103057581.1|4023108_4023837_+	glycerophosphodiester phosphodiesterase family protein	NA	A0A0S2MYI4	Enterococcus_phage	37.5	1.4e-06
WP_041182297.1|4023882_4024845_-|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_094187715.1|4024949_4025712_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_012445975.1|4025706_4025949_+	glycerophosphodiester phosphodiesterase	NA	NA	NA	NA	NA
WP_011407721.1|4026497_4026959_+	cell wall hydrolase	NA	NA	NA	NA	NA
WP_011258802.1|4027219_4028188_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_094187763.1|4029584_4030383_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_069964975.1|4030624_4031239_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_011257835.1|4031321_4032308_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_011257836.1|4032423_4032918_-	peptidylprolyl isomerase	NA	A0A1V0SCU1	Indivirus	52.3	5.5e-26
WP_011257837.1|4033162_4034992_+	translational GTPase TypA	NA	NA	NA	NA	NA
WP_011407704.1|4035010_4035481_+	DUF2127 domain-containing protein	NA	NA	NA	NA	NA
WP_011257840.1|4036403_4037531_-	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_011257841.1|4037631_4039014_-	3-deoxy-7-phosphoheptulonate synthase class II	NA	NA	NA	NA	NA
WP_044757084.1|4039261_4041385_+	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_011407706.1|4041913_4042432_-	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_041182545.1|4042564_4043521_-|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_069964976.1|4045561_4046938_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	63.2	1.9e-79
WP_044756425.1|4047598_4048975_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	63.2	1.9e-79
WP_011407710.1|4049097_4049988_-|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
WP_012445986.1|4050077_4050218_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_115862291.1|4052586_4053906_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_155296469.1|4054650_4055574_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	33.4	2.6e-37
WP_094187763.1|4055761_4056559_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_115862284.1|4057500_4058820_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_094187736.1|4058936_4059699_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_155296459.1|4059788_4060754_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011257859.1|4061055_4062633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094187735.1|4062700_4063464_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_044757086.1|4063530_4064745_+|transposase	IS4 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	1.8e-54
WP_155296460.1|4066115_4066913_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011257831.1|4067885_4068770_-	membrane protein	NA	NA	NA	NA	NA
WP_027703752.1|4068916_4069513_-|protease	ATP-dependent protease	protease	NA	NA	NA	NA
WP_011257829.1|4069512_4070871_-	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_069964981.1|4071237_4071801_-	adenylate kinase	NA	A0A1B4XWI3	Tenacibaculum_phage	31.4	2.7e-13
WP_012446003.1|4071960_4073217_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_109181928.1|4073787_4074753_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_012446005.1|4074896_4075388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109182120.1|4075672_4075846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109182067.1|4075842_4076808_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011407697.1|4079053_4079536_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257818.1|4079732_4080269_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	53.6	3.6e-47
WP_094187799.1|4080415_4081531_+	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_041182545.1|4082057_4083014_-|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_094187800.1|4083203_4086173_-	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	24.9	8.7e-42
WP_011407695.1|4086218_4087112_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011407693.1|4089999_4091877_-	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_011257812.1|4093153_4094155_+	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_011257811.1|4094198_4095920_+	acetolactate synthase 2 catalytic subunit	NA	E4WLQ6	Ostreococcus_tauri_virus	32.9	6.1e-64
WP_011257810.1|4095903_4096161_+	acetolactate synthase	NA	NA	NA	NA	NA
WP_044757088.1|4096236_4097361_+	threonine dehydratase	NA	NA	NA	NA	NA
WP_011407690.1|4097357_4098920_+	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	24.4	4.3e-08
WP_011257808.1|4099250_4100324_-	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_011257807.1|4101140_4101788_-	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_011257806.1|4101855_4103304_-	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_027703665.1|4103424_4104309_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_129215563.1|4105300_4106266_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011407687.1|4106434_4106896_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257800.1|4107165_4107819_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011407686.1|4107947_4108604_+	protein-L-isoaspartate O-methyltransferase	NA	NA	NA	NA	NA
WP_011257798.1|4108624_4110004_+	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_011257797.1|4110276_4111593_-	3-deoxy-D-manno-octulosonic acid transferase	NA	NA	NA	NA	NA
WP_011257796.1|4111669_4112590_+	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferase	NA	NA	NA	NA	NA
WP_011257795.1|4112823_4114158_-	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_011407685.1|4114138_4115251_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_011257793.1|4115260_4115458_-	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_103057263.1|4115583_4116117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257791.1|4116743_4117379_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_044757089.1|4120085_4122758_-	M1 family metallopeptidase	NA	A0A0P0IY26	Acinetobacter_phage	28.0	7.5e-77
WP_044757090.1|4123084_4124377_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	37.7	4.9e-74
WP_011257785.1|4124714_4124900_-	DUF2065 family protein	NA	NA	NA	NA	NA
WP_011257784.1|4125193_4126057_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_011407680.1|4126056_4127184_-|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_011257782.1|4127813_4128200_-	response regulator	NA	W8CYM9	Bacillus_phage	31.8	9.6e-10
WP_011257781.1|4128439_4129339_-	DnaJ domain-containing protein	NA	A0A2L0UZR4	Agrobacterium_phage	27.7	5.9e-18
WP_011407679.1|4129749_4130226_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_011257779.1|4130388_4130871_+	peroxiredoxin	NA	A0A1D8KSL1	Synechococcus_phage	36.2	3.1e-21
WP_011257778.1|4130913_4131474_+	bacterioferritin	NA	NA	NA	NA	NA
WP_069964983.1|4131607_4132570_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.1	1.7e-42
WP_115801871.1|4132844_4134233_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 32
NZ_CP013675	Xanthomonas oryzae pv. oryzae strain PXO236, complete genome	4968717	4166948	4236512	4968717	transposase,tRNA	Enterobacteria_phage(12.5%)	44	NA	NA
WP_069964989.1|4166948_4167914_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_044757098.1|4168025_4170317_+	CRISPR-associated helicase/endonuclease Cas3	NA	NA	NA	NA	NA
WP_011257746.1|4170444_4171119_+	type I-C CRISPR-associated protein Cas5	NA	NA	NA	NA	NA
WP_011257745.1|4171115_4172960_+	type I-C CRISPR-associated protein Cas8c/Csd1	NA	NA	NA	NA	NA
WP_011257744.1|4172956_4173823_+	type I-C CRISPR-associated protein Cas7/Csd2	NA	NA	NA	NA	NA
WP_011257743.1|4173842_4174475_+	CRISPR-associated protein Cas4	NA	NA	NA	NA	NA
WP_011407655.1|4174477_4175512_+	type I-C CRISPR-associated endonuclease Cas1	NA	NA	NA	NA	NA
WP_011257741.1|4175526_4175817_+	CRISPR-associated endonuclease Cas2	NA	NA	NA	NA	NA
WP_011407652.1|4183118_4183958_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_011407650.1|4184568_4185726_+	phosphotransferase	NA	NA	NA	NA	NA
WP_069964990.1|4185761_4187924_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011407648.1|4188299_4188875_+	nicotinamide mononucleotide transporter	NA	NA	NA	NA	NA
WP_011257733.1|4188980_4189709_+	UTRA domain-containing protein	NA	NA	NA	NA	NA
WP_011257732.1|4190146_4190986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069959729.1|4190982_4193292_-	type II secretion system secretin GspD	NA	A7BJX1	Enterobacteria_phage	23.5	5.2e-10
WP_011407647.1|4193288_4194098_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407646.1|4194087_4194741_-	general secretion pathway protein GspM	NA	NA	NA	NA	NA
WP_011407645.1|4194724_4195846_-	PilN domain-containing protein	NA	NA	NA	NA	NA
WP_011407644.1|4195842_4196694_-	general secretion pathway protein GspK	NA	NA	NA	NA	NA
WP_011257726.1|4196690_4197326_-	type II secretion system protein J	NA	NA	NA	NA	NA
WP_011257725.1|4197322_4197739_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_011257724.1|4197735_4198245_-	type II secretion system protein GspH	NA	NA	NA	NA	NA
WP_011407642.1|4198254_4198686_-	type II secretion system major pseudopilin GspG	NA	NA	NA	NA	NA
WP_011257722.1|4198953_4200171_-	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_011407640.1|4200346_4202086_-	type II secretion system ATPase GspE	NA	NA	NA	NA	NA
WP_069964991.1|4204306_4208104_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069964992.1|4209081_4213134_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	57.1	3.4e-121
WP_011257718.1|4213532_4214330_-	DsbC family protein	NA	NA	NA	NA	NA
WP_011257717.1|4214782_4215754_-	site-specific tyrosine recombinase XerD	NA	G1JX48	Mycobacterium_phage	27.9	6.4e-18
WP_011257716.1|4216180_4216648_+	RDD family protein	NA	NA	NA	NA	NA
WP_011407635.1|4217062_4218169_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_011407634.1|4218165_4219248_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_011257713.1|4219355_4220828_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	37.2	6.2e-49
WP_011257712.1|4220827_4221133_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257711.1|4221173_4221599_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_011257710.1|4221806_4224749_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	34.8	6.4e-130
WP_133264531.1|4225685_4226787_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.7	1.2e-41
WP_075239157.1|4226969_4227287_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_155296461.1|4227337_4228657_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_012446083.1|4228869_4229838_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_155296462.1|4229974_4231363_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011257702.1|4231612_4232653_+	pectate lyase	NA	NA	NA	NA	NA
WP_099051332.1|4232919_4234965_-	transglycosylase SLT domain-containing protein	NA	A0A0H3V0Q1	Geobacillus_virus	36.7	8.2e-15
WP_115862295.1|4235192_4236512_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 33
NZ_CP013675	Xanthomonas oryzae pv. oryzae strain PXO236, complete genome	4968717	4257417	4314251	4968717	transposase	Enterobacteria_phage(20.0%)	53	NA	NA
WP_011407616.1|4257417_4258764_+	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	26.9	2.6e-33
WP_011257680.1|4258810_4260214_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	29.6	2.5e-47
WP_011257679.1|4260330_4261239_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.7	2.4e-27
WP_011257678.1|4261235_4261793_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	48.1	1.0e-44
WP_011407613.1|4261789_4262677_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	58.2	2.2e-94
WP_011407612.1|4262732_4263788_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	48.0	4.3e-84
WP_011257675.1|4264013_4264760_+	electron transfer flavoprotein subunit beta/FixA family protein	NA	NA	NA	NA	NA
WP_011257674.1|4264759_4265701_+	electron transfer flavoprotein subunit alpha/FixB family protein	NA	NA	NA	NA	NA
WP_011407611.1|4265923_4266742_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_011407610.1|4266731_4268045_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.6	3.8e-13
WP_011407609.1|4268574_4269759_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.4	1.0e-41
WP_109182077.1|4270074_4271394_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011257669.1|4271480_4272533_-	acyltransferase	NA	A9YX16	Burkholderia_phage	33.9	1.5e-41
WP_011257668.1|4272538_4273702_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_024744691.1|4273692_4273983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407606.1|4274003_4274930_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_011407605.1|4275961_4277038_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A1V0SG19	Hokovirus	21.8	4.9e-11
WP_011257666.1|4277072_4277873_-	FkbM family methyltransferase	NA	H8ZJI6	Ostreococcus_tauri_virus	28.0	3.5e-06
WP_011257665.1|4277919_4279113_-	cystathionine gamma-synthase	NA	NA	NA	NA	NA
WP_011407603.1|4279203_4280574_-	pyridoxal-phosphate dependent enzyme	NA	A0A1X9I5F1	Streptococcus_phage	38.8	2.6e-49
WP_003484103.1|4280815_4281034_-	YdcH family protein	NA	NA	NA	NA	NA
WP_011257662.1|4281375_4282266_-	membrane protein	NA	NA	NA	NA	NA
WP_011407602.1|4282262_4282646_-	DUF4398 domain-containing protein	NA	NA	NA	NA	NA
WP_011257660.1|4282738_4283878_+	PilT/PilU family type 4a pilus ATPase	NA	NA	NA	NA	NA
WP_042464484.1|4284216_4284843_-	maleylacetoacetate isomerase	NA	NA	NA	NA	NA
WP_011257658.1|4284886_4285876_-	fumarylacetoacetate hydrolase	NA	NA	NA	NA	NA
WP_019301777.1|4286037_4286163_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407600.1|4286255_4287638_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	36.3	1.4e-55
WP_027703598.1|4288050_4288404_+	6-carboxytetrahydropterin synthase QueD	NA	NA	NA	NA	NA
WP_011407598.1|4288596_4288932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407597.1|4289046_4289721_-	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_011407596.1|4290045_4290528_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_011257653.1|4290524_4290923_+	TfoX/Sxy family protein	NA	NA	NA	NA	NA
WP_011407595.1|4291234_4291885_-	phosphoglycolate phosphatase	NA	NA	NA	NA	NA
WP_011407594.1|4292026_4293106_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_075239276.1|4293105_4293453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407593.1|4293451_4293967_+	3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabA	NA	NA	NA	NA	NA
WP_011257649.1|4293966_4295175_+	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_041181965.1|4295288_4296110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407591.1|4296283_4298308_-	M3 family metallopeptidase	NA	NA	NA	NA	NA
WP_011407590.1|4298351_4299455_-	PLP-dependent cysteine synthase family protein	NA	NA	NA	NA	NA
WP_011257645.1|4299590_4300007_+	CopL family metal-binding regulatory protein	NA	NA	NA	NA	NA
WP_103057232.1|4300093_4301941_+	copper resistance system multicopper oxidase	NA	NA	NA	NA	NA
WP_011257643.1|4301937_4303044_+	copper resistance protein B	NA	NA	NA	NA	NA
WP_011407588.1|4303200_4303725_+	lactoylglutathione lyase	NA	NA	NA	NA	NA
WP_082323237.1|4303941_4304976_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	32.6	2.3e-42
WP_094187804.1|4305091_4305855_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011257639.1|4305887_4306463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257638.1|4306694_4307168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407585.1|4307549_4309379_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.5	1.3e-133
WP_011407584.1|4309586_4310858_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_011259629.1|4311063_4312299_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_109182076.1|4313285_4314251_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
>prophage 34
NZ_CP013675	Xanthomonas oryzae pv. oryzae strain PXO236, complete genome	4968717	4404607	4447693	4968717	transposase	Acinetobacter_phage(42.86%)	39	NA	NA
WP_115862297.1|4404607_4405996_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_012443955.1|4406266_4407235_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	2.5e-99
WP_155296463.1|4407384_4408704_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_153296753.1|4408774_4408939_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027703827.1|4408938_4409172_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033013369.1|4409429_4410476_+	bile acid:sodium symporter	NA	NA	NA	NA	NA
WP_044757138.1|4410659_4412240_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_011409570.1|4412628_4413525_-	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
WP_011260477.1|4413527_4414691_-	heme A synthase	NA	NA	NA	NA	NA
WP_011260478.1|4414701_4415277_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012443950.1|4415304_4416024_-	SURF1 family protein	NA	NA	NA	NA	NA
WP_012443949.1|4416084_4416303_+	twin transmembrane helix small protein	NA	NA	NA	NA	NA
WP_011260481.1|4416402_4417278_-	cytochrome c oxidase subunit 3	NA	NA	NA	NA	NA
WP_012443948.1|4417316_4417913_-	cytochrome c oxidase assembly protein	NA	NA	NA	NA	NA
WP_011409573.1|4417909_4418083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260484.1|4418063_4419668_-	cytochrome c oxidase subunit I	NA	NA	NA	NA	NA
WP_011260485.1|4419706_4420660_-	cytochrome c oxidase subunit II	NA	NA	NA	NA	NA
WP_011409574.1|4420676_4421153_-	DUF2244 domain-containing protein	NA	NA	NA	NA	NA
WP_011260487.1|4421429_4424630_+	bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase PutA	NA	NA	NA	NA	NA
WP_094187805.1|4424789_4425768_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	1.9e-38
WP_003483093.1|4426825_4427296_-	bacterioferritin	NA	NA	NA	NA	NA
WP_027703893.1|4427638_4427854_-	bacterioferritin	NA	NA	NA	NA	NA
WP_011260490.1|4427934_4428552_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_005990700.1|4429100_4429493_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_011260491.1|4429496_4429925_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_011260492.1|4430110_4430764_+	2-nonaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase	NA	NA	NA	NA	NA
WP_011409578.1|4431067_4431382_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_011260494.1|4431541_4432336_-	adenosylmethionine decarboxylase	NA	NA	NA	NA	NA
WP_011260495.1|4432473_4433166_+	CRP-like protein Clp	NA	NA	NA	NA	NA
WP_011409579.1|4433486_4434203_-	haloacid dehalogenase-like hydrolase	NA	NA	NA	NA	NA
WP_011260497.1|4434195_4434993_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	52.9	7.5e-65
WP_011409580.1|4435129_4436167_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	44.1	7.2e-76
WP_011260499.1|4436284_4436914_-	flavin reductase family protein	NA	NA	NA	NA	NA
WP_011409581.1|4437065_4437647_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	59.3	3.2e-65
WP_080493584.1|4438352_4439177_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409585.1|4440783_4443015_-	NADP-dependent isocitrate dehydrogenase	NA	NA	NA	NA	NA
WP_069960113.1|4443204_4444917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069965005.1|4445065_4446442_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.8	1.4e-79
WP_041182574.1|4446736_4447693_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.1	4.5e-40
>prophage 35
NZ_CP013675	Xanthomonas oryzae pv. oryzae strain PXO236, complete genome	4968717	4462221	4523586	4968717	integrase,transposase,tRNA	Ralstonia_phage(11.11%)	54	4456402:4456421	4526360:4526379
4456402:4456421	attL	CCAGCAGCCTGAGCGGCGAC	NA	NA	NA	NA
WP_069965006.1|4462221_4463316_-|integrase	site-specific integrase	integrase	A0A1L7DQ84	Ralstonia_phage	36.9	3.4e-52
WP_069960144.1|4463695_4463914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407506.1|4464065_4464386_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407505.1|4464578_4466453_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	35.5	1.8e-37
WP_011257505.1|4466561_4467002_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_011407504.1|4467102_4468017_+	lauroyl acyltransferase	NA	NA	NA	NA	NA
WP_011407503.1|4468216_4468738_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_011257502.1|4468980_4470114_+	GTP cyclohydrolase II RibA	NA	A0A2H4PQS2	Staphylococcus_phage	44.2	6.1e-28
WP_048488816.1|4470223_4470733_+	PH domain-containing protein	NA	NA	NA	NA	NA
WP_012443970.1|4470729_4472235_+	PH domain-containing protein	NA	NA	NA	NA	NA
WP_113090124.1|4472400_4473459_-	CDP-glycerol glycerophosphotransferase	NA	NA	NA	NA	NA
WP_011257498.1|4473459_4474284_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_044757153.1|4474481_4475759_-	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_011257496.1|4475923_4477645_-	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_011407500.1|4477695_4479009_-	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_011257494.1|4479008_4479932_-|tRNA	methionyl-tRNA formyltransferase	tRNA	NA	NA	NA	NA
WP_011257493.1|4480325_4480838_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	43.0	2.6e-18
WP_011407499.1|4480970_4482107_+	LysM peptidoglycan-binding domain-containing protein	NA	G3MBQ1	Bacillus_virus	57.1	1.7e-09
WP_011257491.1|4482178_4483321_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_011257490.1|4483363_4483837_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_041181947.1|4483877_4484600_+	DUF4339 domain-containing protein	NA	NA	NA	NA	NA
WP_011257488.1|4484641_4485916_+	RDD family protein	NA	NA	NA	NA	NA
WP_069965007.1|4486098_4488591_+	DNA topoisomerase I	NA	A0A0G2YA05	Acanthamoeba_polyphaga_mimivirus	35.1	1.9e-114
WP_011257486.1|4488601_4489165_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_011407497.1|4489388_4490162_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407496.1|4490158_4490833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407495.1|4490994_4491771_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_011257482.1|4491877_4492093_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041181946.1|4492278_4494180_-	signal peptide peptidase SppA	NA	A0A291AUM2	Sinorhizobium_phage	28.3	8.1e-09
WP_041181945.1|4494264_4495641_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_011257479.1|4496149_4496995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012443959.1|4497325_4497928_-	DUF3106 domain-containing protein	NA	NA	NA	NA	NA
WP_011257477.1|4497911_4498937_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257476.1|4499402_4501625_+	primosomal protein N'	NA	NA	NA	NA	NA
WP_011257475.1|4502027_4502543_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_115801902.1|4504859_4505825_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011407487.1|4506009_4506342_+	divalent-cation tolerance protein CutA	NA	NA	NA	NA	NA
WP_069965009.1|4506347_4508672_+	cytochrome C biogenesis protein	NA	NA	NA	NA	NA
WP_011407485.1|4509505_4509952_+	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_011257470.1|4510050_4510536_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_011407484.1|4510568_4510976_+	four helix bundle protein	NA	NA	NA	NA	NA
WP_010368143.1|4511011_4512379_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_011257468.1|4512517_4512883_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094187861.1|4512879_4513272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407482.1|4513340_4513805_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257466.1|4514750_4515692_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_027703754.1|4515838_4516354_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257464.1|4516497_4516875_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075239516.1|4517585_4518431_+	DUF3426 domain-containing protein	NA	NA	NA	NA	NA
WP_011257462.1|4518537_4518810_+	DNA-binding transcriptional regulator Fis	NA	NA	NA	NA	NA
WP_109181928.1|4519494_4520460_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_012446211.1|4520456_4520651_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044756425.1|4520709_4522086_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	63.2	1.9e-79
WP_011407237.1|4522629_4523586_-|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
4526360:4526379	attR	GTCGCCGCTCAGGCTGCTGG	NA	NA	NA	NA
>prophage 36
NZ_CP013675	Xanthomonas oryzae pv. oryzae strain PXO236, complete genome	4968717	4673603	4845114	4968717	transposase,holin,tRNA	Tupanvirus(11.11%)	118	NA	NA
WP_011257370.1|4673603_4674893_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_011407411.1|4675061_4675271_-	CsbD family protein	NA	NA	NA	NA	NA
WP_011257368.1|4675514_4675649_-	entericidin A/B family lipoprotein	NA	NA	NA	NA	NA
WP_011407410.1|4675712_4675865_-	entericidin A/B family lipoprotein	NA	NA	NA	NA	NA
WP_011407409.1|4675972_4676896_-	arginase	NA	A0A0N9R043	Chrysochromulina_ericina_virus	34.6	2.2e-28
WP_011257366.1|4677217_4677892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257365.1|4677888_4678128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257364.1|4678134_4678431_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257363.1|4678910_4679594_+	dTMP kinase	NA	K7R9G5	Vibrio_phage	33.8	1.3e-14
WP_011407408.1|4680397_4681318_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_011257361.1|4681327_4682056_-	type III pantothenate kinase	NA	NA	NA	NA	NA
WP_011257360.1|4682052_4683018_-	bifunctional biotin--[acetyl-CoA-carboxylase] synthetase/biotin operon repressor	NA	NA	NA	NA	NA
WP_012446311.1|4683375_4683687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027704119.1|4684603_4685788_-	DUF1501 domain-containing protein	NA	NA	NA	NA	NA
WP_012446313.1|4685907_4687497_-	DUF1800 domain-containing protein	NA	NA	NA	NA	NA
WP_011257356.1|4687617_4689033_-	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_002808458.1|4689062_4689746_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_033013584.1|4689817_4690120_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257354.1|4690456_4691461_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_011407403.1|4691924_4692119_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257351.1|4692869_4693445_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_011257350.1|4693503_4695027_-	catalase	NA	A0A2K9L0T1	Tupanvirus	48.0	2.2e-97
WP_069965026.1|4695717_4696188_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_012446321.1|4696149_4696338_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155296464.1|4696350_4697316_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011407399.1|4697398_4697665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257345.1|4697938_4700071_-	ATP-dependent DNA helicase DinG	NA	NA	NA	NA	NA
WP_011257344.1|4700348_4700498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407398.1|4700532_4700919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257342.1|4700920_4701772_-	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_041181934.1|4701824_4702706_+	TolB-like protein	NA	NA	NA	NA	NA
WP_069965028.1|4703328_4705863_-	iron-uptake factor	NA	NA	NA	NA	NA
WP_011407395.1|4706096_4706849_+	DNA/RNA non-specific endonuclease	NA	H6X497	Enterobacteria_phage	33.9	5.6e-22
WP_011407394.1|4706976_4707891_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011257334.1|4709163_4710156_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_011257333.1|4710820_4711279_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069965029.1|4711378_4713169_-	DUF885 domain-containing protein	NA	NA	NA	NA	NA
WP_011257330.1|4716040_4716730_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_044757561.1|4717119_4720134_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011407388.1|4720317_4721019_+	SapC family protein	NA	NA	NA	NA	NA
WP_011257326.1|4721008_4722022_+	cupin-like domain-containing protein	NA	NA	NA	NA	NA
WP_041181930.1|4722032_4723598_+	tryptophan 7-halogenase	NA	E3SL43	Synechococcus_phage	28.8	7.3e-40
WP_011257324.1|4723737_4724760_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_011257323.1|4725169_4726363_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_012446337.1|4726359_4727106_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.9	1.5e-19
WP_027703503.1|4727137_4728739_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_011257320.1|4728799_4729000_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_027703502.1|4728996_4729584_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153296754.1|4729787_4729949_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407380.1|4730069_4730342_-	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_027703501.1|4730407_4731397_+	CDF family Co(II)/Ni(II) efflux transporter DmeF	NA	NA	NA	NA	NA
WP_011257315.1|4731481_4732243_-	ferredoxin--NADP reductase	NA	NA	NA	NA	NA
WP_011257314.1|4732345_4733341_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	31.0	9.4e-25
WP_012446343.1|4733358_4734150_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_044756487.1|4734767_4735982_+|transposase	IS4-like element ISXo14 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.7	8.2e-55
WP_011260830.1|4736117_4737353_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_069965030.1|4738403_4739639_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_082323238.1|4739691_4740849_-|transposase	IS5-like element ISXoo14 family transposase	transposase	NA	NA	NA	NA
WP_094187862.1|4743482_4744584_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	4.7e-41
WP_094187782.1|4745344_4746107_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_094187814.1|4746167_4746965_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011407366.1|4747317_4747602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044757202.1|4749948_4751058_-	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_011257294.1|4751292_4751937_+	sterol-binding protein	NA	NA	NA	NA	NA
WP_011257293.1|4751933_4753607_+	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	E5EQY1	Bathycoccus_sp._RCC1105_virus	28.6	3.1e-28
WP_011257292.1|4753720_4754110_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_027703865.1|4754334_4755087_+	pseudouridylate synthase	NA	NA	NA	NA	NA
WP_012446355.1|4755182_4755725_-	DUF2059 domain-containing protein	NA	NA	NA	NA	NA
WP_011257289.1|4755817_4756249_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_011407359.1|4756251_4756881_+|holin	lysophosphatidylcholine acyltransferase	holin	NA	NA	NA	NA
WP_069965032.1|4757517_4759698_+	peptidyl-dipeptidase Dcp	NA	NA	NA	NA	NA
WP_011407357.1|4759824_4761987_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069965033.1|4762813_4763779_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_155296465.1|4763903_4764666_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_094187863.1|4766699_4767065_-	L-rhamnose mutarotase	NA	NA	NA	NA	NA
WP_069959686.1|4767061_4768363_-	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
WP_069965036.1|4768543_4769320_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_094187735.1|4769448_4770212_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011407353.1|4770612_4771197_+	manganese efflux pump MntP family protein	NA	NA	NA	NA	NA
WP_011257279.1|4771389_4774839_-	hybrid sensor histidine kinase/response regulator	NA	NA	NA	NA	NA
WP_069965037.1|4775586_4778229_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407350.1|4778332_4780732_-	NdvB protein	NA	NA	NA	NA	NA
WP_027703801.1|4780734_4782117_-	MFS transporter	NA	NA	NA	NA	NA
WP_027703800.1|4782274_4782859_+	gluconokinase	NA	NA	NA	NA	NA
WP_044757212.1|4783744_4785499_+	PQQ-binding-like beta-propeller repeat protein	NA	A0A0M4JT37	Mollivirus	35.6	7.3e-81
WP_011407345.1|4785806_4786112_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082324389.1|4786014_4786455_-	3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_011257271.1|4786474_4786903_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155296466.1|4788397_4789717_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011257031.1|4792588_4793557_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_155296467.1|4794839_4796159_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_012445230.1|4796451_4797687_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_041182821.1|4799368_4800325_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.7	3.4e-40
WP_109182027.1|4801169_4802135_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_069965040.1|4802152_4802710_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011257259.1|4802728_4803016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407332.1|4803400_4804195_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	27.8	1.7e-08
WP_011257257.1|4804194_4804944_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_012446379.1|4804955_4805507_+	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_011257255.1|4805503_4806166_+	organic solvent ABC transporter	NA	NA	NA	NA	NA
WP_011257254.1|4806155_4806446_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_011257253.1|4806456_4807515_+	VacJ family lipoprotein	NA	NA	NA	NA	NA
WP_094187817.1|4809313_4810077_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011409560.1|4810181_4811144_+|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_011407325.1|4811490_4812306_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	A0A127AWE5	Bacillus_phage	27.3	6.3e-19
WP_044757236.1|4821625_4823530_-	GAF domain-containing protein	NA	Q6XLU9	Feldmannia_irregularis_virus	27.7	3.9e-19
WP_011407319.1|4823526_4824129_-	biliverdin-producing heme oxygenase	NA	NA	NA	NA	NA
WP_011407318.1|4824188_4825493_-	tetracycline resistance MFS efflux pump	NA	NA	NA	NA	NA
WP_011257243.1|4826040_4828203_-	lytic murein transglycosylase	NA	NA	NA	NA	NA
WP_011407316.1|4828496_4828703_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257241.1|4828910_4829300_-	YchJ family protein	NA	NA	NA	NA	NA
WP_069965042.1|4830644_4831775_-	glycoside hydrolase family 5 protein	NA	NA	NA	NA	NA
WP_011257238.1|4832422_4833475_-	glycoside hydrolase family 5 protein	NA	NA	NA	NA	NA
WP_011257237.1|4834237_4835311_-	glycoside hydrolase family 5 protein	NA	NA	NA	NA	NA
WP_011407313.1|4835618_4836677_+	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	45.7	3.0e-77
WP_011407913.1|4837907_4839122_-|transposase	IS4-like element ISXo14 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	1.8e-54
WP_041182826.1|4840850_4841384_+	lipocalin family protein	NA	NA	NA	NA	NA
WP_094187728.1|4844315_4845114_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
