The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP013679	Xanthomonas oryzae pv. oryzae strain PXO602, complete genome	4951791	7736	59013	4951791	protease,transposase	Ralstonia_phage(40.0%)	42	NA	NA
WP_011407164.1|7736_8573_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_011407165.1|8759_9566_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_011257013.1|9842_11036_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_011257015.1|11944_12706_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_010364790.1|12752_13175_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_011257016.1|13178_13592_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_011407166.1|13887_14655_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_019301610.1|14665_14935_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407167.1|15009_16470_-	cardiolipin synthase	NA	NA	NA	NA	NA
WP_011257020.1|17116_18127_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	37.8	9.5e-49
WP_011257021.1|18398_19601_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_011407169.1|19742_21881_+	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	40.9	5.3e-65
WP_012443560.1|22091_22385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153296734.1|22416_22914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257024.1|23160_24141_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	55.8	1.6e-88
WP_011257025.1|24188_25355_-	FMN-dependent L-lactate dehydrogenase LldD	NA	NA	NA	NA	NA
WP_069959658.1|25501_26068_-	DUF1295 domain-containing protein	NA	NA	NA	NA	NA
WP_069959660.1|27542_28751_+	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_011257029.1|29378_30401_-	sugar kinase	NA	NA	NA	NA	NA
WP_069970062.1|31223_32192_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.9	7.3e-99
WP_125168733.1|33020_33413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103057298.1|33638_34520_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	22.6	2.5e-05
WP_012443646.1|35121_36498_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	56.9	4.1e-79
WP_012443643.1|39510_39753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012443642.1|39694_40018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257128.1|40483_41464_-|transposase	IS5-like element ISXoo7 family transposase	transposase	A0A077K814	Ralstonia_phage	55.9	5.3e-89
WP_069959662.1|42082_43372_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.9	1.0e-39
WP_011407185.1|43811_44147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407187.1|44421_44853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155296471.1|45014_45167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024743401.1|45201_46611_-	FAD-binding protein	NA	NA	NA	NA	NA
WP_041181902.1|46888_47104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257122.1|47928_48189_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027704081.1|48205_48538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080256644.1|48537_48996_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258803.1|49403_50372_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.5e-99
WP_133265185.1|50571_51891_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011407913.1|51992_53207_-|transposase	IS4-like element ISXo14 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	1.8e-54
WP_094187731.1|53727_54525_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_109182053.1|56240_57206_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_125168734.1|57202_57481_-	RHS repeat protein	NA	NA	NA	NA	NA
WP_109182054.1|57624_59013_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP013679	Xanthomonas oryzae pv. oryzae strain PXO602, complete genome	4951791	124477	171338	4951791	transposase	Ralstonia_phage(14.29%)	34	NA	NA
WP_069959667.1|124477_125428_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.6	4.4e-96
WP_143699970.1|125541_125751_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094187709.1|125818_126091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257048.1|126131_126413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069959669.1|126551_127610_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	42.5	4.9e-72
WP_011407232.1|127750_128698_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.7	6.6e-44
WP_011407233.1|128952_129264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027704036.1|130730_131201_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_011257042.1|131370_132063_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257041.1|132154_132553_+	host attachment protein	NA	NA	NA	NA	NA
WP_011407237.1|133354_134311_+|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
WP_044756192.1|134285_134756_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044756194.1|134947_136201_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_011407239.1|136546_137236_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.7	1.3e-36
WP_011257145.1|137248_138406_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_011257146.1|138418_139729_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_027703668.1|141604_141856_-	type I toxin-antitoxin system SymE family toxin	NA	NA	NA	NA	NA
WP_075239626.1|142308_142710_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_011407243.1|142733_142964_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_011407244.1|143030_143693_-	hemolysin III	NA	NA	NA	NA	NA
WP_094187820.1|143957_146366_+	DEAD/DEAH box helicase	NA	A0A1B1IUF6	uncultured_Mediterranean_phage	36.0	1.5e-07
WP_042464339.1|146362_148189_+	ribonuclease H-like domain-containing protein	NA	NA	NA	NA	NA
WP_011407248.1|148677_150822_-	avirulence protein	NA	NA	NA	NA	NA
WP_011407249.1|151012_152170_-	ROK family protein	NA	NA	NA	NA	NA
WP_042464342.1|152342_154931_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011257157.1|154941_155727_+	DUF1868 domain-containing protein	NA	NA	NA	NA	NA
WP_011407251.1|156040_157180_-	saccharopine dehydrogenase	NA	NA	NA	NA	NA
WP_011407253.1|158330_158636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042464345.1|158860_160114_-	DNA topoisomerase IB	NA	A0A0U2TSJ7	Niemeyer_virus	35.2	1.9e-38
WP_011257161.1|160170_160551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257162.1|160752_165225_+	glutamate synthase large subunit	NA	NA	NA	NA	NA
WP_011257163.1|165419_166901_+	NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_155296472.1|168138_169104_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_094187801.1|170539_171338_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP013679	Xanthomonas oryzae pv. oryzae strain PXO602, complete genome	4951791	223021	367855	4951791	tRNA,holin,transposase	Bacillus_phage(18.75%)	94	NA	NA
WP_012443704.1|223021_224926_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_075239321.1|225186_225366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069970067.1|225499_225967_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257199.1|226124_227084_+	pyridoxal-phosphate dependent enzyme	NA	NA	NA	NA	NA
WP_044756223.1|227068_227686_+	YdcF family protein	NA	NA	NA	NA	NA
WP_011257200.1|227728_228148_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012443706.1|228400_229306_-	lipid A hydroxylase LpxO	NA	S4VR59	Pandoravirus	39.5	2.6e-37
WP_011257202.1|229554_230439_-	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_011257203.1|230502_231285_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_011407292.1|231329_232091_-	pimeloyl-ACP methyl ester esterase BioH	NA	NA	NA	NA	NA
WP_011257206.1|232254_232584_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082323350.1|232902_233994_+	DUF4380 domain-containing protein	NA	NA	NA	NA	NA
WP_011407294.1|234062_235661_+	glucan biosynthesis protein D	NA	NA	NA	NA	NA
WP_011407295.1|235825_237070_-	GAF domain-containing sensor histidine kinase	NA	NA	NA	NA	NA
WP_011257210.1|237521_238151_-	thymidine kinase	NA	A0A023W530	Serratia_phage	55.0	3.3e-52
WP_011257211.1|238357_240334_+	AAA family ATPase	NA	A7KV33	Bacillus_phage	37.2	1.1e-112
WP_011407298.1|241720_242386_-	DUF480 domain-containing protein	NA	NA	NA	NA	NA
WP_011257214.1|242672_243683_+	5'-nucleotidase, lipoprotein e(P4) family	NA	NA	NA	NA	NA
WP_011257215.1|243679_244411_+	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_011257216.1|244764_246294_-	tryptophan 7-halogenase	NA	M4T1E3	Cyanophage	28.7	1.0e-46
WP_011407300.1|246403_249436_-	membrane protein	NA	NA	NA	NA	NA
WP_011257218.1|249734_252773_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011257219.1|252937_253990_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_075240491.1|254158_254404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407301.1|254402_255368_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257221.1|255367_258028_+	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_011257222.1|259846_260065_-	YdcH family protein	NA	NA	NA	NA	NA
WP_012446407.1|262626_263112_+	rhamnogalacturonan acetylesterase	NA	NA	NA	NA	NA
WP_109182060.1|263143_263470_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_011257226.1|263691_264336_-	DUF4375 domain-containing protein	NA	NA	NA	NA	NA
WP_011257227.1|264476_265367_-	phenylalanine 4-monooxygenase	NA	NA	NA	NA	NA
WP_011407307.1|265494_265977_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_011257232.1|269012_269546_-	lipocalin family protein	NA	NA	NA	NA	NA
WP_011407313.1|272361_273420_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	45.7	3.0e-77
WP_011257237.1|273727_274801_+	glycoside hydrolase family 5 protein	NA	NA	NA	NA	NA
WP_011257238.1|275563_276616_+	glycoside hydrolase family 5 protein	NA	NA	NA	NA	NA
WP_011257239.1|277263_278394_+	glycoside hydrolase family 5 protein	NA	NA	NA	NA	NA
WP_011257241.1|279717_280107_+	YchJ family protein	NA	NA	NA	NA	NA
WP_011407316.1|280314_280521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407671.1|280752_281721_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	6.6e-100
WP_011257243.1|281974_284137_+	lytic murein transglycosylase	NA	NA	NA	NA	NA
WP_011407318.1|284684_285989_+	tetracycline resistance MFS efflux pump	NA	NA	NA	NA	NA
WP_011407319.1|286048_286651_+	biliverdin-producing heme oxygenase	NA	NA	NA	NA	NA
WP_011257245.1|286647_288552_+	GAF domain-containing protein	NA	Q6XLU9	Feldmannia_irregularis_virus	27.7	3.9e-19
WP_155296473.1|295887_296996_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.6	6.3e-38
WP_155296474.1|297429_297546_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407325.1|299230_300046_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	A0A127AWE5	Bacillus_phage	27.3	6.3e-19
WP_069970072.1|300204_301161_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	4.8e-42
WP_094187715.1|302541_303304_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011257253.1|305102_306161_-	VacJ family lipoprotein	NA	NA	NA	NA	NA
WP_069970073.1|306171_306462_-	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_011257255.1|306451_307114_-	organic solvent ABC transporter	NA	NA	NA	NA	NA
WP_012446379.1|307110_307662_-	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_011257257.1|307673_308423_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_011407332.1|308422_309217_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	27.8	1.7e-08
WP_011257259.1|309601_309889_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044757224.1|309907_310465_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_115862304.1|310482_311448_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_069959685.1|312292_313249_+|transposase	IS30-like element IS1112 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.9e-41
WP_109182012.1|313320_314083_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_109182062.1|314122_314921_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011407338.1|315052_316267_+|transposase	IS4 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	4.1e-54
WP_117231476.1|316326_317157_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011257269.1|317319_318555_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_011257271.1|319952_320381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082324389.1|320400_320841_+	3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_011407345.1|320743_321049_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407346.1|321356_323111_-	PQQ-binding-like beta-propeller repeat protein	NA	A0A0M4JT37	Mollivirus	35.6	7.3e-81
WP_109182012.1|324081_324844_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_027703800.1|324897_325482_-	gluconokinase	NA	NA	NA	NA	NA
WP_011407349.1|325639_327022_+	MFS transporter	NA	NA	NA	NA	NA
WP_044757567.1|327024_329424_+	NdvB protein	NA	NA	NA	NA	NA
WP_011407351.1|329527_332170_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257279.1|332917_336367_+	hybrid sensor histidine kinase/response regulator	NA	NA	NA	NA	NA
WP_011407353.1|336559_337144_-	manganese efflux pump MntP family protein	NA	NA	NA	NA	NA
WP_011407354.1|337620_338397_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_069959686.1|338577_339879_+	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
WP_094187863.1|339875_340241_+	L-rhamnose mutarotase	NA	NA	NA	NA	NA
WP_011257284.1|340677_342159_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	66.0	2.7e-100
WP_109182027.1|342351_343317_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011407357.1|344143_346306_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069959687.1|346432_348601_-	peptidyl-dipeptidase Dcp	NA	NA	NA	NA	NA
WP_011257288.1|349238_349868_-|holin	lysophosphatidylcholine acyltransferase	holin	NA	NA	NA	NA
WP_011257289.1|349870_350302_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_094187815.1|350394_350937_+	DUF2059 domain-containing protein	NA	NA	NA	NA	NA
WP_027703865.1|351032_351785_-	pseudouridylate synthase	NA	NA	NA	NA	NA
WP_011257292.1|352009_352399_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_011257293.1|352512_354186_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	E5EQY1	Bathycoccus_sp._RCC1105_virus	28.6	3.1e-28
WP_044757204.1|354182_354827_-	sterol-binding protein	NA	NA	NA	NA	NA
WP_011407366.1|358511_358796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_115801865.1|359147_359946_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_094187710.1|360005_360769_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_109182067.1|364722_365688_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_042464374.1|366748_367855_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP013679	Xanthomonas oryzae pv. oryzae strain PXO602, complete genome	4951791	778402	814721	4951791	tRNA,transposase	Enterobacteria_phage(36.36%)	32	NA	NA
WP_109182077.1|778402_779722_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011407609.1|780037_781222_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.4	1.0e-41
WP_011407610.1|781751_783065_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.6	3.8e-13
WP_011407611.1|783054_783873_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_069959723.1|784095_785037_-	electron transfer flavoprotein subunit alpha/FixB family protein	NA	NA	NA	NA	NA
WP_011257675.1|785036_785783_-	electron transfer flavoprotein subunit beta/FixA family protein	NA	NA	NA	NA	NA
WP_011407612.1|786008_787064_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	48.0	4.3e-84
WP_011407613.1|787119_788007_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	58.2	2.2e-94
WP_011407614.1|788003_788561_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	47.5	2.3e-44
WP_011407615.1|788557_789466_+	dTDP-4-dehydrorhamnose reductase	NA	I7HXC9	Enterobacteria_phage	35.1	1.8e-27
WP_011257680.1|789582_790986_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	29.6	2.5e-47
WP_011407616.1|791032_792379_-	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	26.9	2.6e-33
WP_011407617.1|792512_793244_+	CoA transferase subunit A	NA	NA	NA	NA	NA
WP_011257683.1|793243_793873_+	CoA transferase subunit B	NA	NA	NA	NA	NA
WP_011407618.1|793930_796018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012446093.1|796014_797664_-	electron transfer flavoprotein-ubiquinone oxidoreductase	NA	NA	NA	NA	NA
WP_011257686.1|797779_798388_+	alpha-ketoglutarate-dependent dioxygenase AlkB	NA	A0A2K9L0M4	Tupanvirus	31.4	1.8e-23
WP_011257687.1|798938_799583_-	ABC transporter	NA	NA	NA	NA	NA
WP_044757110.1|799579_800506_-	MCE family protein	NA	NA	NA	NA	NA
WP_011257689.1|800508_801351_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	30.1	9.1e-13
WP_011407620.1|801436_802549_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_011257691.1|802718_803978_+	threonine/serine exporter	NA	NA	NA	NA	NA
WP_011407621.1|804039_804501_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_011257693.1|804643_806338_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_011257694.1|806449_806854_-	DUF4124 domain-containing protein	NA	NA	NA	NA	NA
WP_011407623.1|806985_807759_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_011257696.1|807769_808237_+	alanine acetyltransferase	NA	NA	NA	NA	NA
WP_011257697.1|808242_808716_+	ribosomal-protein-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_109182079.1|809274_810594_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_109182080.1|810751_812071_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011407627.1|812283_813252_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	9.6e-99
WP_109182081.1|813401_814721_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP013679	Xanthomonas oryzae pv. oryzae strain PXO602, complete genome	4951791	881100	925002	4951791	protease,transposase	Ralstonia_phage(25.0%)	39	NA	NA
WP_129593129.1|881100_882066_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011257750.1|882456_883032_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_011407659.1|883144_883654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010368401.1|883752_883947_+	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_011257752.1|884036_885014_+	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_011257753.1|885243_885684_+	MEKHLA domain-containing protein	NA	NA	NA	NA	NA
WP_011257754.1|885961_886906_+	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_069959731.1|886988_887732_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	29.7	3.1e-12
WP_010368407.1|887936_888176_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	44.6	5.9e-10
WP_011407661.1|888317_889553_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_011407662.1|889723_891079_+	aminodeoxychorismate synthase component I	NA	NA	NA	NA	NA
WP_011257758.1|891139_892213_+	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_069959732.1|892209_893169_+	DNA polymerase III subunit delta'	NA	NA	NA	NA	NA
WP_011257760.1|893165_893519_+	type IV fimbriae assembly protein	NA	NA	NA	NA	NA
WP_112998597.1|894209_895004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_128415345.1|895097_895283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407665.1|895365_895692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041181972.1|895927_897526_-	propionate catabolism operon regulatory protein PrpR	NA	NA	NA	NA	NA
WP_011257763.1|897671_898568_+	methylisocitrate lyase	NA	NA	NA	NA	NA
WP_011407667.1|898643_899798_+	2-methylcitrate synthase	NA	NA	NA	NA	NA
WP_011257765.1|899992_902584_+	Fe/S-dependent 2-methylisocitrate dehydratase AcnD	NA	NA	NA	NA	NA
WP_011407669.1|902906_903044_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069959733.1|903316_904522_+	2-methylaconitate cis-trans isomerase PrpF	NA	NA	NA	NA	NA
WP_011409545.1|904971_905940_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011407672.1|906181_908398_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011407673.1|908476_909475_+	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_103057250.1|909584_909767_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257772.1|910746_913734_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_041182786.1|913908_914856_+	glycerophosphodiester phosphodiesterase family protein	NA	M1HTS7	Paramecium_bursaria_Chlorella_virus	28.5	4.9e-07
WP_011407676.1|915354_915891_+	hypothetical protein	NA	NA	NA	NA	NA
WP_133265185.1|915961_917281_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_041182785.1|917625_918588_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.8	1.5e-43
WP_012446027.1|918721_919282_-	bacterioferritin	NA	NA	NA	NA	NA
WP_011257779.1|919324_919807_-	peroxiredoxin	NA	A0A1D8KSL1	Synechococcus_phage	36.2	3.1e-21
WP_011407679.1|919969_920446_+	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_011257781.1|920856_921756_+	DnaJ domain-containing protein	NA	A0A2L0UZR4	Agrobacterium_phage	27.7	5.9e-18
WP_011257782.1|921995_922382_+	response regulator	NA	W8CYM9	Bacillus_phage	31.8	9.6e-10
WP_011407680.1|923011_924139_+|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_027703756.1|924138_925002_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
>prophage 7
NZ_CP013679	Xanthomonas oryzae pv. oryzae strain PXO602, complete genome	4951791	930302	1082802	4951791	protease,integrase,transposase	Ralstonia_phage(18.52%)	114	1067413:1067433	1082881:1082901
WP_011257788.1|930302_931085_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011407683.1|931195_932572_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	54.8	1.7e-77
WP_011257791.1|932815_933451_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_103057263.1|934077_934611_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258529.1|934794_935763_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	8.7e-100
WP_011257793.1|935896_936094_+	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_011407685.1|936103_937216_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_069960160.1|937196_938531_+	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_011257796.1|938764_939685_-	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferase	NA	NA	NA	NA	NA
WP_011257797.1|939761_941078_+	3-deoxy-D-manno-octulosonic acid transferase	NA	NA	NA	NA	NA
WP_011257798.1|941350_942730_-	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_011407686.1|942750_943407_-	protein-L-isoaspartate O-methyltransferase	NA	NA	NA	NA	NA
WP_011257800.1|943535_944189_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011407687.1|944459_944921_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069960069.1|945980_946865_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011257806.1|946985_948434_+	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_011257807.1|948501_949149_+	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_011257808.1|949965_951039_+	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_011407690.1|951369_952932_-	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	24.4	4.3e-08
WP_011407691.1|952928_954053_-	threonine dehydratase	NA	NA	NA	NA	NA
WP_011257810.1|954128_954386_-	acetolactate synthase	NA	NA	NA	NA	NA
WP_011257811.1|954369_956091_-	acetolactate synthase 2 catalytic subunit	NA	E4WLQ6	Ostreococcus_tauri_virus	32.9	6.1e-64
WP_011257812.1|956134_957136_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_011407693.1|958412_960290_+	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_011407694.1|960715_963067_+	biopolymer transporter Tol	NA	NA	NA	NA	NA
WP_011407695.1|963177_964071_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_094187800.1|964116_967086_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	24.9	8.7e-42
WP_094187799.1|967700_968816_-	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_011257818.1|968962_969499_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	53.6	3.6e-47
WP_011407697.1|969695_970178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109182067.1|972453_973419_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_109182120.1|973415_973589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012446005.1|973873_974365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257827.1|976043_977300_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_011257828.1|977459_978023_+	adenylate kinase	NA	A0A1B4XWI3	Tenacibaculum_phage	31.4	3.6e-13
WP_011257829.1|978389_979748_+	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_027703752.1|979747_980344_+|protease	ATP-dependent protease	protease	NA	NA	NA	NA
WP_011257831.1|980490_981375_+	membrane protein	NA	NA	NA	NA	NA
WP_011257834.1|983356_983971_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_011257835.1|984053_985040_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_011257836.1|985155_985650_-	peptidylprolyl isomerase	NA	A0A1V0SCU1	Indivirus	52.3	5.5e-26
WP_011257837.1|985894_987724_+	translational GTPase TypA	NA	NA	NA	NA	NA
WP_011407704.1|987742_988213_+	DUF2127 domain-containing protein	NA	NA	NA	NA	NA
WP_011257840.1|989135_990263_-	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_011257841.1|990363_991746_-	3-deoxy-7-phosphoheptulonate synthase class II	NA	NA	NA	NA	NA
WP_011257842.1|991993_994117_+	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_011407706.1|994645_995164_-	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_115801872.1|995869_996971_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	1.6e-41
WP_011257570.1|997486_998722_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011407710.1|999335_1000226_-|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
WP_012445986.1|1000315_1000456_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_011407713.1|1004015_1005251_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_109182089.1|1006233_1007553_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_041182948.1|1008298_1009222_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	33.1	1.3e-36
WP_109182121.1|1010284_1011250_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011257859.1|1011551_1013129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094187735.1|1013196_1013960_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011257031.1|1016628_1017597_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_011407721.1|1017857_1018319_-	cell wall hydrolase	NA	NA	NA	NA	NA
WP_011257866.1|1018867_1019110_-	glycerophosphodiester phosphodiesterase	NA	NA	NA	NA	NA
WP_109182012.1|1019103_1019867_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_049756327.1|1019899_1020631_-	glycerophosphodiester phosphodiesterase family protein	NA	A0A0S2MYI4	Enterococcus_phage	37.5	1.1e-06
WP_109182091.1|1022450_1023203_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_109181928.1|1023204_1024170_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011257874.1|1024433_1025441_+	isocitrate dehydrogenase	NA	NA	NA	NA	NA
WP_011257875.1|1025584_1026346_-	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_012445939.1|1029663_1030956_+	trigger factor	NA	NA	NA	NA	NA
WP_002806026.1|1031048_1031675_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	57.4	1.0e-56
WP_011257881.1|1031799_1033086_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	59.9	9.0e-137
WP_012445937.1|1033229_1035701_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.2	1.7e-224
WP_002806049.1|1035914_1036187_+	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	64.0	2.2e-21
WP_011407728.1|1037018_1038989_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_011407729.1|1039694_1040873_-	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_011257886.1|1040869_1041637_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_011257887.1|1041649_1042306_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257888.1|1042333_1042786_+	ribonuclease HI	NA	A0A1Q2U2R0	Vibrio_phage	55.4	2.8e-40
WP_011257889.1|1042794_1043529_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	40.4	8.7e-36
WP_011257891.1|1043964_1044669_-	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
WP_041181989.1|1045494_1046124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012445927.1|1047015_1047216_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069963830.1|1047611_1050335_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	30.0	1.1e-70
WP_069960070.1|1050402_1052553_+	DUF3274 domain-containing protein	NA	A0A077K801	Ralstonia_phage	28.2	2.0e-27
WP_044757078.1|1052549_1054247_+	DUF2875 domain-containing protein	NA	NA	NA	NA	NA
WP_011257897.1|1054566_1056771_+	DUF3274 domain-containing protein	NA	A0A077K801	Ralstonia_phage	29.7	5.9e-19
WP_069970082.1|1056767_1058462_+	DUF2875 domain-containing protein	NA	NA	NA	NA	NA
WP_075239641.1|1058458_1058722_+	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	43.4	7.5e-06
WP_011257899.1|1058783_1059341_+	hypothetical protein	NA	NA	NA	NA	NA
WP_115862289.1|1059423_1060389_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_069970176.1|1060487_1061174_-|integrase	site-specific integrase	integrase	A0A077KET4	Ralstonia_phage	51.8	1.0e-54
WP_011257902.1|1061284_1061689_+	hypothetical protein	NA	A0A1C9C5K8	Heterosigma_akashiwo_virus	35.9	5.0e-17
WP_011407740.1|1061899_1062949_-	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_011257904.1|1062969_1063719_+	3-deoxy-D-manno-octulosonic acid kinase	NA	NA	NA	NA	NA
WP_011257905.1|1063718_1064468_+	MBL fold metallo-hydrolase	NA	A0A0A0RUN7	Bacillus_phage	26.0	2.4e-09
WP_011257906.1|1064467_1065499_+	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
WP_011257907.1|1065516_1065876_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_011407742.1|1065900_1066398_+	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_011257909.1|1066394_1066640_+	MoaD/ThiS family protein	NA	NA	NA	NA	NA
WP_011257910.1|1066636_1067083_+	molybdenum cofactor biosynthesis protein MoaE	NA	NA	NA	NA	NA
1067413:1067433	attL	AATCTGGCGGAGAGAGGGGGA	NA	NA	NA	NA
WP_069970083.1|1067906_1068236_+	helix-turn-helix domain-containing protein	NA	A0A139ZPK3	Marinitoga_camini_virus	45.9	7.7e-08
WP_069970084.1|1068228_1069056_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_082323361.1|1069148_1069553_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_155296475.1|1069587_1070796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069970087.1|1070813_1072151_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_069970177.1|1072335_1072527_-	antitoxin VbhA family protein	NA	NA	NA	NA	NA
WP_155296476.1|1072654_1072876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082323424.1|1072990_1073320_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078537162.1|1073631_1073982_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_082323362.1|1074129_1075383_+	SIR2 family protein	NA	NA	NA	NA	NA
WP_069970089.1|1075379_1077224_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_082323363.1|1077213_1077426_+	KTSC domain-containing protein	NA	A0A0K1LMB5	Caulobacter_phage	50.7	1.4e-10
WP_069970090.1|1077456_1078272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069970091.1|1078693_1080286_+	plasmid mobilization protein	NA	NA	NA	NA	NA
WP_069970092.1|1080625_1081315_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082323364.1|1081311_1082802_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
1082881:1082901	attR	AATCTGGCGGAGAGAGGGGGA	NA	NA	NA	NA
>prophage 8
NZ_CP013679	Xanthomonas oryzae pv. oryzae strain PXO602, complete genome	4951791	1100827	1166682	4951791	transposase	Bacillus_phage(28.57%)	56	NA	NA
WP_011257570.1|1100827_1102063_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011258802.1|1102891_1103860_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_075241901.1|1104327_1104678_-	DUF4433 domain-containing protein	NA	NA	NA	NA	NA
WP_143681429.1|1104759_1106079_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011407757.1|1106122_1106458_-	DUF4433 domain-containing protein	NA	NA	NA	NA	NA
WP_011257932.1|1106789_1107716_-	Grx4 family monothiol glutaredoxin	NA	NA	NA	NA	NA
WP_011257933.1|1107776_1108553_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_011407759.1|1108854_1109526_-	methyltransferase	NA	NA	NA	NA	NA
WP_011407760.1|1109848_1110487_-	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_011257936.1|1110486_1111758_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_011257937.1|1111911_1113003_+	ribosome small subunit-dependent GTPase A	NA	NA	NA	NA	NA
WP_011257938.1|1113002_1114265_+	flavohemoglobin expression-modulating QEGLA motif protein	NA	NA	NA	NA	NA
WP_011407761.1|1114417_1115098_+	type 1 glutamine amidotransferase domain-containing protein	NA	NA	NA	NA	NA
WP_011407762.1|1115264_1117181_-	amylosucrase	NA	NA	NA	NA	NA
WP_011407763.1|1117215_1119660_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_011407764.1|1119929_1121261_+	MFS transporter	NA	NA	NA	NA	NA
WP_011407765.1|1121501_1122533_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_011407766.1|1122773_1123514_-	acetoacetyl-CoA reductase	NA	NA	NA	NA	NA
WP_011257945.1|1123625_1124954_-	CitMHS family transporter	NA	NA	NA	NA	NA
WP_011407767.1|1125181_1126375_-	porin	NA	NA	NA	NA	NA
WP_011407768.1|1126630_1127332_+	response regulator	NA	NA	NA	NA	NA
WP_069970094.1|1127324_1128710_+	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	23.7	8.3e-11
WP_011407770.1|1128709_1129759_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_011257949.1|1129798_1130437_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_069970095.1|1130637_1131492_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_011407771.1|1131488_1132127_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_011257953.1|1132435_1133338_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011257955.1|1133329_1134109_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_143677753.1|1134105_1135428_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	36.3	1.5e-62
WP_069970096.1|1135770_1138416_-	response regulator	NA	B5LWN0	Feldmannia_species_virus	28.1	4.4e-13
WP_011407774.1|1138737_1139910_-	porin	NA	NA	NA	NA	NA
WP_011407775.1|1140200_1141574_+	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_011257960.1|1141771_1144081_+	NADP-dependent malic enzyme	NA	NA	NA	NA	NA
WP_155296477.1|1144809_1145911_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.3	2.2e-43
WP_012445878.1|1147342_1147966_-	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_011257965.1|1147989_1148229_+	rubredoxin	NA	NA	NA	NA	NA
WP_011257966.1|1148278_1149160_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_011407780.1|1149309_1149759_-	DUF192 domain-containing protein	NA	NA	NA	NA	NA
WP_011407781.1|1149909_1150557_-	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
WP_011257969.1|1150648_1151119_-	EVE domain-containing protein	NA	NA	NA	NA	NA
WP_011407783.1|1151115_1151706_-	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_011257971.1|1152314_1152614_-	cell division protein ZapA	NA	NA	NA	NA	NA
WP_011407784.1|1152610_1152832_-	TIGR02449 family protein	NA	NA	NA	NA	NA
WP_011407785.1|1153067_1153610_+	YecA family protein	NA	NA	NA	NA	NA
WP_011257974.1|1153620_1154961_+	M24 family metallopeptidase	NA	NA	NA	NA	NA
WP_094187736.1|1155668_1156432_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011257975.1|1156664_1157990_-	Xaa-Pro dipeptidase	NA	NA	NA	NA	NA
WP_011257976.1|1158188_1158536_-	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_011407789.1|1158532_1160941_-	DUF1631 domain-containing protein	NA	NA	NA	NA	NA
WP_011257978.1|1161119_1162277_-	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_011257979.1|1162292_1162892_-	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	C6K8R3	Cassava_brown_streak_virus	34.8	3.8e-13
WP_011257980.1|1162888_1163284_-	glyoxalase	NA	NA	NA	NA	NA
WP_011257981.1|1163280_1164006_-	ribonuclease PH	NA	NA	NA	NA	NA
WP_011257982.1|1164115_1164976_+	YicC family protein	NA	NA	NA	NA	NA
WP_011257983.1|1165092_1165704_+	guanylate kinase	NA	A0A218KC48	Bacillus_phage	30.9	3.1e-10
WP_099051298.1|1165884_1166682_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_CP013679	Xanthomonas oryzae pv. oryzae strain PXO602, complete genome	4951791	1175113	1239262	4951791	transposase	Leptospira_phage(14.29%)	51	NA	NA
WP_115801874.1|1175113_1176433_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011407794.1|1176796_1177447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094187795.1|1177756_1180279_-	penicillin-binding protein 1A	NA	NA	NA	NA	NA
WP_011407795.1|1180401_1181460_+	pilus assembly protein PilM	NA	NA	NA	NA	NA
WP_011257994.1|1181459_1182218_+	PilN domain-containing protein	NA	NA	NA	NA	NA
WP_011257995.1|1182214_1182880_+	type 4a pilus biogenesis protein PilO	NA	NA	NA	NA	NA
WP_011257996.1|1182876_1183410_+	pilus assembly protein PilP	NA	NA	NA	NA	NA
WP_011407796.1|1183429_1185379_+	type IV pilus secretin PilQ family protein	NA	NA	NA	NA	NA
WP_155296478.1|1185449_1186248_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011257854.1|1186390_1187626_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_082323365.1|1187696_1188731_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	41.7	1.1e-65
WP_069963832.1|1189353_1190373_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_069959745.1|1190393_1191356_+	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_011407801.1|1191358_1191820_+	DUF4381 domain-containing protein	NA	NA	NA	NA	NA
WP_011407802.1|1191816_1192824_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_069959746.1|1192820_1194623_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_011407804.1|1194619_1196377_+	membrane protein	NA	NA	NA	NA	NA
WP_033013273.1|1196672_1196990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103057328.1|1197187_1198468_+	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_011258007.1|1198687_1200688_+	transketolase	NA	NA	NA	NA	NA
WP_069959747.1|1201506_1202214_-	M23 family metallopeptidase	NA	A0A0M5M794	Arthrobacter_phage	34.2	2.6e-05
WP_011407808.1|1202216_1203209_-	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_042464574.1|1203528_1206243_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011407810.1|1206362_1207538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042464577.1|1207672_1209631_-	acetyl-CoA hydrolase	NA	NA	NA	NA	NA
WP_069960293.1|1209806_1210454_+	thermostable hemolysin	NA	NA	NA	NA	NA
WP_011407813.1|1210450_1211950_+	AMP-binding protein	NA	NA	NA	NA	NA
WP_011407814.1|1211946_1212621_+	iron-containing redox enzyme family protein	NA	NA	NA	NA	NA
WP_069959748.1|1212620_1213460_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_011407818.1|1214126_1214825_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.0	9.8e-29
WP_041182938.1|1214842_1216204_+	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_011407820.1|1216303_1216669_+	BlaI/MecI/CopY family transcriptional regulator	NA	NA	NA	NA	NA
WP_069959749.1|1216658_1217975_+	TonB family protein	NA	NA	NA	NA	NA
WP_011407822.1|1217971_1218556_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407823.1|1218898_1219513_-	molybdenum ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.0	2.1e-19
WP_011258026.1|1219512_1220205_-	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_069959750.1|1220215_1220992_-	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_011258028.1|1221062_1221893_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_069959751.1|1221906_1222680_-	S1/P1 nuclease	NA	NA	NA	NA	NA
WP_153296750.1|1225753_1225894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407830.1|1226550_1227552_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_109181945.1|1227939_1228702_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_115801876.1|1228791_1229757_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_027704076.1|1229866_1231186_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_011407833.1|1231648_1232326_-	response regulator transcription factor	NA	Q6XM27	Feldmannia_irregularis_virus	27.4	7.4e-05
WP_027704066.1|1232405_1232795_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407835.1|1233007_1233895_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	32.7	1.2e-31
WP_069970099.1|1234328_1235312_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.5	2.0e-99
WP_011407838.1|1235485_1237573_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_011407839.1|1237724_1238384_+	serine/threonine protein kinase	NA	NA	NA	NA	NA
WP_094187758.1|1238464_1239262_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 10
NZ_CP013679	Xanthomonas oryzae pv. oryzae strain PXO602, complete genome	4951791	1258198	1313985	4951791	tRNA,transposase	Xanthomonas_phage(84.62%)	50	NA	NA
WP_011258055.1|1258198_1259068_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	1.4e-29
WP_011258056.1|1259089_1259761_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	38.9	5.2e-27
WP_011258057.1|1259757_1259979_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_041182003.1|1260152_1263161_-	avirulence protein	NA	NA	NA	NA	NA
WP_011408491.1|1263384_1263684_-	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	91.3	1.9e-45
WP_041182100.1|1263687_1263882_-	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	80.6	2.5e-19
WP_069959754.1|1264150_1267462_-	Avirulence protein AvrBs3	NA	NA	NA	NA	NA
WP_041182759.1|1267685_1267985_-	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	91.3	9.3e-45
WP_041182100.1|1267988_1268183_-	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	80.6	2.5e-19
WP_153296744.1|1268249_1268396_-	hypothetical protein	NA	Q38057	Xanthomonas_phage	78.4	6.4e-07
WP_011408408.1|1273085_1273385_-	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	92.4	6.4e-46
WP_041182100.1|1273388_1273583_-	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	80.6	2.5e-19
WP_082323370.1|1273851_1277649_-	avirulence protein	NA	NA	NA	NA	NA
WP_109181945.1|1278869_1279633_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011408516.1|1279763_1280276_+	hypothetical protein	NA	NA	NA	NA	NA
WP_125168752.1|1280889_1281213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258188.1|1281389_1282358_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_109181946.1|1282876_1283640_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_125168751.1|1283709_1284021_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408511.1|1284142_1284325_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069970101.1|1284449_1285079_-	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	80.6	2.5e-71
WP_011408508.1|1285390_1285603_+	hypothetical protein	NA	A0A1D6ZIV2	Xanthomonas_phage	100.0	1.6e-27
WP_080496434.1|1285755_1286796_+	inovirus-type Gp2 protein	NA	A0A1D6ZIT9	Xanthomonas_phage	99.1	7.7e-203
WP_069959850.1|1286792_1287089_+	DNA-binding protein	NA	A0A1W6DXU2	Xanthomonas_phage	100.0	2.8e-49
WP_042464854.1|1287092_1287296_+	hypothetical protein	NA	A0A1D6ZIU2	Xanthomonas_phage	100.0	9.8e-30
WP_011347634.1|1287307_1287538_+	hypothetical protein	NA	A0A1W6DXZ2	Xanthomonas_phage	100.0	2.2e-30
WP_069959849.1|1287674_1289081_+	hypothetical protein	NA	A0A1W6DXV5	Xanthomonas_phage	99.6	7.9e-235
WP_011408503.1|1289080_1289410_+	DUF2523 domain-containing protein	NA	A0A1D6ZIU0	Xanthomonas_phage	100.0	3.8e-55
WP_069959848.1|1289409_1290603_+	hypothetical protein	NA	A0A1W6DXR3	Xanthomonas_phage	100.0	5.5e-221
WP_069959847.1|1290604_1291252_+	conjugal transfer protein	NA	A0A1W6DY89	Xanthomonas_phage	100.0	2.7e-121
WP_069959846.1|1291412_1291706_+	hypothetical protein	NA	A0A1W6DXU7	Xanthomonas_phage	100.0	3.4e-47
WP_113085484.1|1291761_1291974_+	hypothetical protein	NA	A0A1W6DXJ1	Xanthomonas_phage	100.0	2.4e-26
WP_069959845.1|1291998_1292310_-	chloride channel protein	NA	A0A1W6DXV7	Xanthomonas_phage	100.0	1.8e-54
WP_075239627.1|1293311_1293410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044756821.1|1293451_1294231_+	pectate lyase	NA	NA	NA	NA	NA
WP_044756822.1|1294761_1298058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012444931.1|1298326_1298521_+	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	79.0	1.3e-18
WP_011408491.1|1298524_1298824_+	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	91.3	1.9e-45
WP_069964882.1|1299047_1302905_+	avirulence protein	NA	NA	NA	NA	NA
WP_011258948.1|1303490_1304111_-	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE	NA	NA	NA	NA	NA
WP_011258947.1|1304100_1304877_-	imidazole glycerol phosphate synthase subunit HisF	NA	NA	NA	NA	NA
WP_011258946.1|1304870_1305605_-	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino]imidazole-4- carboxamide isomerase	NA	NA	NA	NA	NA
WP_011258945.1|1305601_1306204_-	imidazole glycerol phosphate synthase subunit HisH	NA	NA	NA	NA	NA
WP_011258944.1|1306200_1307328_-	bifunctional histidinol-phosphatase/imidazoleglycerol-phosphate dehydratase HisB	NA	NA	NA	NA	NA
WP_011408488.1|1307324_1308416_-	histidinol-phosphate transaminase	NA	NA	NA	NA	NA
WP_011258942.1|1308412_1309708_-	histidinol dehydrogenase	NA	NA	NA	NA	NA
WP_011258941.1|1309704_1310619_-	ATP phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_011258940.1|1310628_1310955_-	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_094187798.1|1311268_1312066_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_012444952.1|1312572_1313985_-|tRNA	histidine--tRNA ligase	tRNA	A0A2K9L6G5	Tupanvirus	28.2	3.0e-40
>prophage 11
NZ_CP013679	Xanthomonas oryzae pv. oryzae strain PXO602, complete genome	4951791	1415042	1542764	4951791	tRNA,transposase	Ralstonia_phage(19.23%)	97	NA	NA
WP_109181928.1|1415042_1416008_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011408430.1|1416028_1416832_-	amidohydrolase	NA	NA	NA	NA	NA
WP_011408429.1|1416971_1418120_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_011408428.1|1418346_1418991_+	heme ABC exporter ATP-binding protein CcmA	NA	G3M9Y6	Bacillus_virus	25.9	3.1e-13
WP_011258853.1|1418987_1419683_+	heme exporter protein CcmB	NA	NA	NA	NA	NA
WP_011408427.1|1419777_1420530_+	heme ABC transporter permease	NA	NA	NA	NA	NA
WP_011258852.1|1420526_1420697_+	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_011258851.1|1420693_1421164_+	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_011408426.1|1421332_1423270_+	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_011258849.1|1423262_1423865_+	DsbE family thiol:disulfide interchange protein	NA	NA	NA	NA	NA
WP_094187828.1|1423882_1424293_+	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_011258847.1|1424286_1425306_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_011258845.1|1425595_1427467_-	DUF4105 domain-containing protein	NA	NA	NA	NA	NA
WP_011408424.1|1427463_1427763_-	DUF2388 domain-containing protein	NA	NA	NA	NA	NA
WP_011258843.1|1427797_1429216_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_011258842.1|1429424_1430666_+	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.4	1.7e-103
WP_011258841.1|1430821_1431409_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_011408420.1|1431545_1433027_+	amino acid permease	NA	NA	NA	NA	NA
WP_069959832.1|1433103_1434534_+	amino acid permease	NA	NA	NA	NA	NA
WP_011408418.1|1434622_1435300_+	methylthioribulose 1-phosphate dehydratase	NA	NA	NA	NA	NA
WP_011408417.1|1435311_1435878_+	acireductone dioxygenase	NA	NA	NA	NA	NA
WP_011408416.1|1435880_1436579_+	acireductone synthase	NA	NA	NA	NA	NA
WP_042464827.1|1436905_1437991_+	peptidase C13	NA	NA	NA	NA	NA
WP_155296480.1|1439822_1441142_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_069959831.1|1441430_1445558_+	avirulence protein	NA	NA	NA	NA	NA
WP_069959830.1|1445698_1447174_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	67.1	9.2e-101
WP_082323372.1|1448725_1452328_+	Avirulence protein AvrBs3	NA	NA	NA	NA	NA
WP_153296744.1|1452383_1452530_+	hypothetical protein	NA	Q38057	Xanthomonas_phage	78.4	6.4e-07
WP_042464821.1|1452596_1452791_+	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	82.3	3.9e-20
WP_011408408.1|1452794_1453094_+	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	92.4	6.4e-46
WP_069960204.1|1453317_1456833_+	Avirulence protein AvrBs3	NA	NA	NA	NA	NA
WP_109182103.1|1456906_1457002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153296780.1|1457245_1457512_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258825.1|1458202_1459216_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_069959827.1|1459315_1459912_+	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_011407175.1|1459963_1460932_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	5.6e-99
WP_115801888.1|1461144_1462464_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_155296478.1|1462903_1463701_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011258822.1|1463851_1465201_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	51.6	4.5e-94
WP_099051282.1|1465207_1465972_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_027704061.1|1466332_1466800_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_109181933.1|1466986_1468088_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.2	1.2e-36
WP_011257031.1|1469265_1470234_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_155296481.1|1471265_1472231_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_109181931.1|1474460_1475426_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_109181930.1|1475651_1476449_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011257031.1|1476729_1477698_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_069960202.1|1477889_1478858_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.9e-99
WP_011258800.1|1479718_1480918_+	homoserine O-acetyltransferase	NA	NA	NA	NA	NA
WP_011258799.1|1481066_1481249_+	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_011408398.1|1481570_1483046_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	66.8	2.9e-99
WP_011408397.1|1483100_1484285_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.8	5.0e-41
WP_109181928.1|1484729_1485695_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011258802.1|1487047_1488016_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011408388.1|1488174_1488522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258793.1|1488523_1489291_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_109181926.1|1490361_1491159_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011258790.1|1491370_1493899_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	34.0	4.0e-64
WP_042464810.1|1494465_1495911_-	acetylhydrolase	NA	M1HKG7	Acanthocystis_turfacea_Chlorella_virus	25.8	1.8e-08
WP_042464808.1|1496282_1496423_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_103057266.1|1496422_1497571_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_011258786.1|1497692_1498688_+	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	46.9	3.7e-05
WP_011408382.1|1498684_1499824_+	5-methyltetrahydrofolate--homocysteine methyltransferase	NA	A0A140XBC7	Dickeya_phage	66.7	2.2e-17
WP_012445124.1|1499966_1502720_+	methionine synthase	NA	NA	NA	NA	NA
WP_011258783.1|1503106_1504312_-	AGE family epimerase/isomerase	NA	NA	NA	NA	NA
WP_103073473.1|1504308_1505367_-	carbohydrate kinase	NA	NA	NA	NA	NA
WP_011258781.1|1505291_1506602_-	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
WP_069960295.1|1506615_1507791_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_042464805.1|1507931_1508777_-	transporter	NA	NA	NA	NA	NA
WP_042464803.1|1509110_1509863_-	DUF2058 family protein	NA	NA	NA	NA	NA
WP_011258777.1|1509863_1510100_-	protein SlyX	NA	NA	NA	NA	NA
WP_011408374.1|1510092_1511442_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	40.4	2.4e-79
WP_027703707.1|1511467_1512433_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_011408372.1|1512524_1513082_-	glutathione peroxidase	NA	NA	NA	NA	NA
WP_042464800.1|1513217_1513466_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014502778.1|1513468_1513831_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012445132.1|1513827_1514703_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.9	3.3e-13
WP_044756884.1|1514699_1515686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012445134.1|1515695_1516526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027703710.1|1517158_1517581_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408367.1|1517703_1519107_-	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_155296175.1|1520455_1520599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094187715.1|1520558_1521322_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011258759.1|1524344_1525712_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	48.6	3.3e-113
WP_011258758.1|1525953_1526454_+	DUF3060 domain-containing protein	NA	NA	NA	NA	NA
WP_041182090.1|1526733_1526997_-	PDZ domain-containing protein	NA	NA	NA	NA	NA
WP_011408362.1|1527334_1528834_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_011408361.1|1528830_1529763_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_027703748.1|1529943_1532772_+	2-oxoglutarate dehydrogenase E1 component	NA	NA	NA	NA	NA
WP_027703749.1|1532814_1534017_+	dihydrolipoyllysine-residue succinyltransferase	NA	NA	NA	NA	NA
WP_027703750.1|1534254_1535691_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.1	5.7e-39
WP_044756895.1|1535889_1536483_+	TIGR00730 family Rossman fold protein	NA	A0A2I2L3F0	Orpheovirus	27.5	2.1e-11
WP_103073520.1|1536750_1537344_+	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	41.2	8.1e-16
WP_011408359.1|1537340_1539110_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	30.7	8.0e-59
WP_069970104.1|1539448_1540054_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_044756897.1|1540183_1541110_+	TolC family protein	NA	NA	NA	NA	NA
WP_115862277.1|1541444_1542764_+|transposase	IS701-like element ISXo15 family transposase	transposase	NA	NA	NA	NA
>prophage 12
NZ_CP013679	Xanthomonas oryzae pv. oryzae strain PXO602, complete genome	4951791	1593917	1717948	4951791	tRNA,protease,transposase,coat	Acidithiobacillus_phage(16.67%)	104	NA	NA
WP_033003618.1|1593917_1594442_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_044756902.1|1594450_1595221_+	molecular chaperone	NA	NA	NA	NA	NA
WP_044756903.1|1595237_1597589_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_011258703.1|1597585_1598620_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_044756904.1|1598666_1598999_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408326.1|1599001_1599727_+	molecular chaperone	NA	NA	NA	NA	NA
WP_011258701.1|1600102_1600906_+	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_011258700.1|1601075_1601954_+	elongation factor Ts	NA	NA	NA	NA	NA
WP_011408325.1|1602081_1602459_+	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_011258698.1|1602515_1603238_+	UMP kinase	NA	NA	NA	NA	NA
WP_011258697.1|1603418_1603976_+	ribosome recycling factor	NA	NA	NA	NA	NA
WP_027703358.1|1603993_1604755_+	di-trans,poly-cis-decaprenylcistransferase	NA	R9W0U9	Flavobacterium_phage	32.6	3.6e-16
WP_011258695.1|1604751_1605579_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_011258694.1|1605581_1606772_+	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
WP_011408324.1|1606798_1608145_+|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_011258692.1|1608141_1610595_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_069959820.1|1610994_1612008_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_011258690.1|1612004_1612466_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_011258689.1|1612489_1613281_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_027703356.1|1613319_1614576_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_011408322.1|1614572_1615313_+	ribonuclease HII	NA	G9E3X7	Emiliania_huxleyi_virus	38.0	1.6e-24
WP_011408321.1|1615770_1619361_+	DNA polymerase III subunit alpha	NA	A0A291AVA6	Streptomyces_phage	36.6	4.4e-181
WP_011258685.1|1619536_1620496_+	acetyl-CoA carboxylase carboxyltransferase subunit alpha	NA	NA	NA	NA	NA
WP_042464756.1|1621335_1623516_+	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_011258682.1|1623515_1624253_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.6	3.5e-08
WP_011258681.1|1624249_1625662_+	DUF3526 domain-containing protein	NA	NA	NA	NA	NA
WP_011258680.1|1625598_1626942_+	DUF3526 domain-containing protein	NA	NA	NA	NA	NA
WP_012445196.1|1627763_1628030_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069970181.1|1628107_1628554_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408316.1|1628627_1629230_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_011258677.1|1629397_1630714_+	polyhydroxyalkanoate depolymerase	NA	NA	NA	NA	NA
WP_012445198.1|1631186_1631750_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080256646.1|1635451_1635622_+	adenylyl-sulfate kinase	NA	NA	NA	NA	NA
WP_011408313.1|1635635_1636052_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069959817.1|1636850_1638326_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	67.5	2.2e-102
WP_011408311.1|1638368_1638764_+	type I toxin-antitoxin system SymE family toxin	NA	NA	NA	NA	NA
WP_082323429.1|1638803_1640180_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.1	2.0e-78
WP_011258670.1|1641810_1642485_+	DUF502 domain-containing protein	NA	A0A2I7S9X1	Vibrio_phage	24.5	1.9e-08
WP_011258669.1|1642489_1643266_+	queuosine precursor transporter	NA	R4TNY5	Halovirus	27.2	1.9e-09
WP_069959816.1|1643686_1645624_+	DUF885 family protein	NA	NA	NA	NA	NA
WP_011408306.1|1645805_1646783_-	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_011408305.1|1646779_1648177_-	S-methylmethionine permease	NA	NA	NA	NA	NA
WP_011408304.1|1648447_1649506_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011408302.1|1650269_1650719_+	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_011258663.1|1650943_1653028_+|tRNA	methionine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_041182084.1|1653235_1653832_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_011408301.1|1653833_1654262_+	Rnf electron transport complex subunit RnfB	NA	NA	NA	NA	NA
WP_042464748.1|1654880_1655663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012445216.1|1655748_1656117_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258659.1|1656175_1656739_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_011258658.1|1656723_1657569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408297.1|1657794_1658793_+	acyl-CoA desaturase	NA	G4YAW5	Emiliania_huxleyi_virus	30.6	2.3e-18
WP_069970106.1|1658789_1660040_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_094187733.1|1659964_1660924_+	DUF1365 domain-containing protein	NA	NA	NA	NA	NA
WP_011258655.1|1660920_1662216_+	class I SAM-dependent methyltransferase	NA	A0A2I2L5L3	Orpheovirus	32.4	3.9e-39
WP_011408293.1|1662212_1662758_+	DUF2878 domain-containing protein	NA	NA	NA	NA	NA
WP_011408292.1|1662754_1663537_+	DUF1295 domain-containing protein	NA	NA	NA	NA	NA
WP_012445221.1|1663554_1664625_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_011408290.1|1664786_1665134_-	RidA family protein	NA	NA	NA	NA	NA
WP_069964915.1|1666114_1668679_+	bifunctional lysylphosphatidylglycerol flippase/synthetase MprF	NA	NA	NA	NA	NA
WP_109181916.1|1669070_1669832_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011408285.1|1670117_1671488_-	virulence factor family protein	NA	NA	NA	NA	NA
WP_011258646.1|1671557_1671752_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258645.1|1671811_1672420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408284.1|1672455_1673058_-	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_011258643.1|1673331_1673787_-	PA2169 family four-helix-bundle protein	NA	NA	NA	NA	NA
WP_103057306.1|1675377_1675539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258642.1|1675709_1676921_-	MFS transporter	NA	NA	NA	NA	NA
WP_011408282.1|1677141_1678260_+	alkene reductase	NA	NA	NA	NA	NA
WP_075239156.1|1679150_1679441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408280.1|1679729_1680065_-	alkylphosphonate utilization protein	NA	NA	NA	NA	NA
WP_011408279.1|1680179_1681229_+	cation transporter	NA	NA	NA	NA	NA
WP_011408277.1|1682900_1683374_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_069970107.1|1683513_1684890_+	Hsp70 family protein	NA	NA	NA	NA	NA
WP_011258635.1|1685079_1685265_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155296482.1|1685655_1686975_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_069970109.1|1687063_1688278_-|transposase	IS4 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	2.4e-54
WP_041182418.1|1688462_1689029_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_011258631.1|1689219_1689486_-	DksA/TraR family C4-type zinc finger protein	NA	A0A193GYU8	Escherichia_phage	54.5	1.5e-17
WP_011258630.1|1689660_1689915_+	DUF2789 domain-containing protein	NA	NA	NA	NA	NA
WP_011258629.1|1690075_1690249_-	DUF1328 domain-containing protein	NA	NA	NA	NA	NA
WP_041182081.1|1690650_1691178_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_011258627.1|1691644_1692745_+	Glu/Leu/Phe/Val dehydrogenase	NA	NA	NA	NA	NA
WP_069964917.1|1692805_1695634_-|protease	autotransporter serine protease	protease	A0A1V0SBG2	Catovirus	25.2	3.9e-07
WP_011408270.1|1695789_1696965_+	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
WP_011408269.1|1697087_1697432_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258624.1|1697661_1697988_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408268.1|1698096_1699806_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.5	2.1e-16
WP_011408267.1|1699903_1700494_+	cell shape determination protein CcmA	NA	NA	NA	NA	NA
WP_011258621.1|1700490_1700856_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408265.1|1701192_1702215_+	ligase-associated DNA damage response exonuclease	NA	NA	NA	NA	NA
WP_011258619.1|1702211_1702445_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069970110.1|1702441_1704046_+	ATP-dependent DNA ligase	NA	A0A068CDF3	Rhizobium_phage	36.6	6.4e-15
WP_069970111.1|1704042_1706544_+	ligase-associated DNA damage response DEXH box helicase	NA	NA	NA	NA	NA
WP_069970112.1|1706533_1707178_+	ligase-associated DNA damage response endonuclease PdeM	NA	NA	NA	NA	NA
WP_003488188.1|1708688_1708895_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	70.1	9.3e-20
WP_011408258.1|1708981_1709734_-	S-methyl-5'-thioinosine phosphorylase	NA	NA	NA	NA	NA
WP_011408257.1|1709819_1710374_-	hypoxanthine-guanine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_011408256.1|1710373_1711378_-	beta-N-acetylhexosaminidase	NA	NA	NA	NA	NA
WP_011408255.1|1711495_1713073_-	cryptochrome/photolyase family protein	NA	A0A1V0SE91	Indivirus	25.6	2.2e-44
WP_011408254.1|1713253_1714288_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_041182416.1|1714304_1714988_-	DsbA family oxidoreductase	NA	NA	NA	NA	NA
WP_011408252.1|1715107_1716484_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	56.9	8.3e-80
WP_011257310.1|1716712_1717948_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
>prophage 13
NZ_CP013679	Xanthomonas oryzae pv. oryzae strain PXO602, complete genome	4951791	1836442	1902295	4951791	tRNA,transposase	Bacillus_phage(20.0%)	42	NA	NA
WP_011408191.1|1836442_1837678_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011258521.1|1838177_1839281_+	exo-alpha-sialidase	NA	NA	NA	NA	NA
WP_011408189.1|1839422_1841381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258519.1|1841405_1842137_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_011258518.1|1842133_1843198_-	N(4)-(beta-N-acetylglucosaminyl)-L-asparaginase	NA	NA	NA	NA	NA
WP_011408185.1|1847819_1848902_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011258513.1|1848913_1849537_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011258512.1|1849787_1850264_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_011408184.1|1850297_1851500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069959811.1|1851507_1858434_-	response regulator	NA	W8CYM9	Bacillus_phage	31.1	2.9e-11
WP_011258510.1|1858547_1860584_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	42.1	2.1e-23
WP_003482487.1|1860623_1861154_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258508.1|1861153_1861516_-	response regulator	NA	A0A220YL79	Alteromonas_virus	26.8	9.0e-10
WP_005913706.1|1861533_1861935_-	response regulator	NA	NA	NA	NA	NA
WP_044756943.1|1862184_1863135_+	glutathione synthase	NA	NA	NA	NA	NA
WP_011258506.1|1863131_1864007_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_011258505.1|1864301_1865216_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	48.5	1.2e-63
WP_011408180.1|1865212_1865932_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_011408179.1|1865945_1867973_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	33.2	4.6e-95
WP_011408178.1|1868172_1868697_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069959810.1|1868710_1871155_-	penicillin-binding protein 1B	NA	NA	NA	NA	NA
WP_044756949.1|1871396_1873499_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_042465507.1|1873831_1875274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042464698.1|1875563_1877750_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_002812057.1|1878039_1878120_+	pyrroloquinoline quinone precursor peptide PqqA	NA	NA	NA	NA	NA
WP_011258497.1|1878203_1879103_+	pyrroloquinoline quinone biosynthesis protein PqqB	NA	NA	NA	NA	NA
WP_011408174.1|1879099_1879852_+	pyrroloquinoline-quinone synthase PqqC	NA	NA	NA	NA	NA
WP_011408173.1|1879848_1880127_+	pyrroloquinoline quinone biosynthesis peptide chaperone PqqD	NA	NA	NA	NA	NA
WP_011408172.1|1880123_1881242_+	pyrroloquinoline quinone biosynthesis protein PqqE	NA	NA	NA	NA	NA
WP_011408171.1|1881304_1881817_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094187782.1|1882127_1882891_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_041182063.1|1883061_1884576_+	PhoPQ-regulated protein	NA	NA	NA	NA	NA
WP_011408167.1|1886017_1888660_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_069970116.1|1888880_1893002_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SDF7	Indivirus	28.5	5.6e-47
WP_011408166.1|1893103_1893649_+	DNA starvation/stationary phase protection protein	NA	A0A2H4N7L5	Lake_Baikal_phage	32.4	1.5e-16
WP_069959808.1|1894203_1896000_+	DNA helicase RecQ	NA	L7RCS0	Acanthamoeba_polyphaga_moumouvirus	35.3	2.6e-81
WP_011408165.1|1896138_1896636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408164.1|1896714_1897119_+	response regulator	NA	NA	NA	NA	NA
WP_008578058.1|1897749_1898424_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A088F6S9	Vibrio_phage	34.7	6.4e-25
WP_069959795.1|1898802_1900179_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.0	1.1e-58
WP_094187715.1|1900245_1901008_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011257310.1|1901059_1902295_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
>prophage 14
NZ_CP013679	Xanthomonas oryzae pv. oryzae strain PXO602, complete genome	4951791	1963599	2110362	4951791	tRNA,transposase	Staphylococcus_prophage(12.5%)	114	NA	NA
WP_011258399.1|1963599_1966431_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SGW1	Hokovirus	22.2	4.1e-41
WP_011408095.1|1966437_1967454_-	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_094187736.1|1967579_1968343_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011408094.1|1968468_1970073_-	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_003484323.1|1970189_1970459_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_011258396.1|1970550_1971603_-	GTPase ObgE	NA	NA	NA	NA	NA
WP_011258395.1|1971835_1972096_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_011258394.1|1972108_1972429_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_012444462.1|1972721_1975688_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.8	3.3e-307
WP_075240114.1|1975684_1976092_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_011258392.1|1976205_1976670_-	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
WP_011408091.1|1976693_1977464_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_011408090.1|1977534_1978440_+	acyl-CoA thioesterase II	NA	NA	NA	NA	NA
WP_011408089.1|1978667_1979171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408088.1|1979282_1980026_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_041182403.1|1980280_1980736_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109181906.1|1980880_1981679_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011408086.1|1981721_1982303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042464672.1|1982363_1983278_+	arginyltransferase	NA	NA	NA	NA	NA
WP_027703288.1|1983231_1984563_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_011258382.1|1984867_1986469_-	membrane protein	NA	NA	NA	NA	NA
WP_027703287.1|1986914_1987991_+	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
WP_011408082.1|1988086_1988560_-	DUF3574 domain-containing protein	NA	NA	NA	NA	NA
WP_011408081.1|1988795_1991231_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	22.5	2.6e-12
WP_069964514.1|1992587_1993310_+	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_011408078.1|1993354_1995133_+	glycoside hydrolase family 15 protein	NA	NA	NA	NA	NA
WP_011258376.1|1995129_1996497_+	alpha,alpha-trehalose-phosphate synthase (UDP-forming)	NA	NA	NA	NA	NA
WP_011258374.1|1996746_1997127_-	DUF393 domain-containing protein	NA	NA	NA	NA	NA
WP_011258373.1|1997101_1997608_-	DUF4166 domain-containing protein	NA	NA	NA	NA	NA
WP_011258372.1|1997628_1998435_-	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
WP_011408077.1|1998442_1999438_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_011258370.1|1999558_2000440_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_011258369.1|2000597_2002256_-	NAD+ synthase	NA	A0A2L0UZF5	Agrobacterium_phage	38.0	1.2e-93
WP_011408075.1|2002684_2002981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258368.1|2003300_2004176_-	succinate--CoA ligase subunit alpha	NA	NA	NA	NA	NA
WP_011258367.1|2004200_2005370_-	ADP-forming succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
WP_012444444.1|2005603_2007217_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_033013168.1|2007547_2008939_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_027703281.1|2009011_2009218_+	DUF2559 family protein	NA	NA	NA	NA	NA
WP_011408072.1|2009797_2011531_-	type IV-A pilus assembly ATPase PilB	NA	NA	NA	NA	NA
WP_069970117.1|2013060_2013720_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069970118.1|2013700_2015290_-	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_011408068.1|2015424_2015850_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_069970182.1|2016204_2017464_+	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_069970119.1|2017470_2018334_+	prepilin peptidase	NA	NA	NA	NA	NA
WP_011258357.1|2018347_2018956_+	dephospho-CoA kinase	NA	NA	NA	NA	NA
WP_155296483.1|2019026_2020346_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_082323380.1|2020906_2021314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041182041.1|2021192_2022149_-|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.9	1.1e-41
WP_011257031.1|2022840_2023809_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_011408064.1|2023978_2024347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_125168748.1|2025862_2026192_-	hypothetical protein	NA	NA	NA	NA	NA
WP_125168747.1|2026188_2026488_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258803.1|2026636_2027605_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.5e-99
WP_155296484.1|2027656_2028211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069959761.1|2028227_2029463_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_109181904.1|2035251_2036571_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_094187715.1|2036613_2037376_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_069959790.1|2037452_2039285_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.3	1.2e-30
WP_069960188.1|2039416_2040007_-	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
WP_044756980.1|2040072_2043129_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_011258341.1|2043125_2044229_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_011258340.1|2044254_2045091_-	MipA/OmpV family protein	NA	NA	NA	NA	NA
WP_011408057.1|2046685_2047375_+	response regulator transcription factor	NA	Q6XM27	Feldmannia_irregularis_virus	28.3	3.6e-07
WP_011408056.1|2047371_2048565_+	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	23.9	5.2e-22
WP_011258336.1|2048623_2049889_-	potassium transporter	NA	NA	NA	NA	NA
WP_059317475.1|2050035_2051712_-	serine hydrolase	NA	NA	NA	NA	NA
WP_059317476.1|2051653_2052154_-	RraA family protein	NA	NA	NA	NA	NA
WP_069959788.1|2053969_2054917_+	DMT family transporter	NA	NA	NA	NA	NA
WP_059317478.1|2055104_2055827_-	pseudouridine synthase	NA	NA	NA	NA	NA
WP_012444418.1|2055976_2058373_-	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	30.2	3.8e-11
WP_011258329.1|2058636_2060541_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	35.7	2.5e-58
WP_069970183.1|2061216_2061867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258326.1|2061903_2062146_+	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_011258325.1|2062494_2062896_-	membrane protein	NA	NA	NA	NA	NA
WP_027704130.1|2062921_2063455_-	DUF4019 domain-containing protein	NA	NA	NA	NA	NA
WP_011258323.1|2063857_2064112_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069959787.1|2065574_2067038_+	DNA-3-methyladenine glycosylase 2 family protein	NA	NA	NA	NA	NA
WP_012444410.1|2067034_2067580_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A1S5V092	Saudi_moumouvirus	51.9	4.1e-14
WP_027704131.1|2067836_2069135_+	alkaline phosphatase family protein	NA	NA	NA	NA	NA
WP_011258317.1|2069261_2070707_+	chloride channel protein	NA	A0A1X9I5Z9	Streptococcus_phage	31.5	4.9e-14
WP_011258316.1|2070779_2071820_+	zinc-dependent alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_011408042.1|2071952_2072135_-	30S ribosomal protein THX	NA	NA	NA	NA	NA
WP_011258314.1|2072434_2072845_-	MerC domain-containing protein	NA	NA	NA	NA	NA
WP_069970120.1|2075472_2077854_+	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_059317479.1|2078080_2079052_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.5	1.2e-32
WP_094187725.1|2079103_2079514_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_011258309.1|2079612_2080338_-	OmpA family protein	NA	G3M9Z0	Bacillus_virus	33.9	1.4e-09
WP_011258308.1|2080754_2082209_-	deoxyribodipyrimidine photo-lyase	NA	A0A1V0S949	Catovirus	31.7	5.7e-47
WP_011408037.1|2082275_2083706_-	replicative DNA helicase	NA	O80281	Escherichia_phage	53.4	8.5e-120
WP_011258306.1|2083927_2084482_-	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	35.3	1.1e-19
WP_011258305.1|2084698_2086639_-	asparagine synthase (glutamine-hydrolyzing)	NA	A0A1B1ISV2	uncultured_Mediterranean_phage	30.5	4.4e-26
WP_027704133.1|2086814_2087453_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_033013599.1|2089686_2090850_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_011408033.1|2091007_2091799_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_011258299.1|2091944_2092160_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408032.1|2092159_2092927_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_011258297.1|2092988_2093819_-|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_011408031.1|2093891_2094320_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408030.1|2094451_2094931_+	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_011258294.1|2095181_2095397_-	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	59.7	6.5e-16
WP_011258293.1|2095624_2096110_+	DUF456 domain-containing protein	NA	NA	NA	NA	NA
WP_011258291.1|2097671_2097875_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408025.1|2098652_2099111_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_011408024.1|2099516_2100023_-	Fur family transcriptional regulator	NA	NA	NA	NA	NA
WP_011258289.1|2100036_2101440_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_075242217.1|2102637_2103369_-	nitrilase	NA	NA	NA	NA	NA
WP_011407237.1|2103442_2104399_+|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
WP_011408021.1|2104575_2105163_-	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_011408020.1|2105393_2106206_+	C1 family peptidase	NA	NA	NA	NA	NA
WP_011408019.1|2106236_2107400_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.2	2.6e-98
WP_011408018.1|2107531_2107915_-	membrane protein	NA	NA	NA	NA	NA
WP_011408017.1|2108430_2109243_+	C1 family peptidase	NA	NA	NA	NA	NA
WP_011408016.1|2109303_2110362_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	42.6	4.1e-71
>prophage 15
NZ_CP013679	Xanthomonas oryzae pv. oryzae strain PXO602, complete genome	4951791	2331319	2476300	4951791	protease,transposase	Xanthomonas_phage(40.74%)	107	NA	NA
WP_069959761.1|2331319_2332555_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011258091.1|2332976_2334365_-	amino acid permease	NA	NA	NA	NA	NA
WP_011258090.1|2335120_2336062_-	proline iminopeptidase-family hydrolase	NA	NA	NA	NA	NA
WP_011407882.1|2336375_2337140_-	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011407881.1|2337332_2338715_+	APC family permease	NA	NA	NA	NA	NA
WP_011407879.1|2339169_2340567_+	trypsin-like peptidase domain-containing protein	NA	NA	NA	NA	NA
WP_011407877.1|2341129_2341528_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258085.1|2341672_2342677_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_069959760.1|2342714_2344232_-	tryptophan 7-halogenase	NA	A0A1D7SEI2	Cyanophage	32.5	4.7e-52
WP_044757048.1|2344272_2345319_-	cupin-like domain-containing protein	NA	NA	NA	NA	NA
WP_011407875.1|2345329_2346082_-	SapC family protein	NA	NA	NA	NA	NA
WP_094187791.1|2346413_2349560_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_069959759.1|2350618_2352625_-	M1 family metallopeptidase	NA	NA	NA	NA	NA
WP_011258079.1|2352844_2353291_-	redox-sensitive transcriptional activator SoxR	NA	NA	NA	NA	NA
WP_069959758.1|2355282_2356449_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	42.1	3.4e-74
WP_011258076.1|2356450_2357023_-	DUF1190 domain-containing protein	NA	A0A191ZBZ0	Erwinia_phage	27.7	1.1e-09
WP_011407869.1|2357035_2357440_-	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_011407868.1|2357477_2358149_-	YjfK family protein	NA	NA	NA	NA	NA
WP_011407867.1|2358151_2359234_-	potassium channel protein	NA	NA	NA	NA	NA
WP_011258072.1|2359259_2360033_-	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_012445807.1|2360045_2360462_-	YjfI family protein	NA	NA	NA	NA	NA
WP_011258070.1|2360642_2361242_-	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_011258069.1|2361408_2361951_+	shikimate kinase	NA	NA	NA	NA	NA
WP_011258068.1|2361947_2363060_+	3-dehydroquinate synthase	NA	NA	NA	NA	NA
WP_011407864.1|2363361_2363613_+	WGR domain-containing protein	NA	NA	NA	NA	NA
WP_011258066.1|2363627_2364692_+	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
WP_069959757.1|2366163_2369880_+	avirulence protein	NA	NA	NA	NA	NA
WP_011258059.1|2370148_2370343_+	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	94.1	3.9e-20
WP_011408408.1|2370346_2370646_+	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	92.4	6.4e-46
WP_069960173.1|2370869_2375294_+	avirulence protein	NA	NA	NA	NA	NA
WP_153296744.1|2375349_2375496_+	hypothetical protein	NA	Q38057	Xanthomonas_phage	78.4	6.4e-07
WP_041182100.1|2375562_2375757_+	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	80.6	2.5e-19
WP_041182759.1|2375760_2376060_+	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	91.3	9.3e-45
WP_041182100.1|2379823_2380018_+	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	80.6	2.5e-19
WP_125168752.1|2382305_2382629_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408516.1|2383242_2383755_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109181945.1|2383885_2384648_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_082323370.1|2385869_2389667_+	avirulence protein	NA	NA	NA	NA	NA
WP_012444931.1|2389935_2390130_+	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	79.0	1.3e-18
WP_011408491.1|2390133_2390433_+	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	91.3	1.9e-45
WP_069970122.1|2390656_2394412_+	avirulence protein	NA	NA	NA	NA	NA
WP_109181946.1|2394501_2395264_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_153296744.1|2395283_2395430_+	hypothetical protein	NA	Q38057	Xanthomonas_phage	78.4	6.4e-07
WP_042464821.1|2395495_2395690_+	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	82.3	3.9e-20
WP_011408491.1|2395693_2395993_+	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	91.3	1.9e-45
WP_069959856.1|2396217_2400234_+	avirulence protein	NA	NA	NA	NA	NA
WP_011258057.1|2400407_2400629_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_082323384.1|2400625_2401183_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	40.0	7.9e-21
WP_125168753.1|2402328_2402574_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069970123.1|2402557_2403514_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.0	3.7e-42
WP_011257031.1|2403928_2404897_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_041182129.1|2405041_2406007_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_041182130.1|2405984_2410085_-	RHS repeat protein	NA	NA	NA	NA	NA
WP_011408397.1|2410393_2411578_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.8	5.0e-41
WP_041182131.1|2411628_2412528_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.1	2.8e-36
WP_011408524.1|2412694_2413201_+	glyoxalase	NA	NA	NA	NA	NA
WP_011258968.1|2413675_2414308_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_011258969.1|2414307_2416164_-	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_011408525.1|2416160_2417660_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258971.1|2417602_2418067_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_069960087.1|2418063_2418864_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_011258973.1|2419133_2420174_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_011258974.1|2420170_2421940_-	lipid A export permease/ATP-binding protein MsbA	NA	W8CYL7	Bacillus_phage	28.0	9.4e-52
WP_011258975.1|2421936_2422401_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_011408526.1|2422404_2423067_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_011408527.1|2423095_2425504_-	DNA internalization-related competence protein ComEC/Rec2	NA	NA	NA	NA	NA
WP_109181948.1|2425757_2426723_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011258980.1|2428116_2428851_-	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	34.5	1.0e-31
WP_010378794.1|2428843_2430085_-	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_014503500.1|2430108_2430561_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408531.1|2430511_2430760_-	succinate dehydrogenase assembly factor 2	NA	NA	NA	NA	NA
WP_011408532.1|2430870_2431653_-	succinate dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_012444910.1|2431669_2431879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258983.1|2431882_2433673_-	succinate dehydrogenase flavoprotein subunit	NA	NA	NA	NA	NA
WP_011258984.1|2433707_2434094_-	succinate dehydrogenase, hydrophobic membrane anchor protein	NA	NA	NA	NA	NA
WP_011258985.1|2434090_2434486_-	succinate dehydrogenase, cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_012444907.1|2434545_2434812_-	DUF1674 domain-containing protein	NA	NA	NA	NA	NA
WP_011408533.1|2434755_2435628_+	folate-binding protein YgfZ	NA	NA	NA	NA	NA
WP_011258986.1|2435756_2436854_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	30.1	2.2e-22
WP_011408534.1|2437290_2438721_+	glucose-6-phosphate dehydrogenase	NA	A0A222YYZ2	Synechococcus_phage	34.5	2.2e-67
WP_011258988.1|2438717_2439725_+	glucokinase	NA	NA	NA	NA	NA
WP_011258989.1|2439721_2440441_+	6-phosphogluconolactonase	NA	NA	NA	NA	NA
WP_011258990.1|2440543_2442460_+	phosphogluconate dehydratase	NA	NA	NA	NA	NA
WP_011408535.1|2442515_2443175_+	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_027703995.1|2444801_2445005_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258994.1|2446020_2446401_+	response regulator	NA	NA	NA	NA	NA
WP_011408539.1|2446615_2450011_+	PAS domain S-box protein	NA	A0A1V0SGX0	Hokovirus	27.8	2.9e-25
WP_094187715.1|2451576_2452339_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011408544.1|2454234_2454468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259000.1|2454634_2455609_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	39.6	2.0e-19
WP_069960088.1|2456372_2457254_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408549.1|2458954_2460088_+	phospholipase A	NA	NA	NA	NA	NA
WP_011408550.1|2460516_2460969_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_125168754.1|2460656_2461151_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259006.1|2461287_2462805_-	fumarate hydratase	NA	NA	NA	NA	NA
WP_012444869.1|2463138_2465019_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	38.0	2.3e-24
WP_011408551.1|2465207_2465987_+	ferredoxin--NADP reductase	NA	NA	NA	NA	NA
WP_011259009.1|2466137_2466623_-	glutathione peroxidase	NA	A0A1S7DM81	Molluscum_contagiosum_virus	36.2	2.8e-14
WP_027703343.1|2469079_2469319_-	HTH domain-containing protein	NA	NA	NA	NA	NA
WP_069959861.1|2469570_2470284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259013.1|2471808_2472309_+	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_044757420.1|2472470_2473049_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259015.1|2473140_2473641_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011259016.1|2473707_2474541_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408556.1|2474591_2474906_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_011259018.1|2475089_2475278_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408557.1|2475691_2476300_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
>prophage 16
NZ_CP013679	Xanthomonas oryzae pv. oryzae strain PXO602, complete genome	4951791	2565339	2613435	4951791	tRNA,transposase	Moumouvirus(16.67%)	44	NA	NA
WP_011408598.1|2565339_2566734_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	39.5	7.6e-81
WP_011259080.1|2566735_2566993_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408599.1|2566989_2567295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408600.1|2567291_2567618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408603.1|2568344_2569007_+	carbonate dehydratase	NA	NA	NA	NA	NA
WP_024744799.1|2569095_2569626_+	3-hydroxyanthranilate 3,4-dioxygenase	NA	NA	NA	NA	NA
WP_011408606.1|2571849_2573121_+	kynureninase	NA	NA	NA	NA	NA
WP_011408607.1|2573292_2574660_+	FAD-dependent monooxygenase	NA	NA	NA	NA	NA
WP_011259089.1|2574963_2576409_+	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_011259090.1|2576405_2577092_+	DUF2461 domain-containing protein	NA	NA	NA	NA	NA
WP_011259091.1|2577064_2578084_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_011259092.1|2578125_2578686_+	DUF2939 domain-containing protein	NA	NA	NA	NA	NA
WP_011259093.1|2578706_2579663_-	5'-nucleotidase	NA	NA	NA	NA	NA
WP_011408609.1|2579830_2580607_-	NAD kinase	NA	NA	NA	NA	NA
WP_069970124.1|2581090_2583226_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_027703372.1|2583222_2583414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259098.1|2585188_2585695_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_011259099.1|2585735_2586263_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_011408612.1|2586259_2586751_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_011408613.1|2586774_2587350_+	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_011259101.1|2587426_2588380_-	DUF1684 domain-containing protein	NA	NA	NA	NA	NA
WP_011259102.1|2588468_2589341_-	sulfurtransferase	NA	NA	NA	NA	NA
WP_103057219.1|2589337_2590105_-	CoA pyrophosphatase	NA	NA	NA	NA	NA
WP_011408617.1|2590295_2590994_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_011408618.1|2591157_2591940_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_011408619.1|2591948_2592329_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259107.1|2592325_2593036_+	endonuclease III	NA	NA	NA	NA	NA
WP_011408621.1|2594346_2594895_-	carbonate dehydratase	NA	NA	NA	NA	NA
WP_069970125.1|2595066_2596035_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.5e-99
WP_011408623.1|2596639_2597875_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_041182144.1|2598438_2598759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259109.1|2599098_2600349_+	porin	NA	NA	NA	NA	NA
WP_103057309.1|2600483_2601557_+	phosphate ABC transporter substrate-binding protein PstS	NA	M4SNR3	Cyanophage	38.4	5.0e-48
WP_011408626.1|2601744_2602836_+	phosphate ABC transporter substrate-binding protein PstS	NA	E3SKK5	Synechococcus_phage	39.7	1.1e-47
WP_069959864.1|2602948_2603923_+	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_069959865.1|2603922_2604792_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_011259114.1|2604814_2605645_+	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	32.6	5.5e-18
WP_011408630.1|2605773_2606484_+	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_011259116.1|2606616_2607024_+	RcnB family protein	NA	NA	NA	NA	NA
WP_094187739.1|2607301_2607943_+	ribonuclease T	NA	NA	NA	NA	NA
WP_011408631.1|2608013_2609333_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_042464912.1|2609569_2610631_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011408397.1|2610681_2611866_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.8	5.0e-41
WP_109181954.1|2612115_2613435_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 17
NZ_CP013679	Xanthomonas oryzae pv. oryzae strain PXO602, complete genome	4951791	2620154	2691265	4951791	tRNA,protease,transposase	uncultured_Mediterranean_phage(35.71%)	51	NA	NA
WP_011259125.1|2620154_2621300_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.2	2.2e-86
WP_027703908.1|2621369_2622440_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_011259127.1|2622605_2623037_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_011259128.1|2623160_2624657_+	aminotransferase class III-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_011259129.1|2625001_2625709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259140.1|2629049_2630171_-	phytase	NA	NA	NA	NA	NA
WP_103057211.1|2632443_2632869_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_011259142.1|2633061_2633694_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_094187715.1|2634090_2634853_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011259143.1|2635133_2636165_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011408648.1|2636171_2637965_-	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_012444765.1|2637961_2638246_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	57.0	1.4e-18
WP_011408650.1|2638477_2638963_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259147.1|2639021_2639528_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	41.1	4.8e-25
WP_011259148.1|2639524_2640145_-	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_011408651.1|2640385_2642290_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	36.8	1.0e-112
WP_109181955.1|2642377_2643435_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_109181956.1|2643532_2644852_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_075239722.1|2645085_2646243_+	molybdopterin-synthase adenylyltransferase MoeB	NA	NA	NA	NA	NA
WP_109181957.1|2646519_2647485_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_109181958.1|2647462_2648938_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	54.8	1.2e-76
WP_011257031.1|2651477_2652446_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_075243670.1|2652713_2652953_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011259163.1|2654827_2656048_-	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_011259164.1|2656362_2657760_-	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_011259165.1|2657770_2658991_-	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
WP_011259166.1|2658987_2659626_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_011259167.1|2659696_2660557_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011408658.1|2660553_2661342_-	type IV pilus biogenesis/stability protein PilW	NA	NA	NA	NA	NA
WP_011259169.1|2661352_2662558_-	23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN	NA	NA	NA	NA	NA
WP_002812972.1|2662576_2663002_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	41.7	1.1e-19
WP_011259170.1|2663221_2663854_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011259171.1|2663878_2666251_+	3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_011259172.1|2666408_2667614_+	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
WP_069959870.1|2667934_2669266_+	voltage-gated chloride channel family protein	NA	A0A1X9I5Z9	Streptococcus_phage	35.2	1.1e-41
WP_011408659.1|2669262_2669613_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408660.1|2669644_2670052_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	49.1	5.7e-21
WP_011259175.1|2670048_2670375_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259176.1|2670406_2671783_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	38.3	6.8e-74
WP_011259177.1|2672019_2676186_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103073501.1|2676298_2676928_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_069960218.1|2677034_2678963_-	DUF3857 and transglutaminase domain-containing protein	NA	NA	NA	NA	NA
WP_011259180.1|2679125_2681486_-	DNA translocase FtsK	NA	G1D482	Mycobacterium_virus	45.8	2.5e-84
WP_069959872.1|2681769_2682738_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.5	5.9e-64
WP_011408662.1|2682795_2683917_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_042465566.1|2685344_2686097_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_002813418.1|2686177_2686396_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_011259186.1|2686676_2688959_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	44.6	8.7e-175
WP_005914463.1|2689102_2689423_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	1.0e-12
WP_011408665.1|2689673_2690132_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_011259189.1|2690128_2691265_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 18
NZ_CP013679	Xanthomonas oryzae pv. oryzae strain PXO602, complete genome	4951791	2773003	2801640	4951791	transposase	Ralstonia_phage(80.0%)	12	NA	NA
WP_011407175.1|2773003_2773972_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	5.6e-99
WP_128896930.1|2774066_2774603_-	DUF3828 domain-containing protein	NA	NA	NA	NA	NA
WP_103073433.1|2774635_2779471_-	type IV secretion protein Rhs	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	39.8	1.4e-09
WP_011258802.1|2780806_2781775_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011257031.1|2783838_2784807_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_128415342.1|2786431_2786911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259260.1|2795044_2795437_+	c-type cytochrome	NA	NA	NA	NA	NA
WP_011259261.1|2795445_2795907_+	cytochrome c	NA	NA	NA	NA	NA
WP_153296779.1|2796327_2796726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_115801893.1|2798429_2799395_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_082323388.1|2799401_2800547_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_069959881.1|2800671_2801640_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	9.6e-99
>prophage 19
NZ_CP013679	Xanthomonas oryzae pv. oryzae strain PXO602, complete genome	4951791	2823950	2884552	4951791	tRNA,protease,transposase	Moumouvirus(10.0%)	53	NA	NA
WP_011259285.1|2823950_2825381_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.5	1.1e-42
WP_011408724.1|2825878_2826316_+	SufE family protein	NA	NA	NA	NA	NA
WP_011259287.1|2826312_2827563_+	MFS transporter	NA	NA	NA	NA	NA
WP_011259288.1|2827630_2828692_-	S41 family peptidase	NA	NA	NA	NA	NA
WP_075242610.1|2828834_2829875_-	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_024710406.1|2829965_2830247_+	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
WP_011408728.1|2830243_2831593_+	dihydroorotase	NA	NA	NA	NA	NA
WP_094187752.1|2831532_2832432_+	M23 family metallopeptidase	NA	A0A075BS18	Microcystis_phage	41.2	2.6e-13
WP_094187715.1|2833330_2834093_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011259294.1|2834119_2834383_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012444728.1|2834754_2835243_-	general stress protein	NA	NA	NA	NA	NA
WP_011408734.1|2835466_2836786_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011257031.1|2836922_2837891_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_069964543.1|2838090_2839407_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_012444725.1|2839766_2840948_+	putative acyl-CoA thioester hydrolase	NA	NA	NA	NA	NA
WP_011259303.1|2842536_2844207_+	glycoside hydrolase family 28 protein	NA	NA	NA	NA	NA
WP_011259304.1|2844423_2845113_-	phytoene synthase	NA	NA	NA	NA	NA
WP_011408736.1|2845141_2845846_-	phosphoglycolate phosphatase	NA	NA	NA	NA	NA
WP_011259306.1|2845919_2846639_-	bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase	NA	NA	NA	NA	NA
WP_011408737.1|2846669_2848019_-	TRZ/ATZ family hydrolase	NA	NA	NA	NA	NA
WP_099051322.1|2848026_2848863_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002802373.1|2849021_2849588_-	elongation factor P	NA	NA	NA	NA	NA
WP_011408738.1|2849689_2850718_+	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_011259310.1|2850936_2853054_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_094187831.1|2853050_2853971_-	phosphate/phosphite/phosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_011408739.1|2854031_2854796_-	RNA methyltransferase	NA	NA	NA	NA	NA
WP_011408740.1|2854914_2855748_+	inositol monophosphatase	NA	NA	NA	NA	NA
WP_011259314.1|2856000_2856612_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	69.8	1.1e-79
WP_011259315.1|2856866_2857307_+	ribonuclease	NA	NA	NA	NA	NA
WP_011259316.1|2857303_2857729_+	barstar family protein	NA	NA	NA	NA	NA
WP_027703271.1|2858177_2860073_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	26.8	1.8e-48
WP_069959885.1|2860162_2861539_+	ATP-dependent RNA helicase DbpA	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	31.4	1.6e-54
WP_011259319.1|2861641_2862202_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	43.2	1.6e-29
WP_011408741.1|2862299_2863856_-	YdiU family protein	NA	NA	NA	NA	NA
WP_011408742.1|2864139_2865015_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_012444709.1|2865215_2865914_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_011408744.1|2866084_2866294_-	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	62.3	2.8e-16
WP_011408745.1|2866563_2867049_+	YaiI/YqxD family protein	NA	NA	NA	NA	NA
WP_011259325.1|2867119_2867668_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_011259326.1|2867664_2868846_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_012444707.1|2869069_2871139_+	GGDEF and EAL domain-containing response regulator	NA	NA	NA	NA	NA
WP_011259328.1|2871238_2872117_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_011259329.1|2872214_2873114_+|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_011408747.1|2873201_2873942_+	beta-ketoacyl-ACP reductase	NA	NA	NA	NA	NA
WP_011259331.1|2874101_2874677_+	polyhydroxyalkanoate synthesis repressor PhaR	NA	NA	NA	NA	NA
WP_011408749.1|2874850_2875822_-	TraB/GumN family protein	NA	NA	NA	NA	NA
WP_011408750.1|2875855_2876797_-	DUF1684 domain-containing protein	NA	NA	NA	NA	NA
WP_011259334.1|2876796_2878674_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	35.2	1.4e-85
WP_011408751.1|2878811_2880545_-	N-acetylmuramoyl-L-alanine amidase	NA	A6XML1	Bacillus_virus	28.4	4.1e-15
WP_011259336.1|2880597_2881098_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_011259337.1|2881094_2882582_-	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_069959886.1|2882606_2883674_+|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_094187715.1|2883788_2884552_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 20
NZ_CP013679	Xanthomonas oryzae pv. oryzae strain PXO602, complete genome	4951791	2887747	2974683	4951791	tRNA,protease,transposase	Bacillus_phage(18.18%)	58	NA	NA
WP_094187754.1|2887747_2888495_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_041182165.1|2888811_2890647_-	formylglycine-generating enzyme family protein	NA	A0A075BSL8	Microcystis_phage	33.1	5.6e-23
WP_041182166.1|2890918_2892010_+	ribonuclease D	NA	NA	NA	NA	NA
WP_080493491.1|2892085_2892475_-	ATP-dependent DNA ligase	NA	NA	NA	NA	NA
WP_011408757.1|2892338_2892689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259345.1|2893102_2893504_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_011259346.1|2894010_2894145_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_015463309.1|2894367_2894547_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027703932.1|2895148_2895439_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_011408759.1|2895426_2895705_-	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_080256628.1|2896189_2896378_-	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_011408397.1|2897150_2898335_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.8	5.0e-41
WP_011408763.1|2904373_2904790_+	DUF3301 domain-containing protein	NA	NA	NA	NA	NA
WP_011408764.1|2905000_2905327_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259352.1|2905359_2905800_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	46.2	9.3e-25
WP_011259353.1|2905878_2906514_-	stringent starvation protein A	NA	NA	NA	NA	NA
WP_103057267.1|2906907_2907651_-	cytochrome c1	NA	NA	NA	NA	NA
WP_011259355.1|2907658_2908918_-	cytochrome bc complex cytochrome b subunit	NA	NA	NA	NA	NA
WP_011259356.1|2908917_2909562_-	ubiquinol-cytochrome c reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_011259357.1|2910091_2911078_-	lytic transglycosylase domain-containing protein	NA	A0A0H3V0Q1	Geobacillus_virus	56.0	1.3e-29
WP_011408766.1|2913013_2914468_+|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_011408767.1|2914891_2915878_+	PhoH family protein	NA	W8D063	Erwinia_phage	47.7	2.5e-46
WP_011259362.1|2916289_2916952_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259363.1|2917006_2917492_+	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_011408769.1|2917491_2918010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408770.1|2918104_2918983_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_011259366.1|2918979_2920260_+	DUF4105 domain-containing protein	NA	NA	NA	NA	NA
WP_011259367.1|2920275_2921277_+	magnesium and cobalt transport protein CorA	NA	NA	NA	NA	NA
WP_011408772.1|2921428_2922793_-	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_011408773.1|2923047_2923458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408774.1|2923613_2924444_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_075240820.1|2924757_2926005_-	polyamine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.3	1.2e-24
WP_011259371.1|2926150_2927662_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_011408778.1|2927648_2929235_-	multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_011408779.1|2929231_2930434_-	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_115840172.1|2930940_2932329_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011408781.1|2932562_2933948_-	glutamine synthetase	NA	NA	NA	NA	NA
WP_011259377.1|2934855_2936235_+	glutamine synthetase	NA	NA	NA	NA	NA
WP_011408783.1|2936234_2937551_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_012444665.1|2937687_2938932_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.4	2.5e-19
WP_011408784.1|2939239_2940520_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_094187755.1|2940825_2941134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069970126.1|2941093_2943442_-	FdhF/YdeP family oxidoreductase	NA	NA	NA	NA	NA
WP_011259382.1|2943438_2944284_-	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_069970127.1|2944290_2945985_-	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_075242096.1|2946127_2946310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094187715.1|2946306_2947070_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011259384.1|2948420_2949773_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_069970184.1|2949833_2952971_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408788.1|2953137_2953992_+	hypothetical protein	NA	A0A1B1INV8	uncultured_Mediterranean_phage	39.8	6.4e-14
WP_011408789.1|2954162_2955467_+	DUF445 family protein	NA	NA	NA	NA	NA
WP_069959889.1|2955608_2959703_+	response regulator	NA	A0A1V0SGX0	Hokovirus	28.4	1.1e-55
WP_011259389.1|2959736_2960723_+	response regulator	NA	W8CYM9	Bacillus_phage	26.8	2.8e-05
WP_069959890.1|2960847_2961831_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.5	1.5e-99
WP_027703873.1|2967580_2968240_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012444649.1|2968254_2969559_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_011259395.1|2969571_2972742_+	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_109181969.1|2973717_2974683_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
>prophage 21
NZ_CP013679	Xanthomonas oryzae pv. oryzae strain PXO602, complete genome	4951791	2984037	3053761	4951791	transposase	uncultured_Caudovirales_phage(61.54%)	46	NA	NA
WP_011258188.1|2984037_2985006_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_069959892.1|2985300_2987646_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041182891.1|2987663_2988395_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069959893.1|2988426_2990769_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014503414.1|2990793_2991522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069959894.1|2991550_2993893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042465604.1|2993917_2994661_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069964549.1|2994691_2997526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069964550.1|2997522_2998452_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_069964551.1|2998460_3001223_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	27.2	1.5e-43
WP_011408812.1|3006107_3006497_-	type VI secretion protein	NA	NA	NA	NA	NA
WP_011408813.1|3006651_3007611_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011408814.1|3007543_3007858_+	DUF1153 domain-containing protein	NA	NA	NA	NA	NA
WP_151420453.1|3008085_3009405_+|transposase	IS701-like element ISXo15 family transposase	transposase	NA	NA	NA	NA
WP_041183259.1|3010509_3010926_-	type I toxin-antitoxin system SymE family toxin	NA	NA	NA	NA	NA
WP_155296486.1|3010922_3011228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155296487.1|3011169_3011547_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069970129.1|3011627_3012695_-	ParA family protein	NA	H2BD62	Pseudomonas_phage	37.3	3.8e-48
WP_155296495.1|3012859_3015901_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_069959900.1|3016950_3017403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069959901.1|3017657_3019463_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_128415369.1|3019464_3019812_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044756757.1|3019887_3020595_+	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	51.2	8.4e-52
WP_011259416.1|3020746_3021139_+	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_075251701.1|3021161_3021677_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_069959903.1|3021673_3022027_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259417.1|3022115_3022856_+	flagellar motor protein	NA	NA	NA	NA	NA
WP_011408827.1|3022862_3023837_+	flagellar motor protein MotD	NA	NA	NA	NA	NA
WP_069959904.1|3023838_3024621_+	ParA family protein	NA	Q8JL10	Natrialba_phage	37.7	1.0e-13
WP_042465006.1|3024617_3025640_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_011259421.1|3025740_3026049_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_002806565.1|3026045_3026411_+	response regulator	NA	W8CYM9	Bacillus_phage	39.3	2.7e-14
WP_011259422.1|3026444_3028454_+	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_069960094.1|3028628_3028883_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_103073514.1|3030565_3031252_+	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	36.2	2.8e-12
WP_011408833.1|3031567_3032329_+	transporter	NA	NA	NA	NA	NA
WP_044756756.1|3032342_3034685_+	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	61.7	1.2e-09
WP_115840174.1|3035181_3036147_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_069959906.1|3036386_3038633_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	41.2	2.9e-13
WP_042465628.1|3039361_3041473_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	41.8	3.2e-14
WP_069959907.1|3042157_3044233_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.9	1.3e-12
WP_011259431.1|3044825_3047087_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.9	9.3e-12
WP_011408839.1|3047480_3049742_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	54.5	1.3e-10
WP_011259433.1|3050699_3051497_+	flagellar brake protein	NA	NA	NA	NA	NA
WP_011408841.1|3051632_3052115_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_094187763.1|3052963_3053761_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 22
NZ_CP013679	Xanthomonas oryzae pv. oryzae strain PXO602, complete genome	4951791	3132941	3144716	4951791	tRNA	Escherichia_phage(22.22%)	13	NA	NA
WP_011259503.1|3132941_3133241_-	endolysin	NA	A0A1W6JT17	Escherichia_phage	66.7	1.5e-15
WP_011259504.1|3133283_3133514_-	endolysin	NA	D5LH07	Escherichia_phage	63.8	4.7e-20
WP_011259505.1|3133757_3134507_-	isopentenyl transferase	NA	NA	NA	NA	NA
WP_011408881.1|3134511_3135207_-	hypothetical protein	NA	E5DV83	Deep-sea_thermophilic_phage	41.0	5.6e-16
WP_109181974.1|3135142_3135370_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012444559.1|3135392_3135692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103057240.1|3136079_3136484_-	helix-turn-helix domain-containing protein	NA	A0A1W6JTD5	Pseudomonas_phage	56.6	1.1e-32
WP_003481884.1|3137209_3137422_-	carbon storage regulator CsrA	NA	J7I430	Pseudomonas_phage	76.5	1.3e-13
WP_011259507.1|3137561_3140210_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	39.6	3.7e-84
WP_012444556.1|3140311_3140800_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_011408884.1|3141102_3142137_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	60.7	6.2e-112
WP_011408885.1|3142309_3142951_-	transcriptional repressor LexA	NA	A0A1W6JNS2	Morganella_phage	40.2	2.4e-13
WP_011408886.1|3143039_3144716_-	2-polyprenylphenol 6-hydroxylase	NA	E5EQ95	Micromonas_sp._RCC1109_virus	27.2	3.3e-38
>prophage 23
NZ_CP013679	Xanthomonas oryzae pv. oryzae strain PXO602, complete genome	4951791	3185025	3264014	4951791	transposase,plate	Xanthomonas_phage(50.0%)	59	NA	NA
WP_011407237.1|3185025_3185982_+|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
WP_011259549.1|3186080_3187193_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_041182180.1|3187189_3188320_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_011408908.1|3188441_3189140_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_027703449.1|3189136_3190372_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_011259553.1|3190384_3191227_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_011259554.1|3191507_3192359_-	chain-length determining protein	NA	NA	NA	NA	NA
WP_027703450.1|3192404_3193538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259555.1|3193534_3194485_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_011259556.1|3194481_3195735_-	O-antigen translocase	NA	NA	NA	NA	NA
WP_069959913.1|3195731_3196844_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	E5ES42	Bathycoccus_sp._RCC1105_virus	28.4	8.3e-30
WP_069959914.1|3196843_3197776_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_069959915.1|3197762_3198716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408914.1|3198719_3199391_-	acetyltransferase	NA	NA	NA	NA	NA
WP_011408915.1|3199387_3199819_-	WxcM-like domain-containing protein	NA	NA	NA	NA	NA
WP_041182464.1|3200213_3200744_+	cytochrome-c oxidase	NA	NA	NA	NA	NA
WP_012444527.1|3200827_3202168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408918.1|3202193_3202586_+	c-type cytochrome	NA	NA	NA	NA	NA
WP_033013216.1|3203028_3203817_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408920.1|3203880_3204462_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_011408921.1|3204353_3205115_+	zf-HC2 domain-containing protein	NA	NA	NA	NA	NA
WP_011259567.1|3205111_3206437_+	S8 family serine peptidase	NA	A0A217EQY2	Bacillus_phage	39.2	2.4e-23
WP_011259568.1|3206447_3207206_+	heme ABC transporter permease	NA	NA	NA	NA	NA
WP_011408923.1|3207202_3207409_+	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_011259569.1|3207405_3207876_+	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_011408924.1|3207939_3209928_+	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_011259571.1|3209924_3210467_+	DsbE family thiol:disulfide interchange protein	NA	NA	NA	NA	NA
WP_027703454.1|3210466_3210964_+	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_011408926.1|3210963_3211668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069959916.1|3211876_3215596_+	avirulence protein	NA	NA	NA	NA	NA
WP_155296488.1|3215651_3215798_+	hypothetical protein	NA	Q38057	Xanthomonas_phage	77.8	4.1e-06
WP_042464821.1|3215864_3216059_+	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	82.3	3.9e-20
WP_011408408.1|3216062_3216362_+	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	92.4	6.4e-46
WP_069964559.1|3216585_3221037_+	avirulence protein	NA	NA	NA	NA	NA
WP_012444931.1|3221305_3221500_+	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	79.0	1.3e-18
WP_011408408.1|3221503_3221803_+	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	92.4	6.4e-46
WP_069970132.1|3222026_3226472_+	avirulence protein	NA	NA	NA	NA	NA
WP_069964561.1|3226951_3227545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069959918.1|3227534_3229010_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	67.1	5.4e-101
WP_069959919.1|3229092_3231681_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_011259580.1|3231737_3232850_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_011259581.1|3232974_3233553_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_042465046.1|3235039_3237127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069959920.1|3237512_3238610_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_042465048.1|3239026_3242107_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033013236.1|3245142_3245850_+	response regulator	NA	NA	NA	NA	NA
WP_011259588.1|3245846_3246839_+	c-type cytochrome	NA	NA	NA	NA	NA
WP_011259589.1|3246835_3249295_+	two-component system VirA-like sensor kinase	NA	NA	NA	NA	NA
WP_011259590.1|3249408_3250389_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011408942.1|3250397_3251426_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_109181977.1|3251592_3252390_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_109181978.1|3252452_3253250_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_012444504.1|3253310_3253637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069959922.1|3253633_3256537_-	protein kinase	NA	A0A2R8FF19	Brazilian_cedratvirus	25.0	2.5e-09
WP_011408945.1|3256533_3257256_-	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
WP_011408946.1|3257252_3257900_-	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
WP_069959923.1|3257896_3261355_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_011408948.1|3261358_3262675_-	type VI secretion system protein TssL	NA	NA	NA	NA	NA
WP_011408949.1|3262676_3264014_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 24
NZ_CP013679	Xanthomonas oryzae pv. oryzae strain PXO602, complete genome	4951791	3272976	3340143	4951791	transposase,plate	Ralstonia_phage(83.33%)	50	NA	NA
WP_011408954.1|3272976_3273987_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_011259602.1|3273950_3275828_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_011259603.1|3275831_3276335_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_011259604.1|3276322_3277156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259605.1|3277191_3277695_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_027703472.1|3277794_3279309_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_024711387.1|3279301_3279808_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_011257031.1|3281165_3282134_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_155296489.1|3282269_3283589_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011260830.1|3283759_3284995_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011258802.1|3285180_3286149_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_115840162.1|3286285_3287605_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_069970134.1|3287671_3289594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259611.1|3289618_3290356_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408961.1|3290386_3292729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042465640.1|3292746_3293493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042465052.1|3293521_3296356_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012445381.1|3298855_3299455_-	NfuA family Fe-S biogenesis protein	NA	NA	NA	NA	NA
WP_012445382.1|3299542_3299899_+	4a-hydroxytetrahydrobiopterin dehydratase	NA	NA	NA	NA	NA
WP_012445383.1|3299895_3300318_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_011408967.1|3300333_3300567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069960235.1|3300593_3300854_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259619.1|3303024_3304011_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_042465057.1|3304421_3308135_+	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
WP_094187765.1|3308660_3309424_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_012445389.1|3309527_3310175_-	response regulator	NA	NA	NA	NA	NA
WP_011408973.1|3310396_3311158_-	sulfurtransferase	NA	NA	NA	NA	NA
WP_011257031.1|3311315_3312284_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_011408974.1|3312417_3312783_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408975.1|3312841_3313273_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_011259625.1|3313284_3314547_+	TIGR03862 family flavoprotein	NA	NA	NA	NA	NA
WP_011408976.1|3314530_3315823_-	nucleotide sugar dehydrogenase	NA	NA	NA	NA	NA
WP_011408977.1|3316192_3316963_+	4'-phosphopantetheinyl transferase superfamily protein	NA	NA	NA	NA	NA
WP_011259629.1|3317719_3318955_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_011408979.1|3320254_3320512_-	stress-induced protein	NA	NA	NA	NA	NA
WP_011408980.1|3320951_3321935_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.2	7.5e-99
WP_011258802.1|3322250_3323219_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011407489.1|3323355_3324675_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011408981.1|3324824_3325787_+|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_153296740.1|3326036_3326195_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041182195.1|3326226_3326406_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109181928.1|3326770_3327736_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011408985.1|3328943_3329921_+	siroheme synthase	NA	NA	NA	NA	NA
WP_042465070.1|3330729_3330924_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408987.1|3332317_3332680_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408988.1|3332663_3333233_-	molybdenum cofactor guanylyltransferase	NA	NA	NA	NA	NA
WP_011259640.1|3333270_3334524_-	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_011408989.1|3334729_3335107_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259629.1|3337035_3338271_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_011407587.1|3339108_3340143_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	32.8	8.0e-43
>prophage 25
NZ_CP013679	Xanthomonas oryzae pv. oryzae strain PXO602, complete genome	4951791	3481253	3609352	4951791	tRNA,protease,integrase,transposase	Ralstonia_phage(14.29%)	101	3582661:3582720	3602290:3603101
WP_094187736.1|3481253_3482017_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_125168762.1|3482849_3483095_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259756.1|3483040_3485407_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_011409066.1|3485403_3486078_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259758.1|3486287_3487226_-	isopenicillin N synthase family oxygenase	NA	NA	NA	NA	NA
WP_011259759.1|3487348_3488698_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_011259760.1|3488694_3489582_-	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_011409067.1|3489899_3490706_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_011259762.1|3491151_3492369_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_069959939.1|3492474_3493443_+	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	23.7	5.4e-09
WP_011259764.1|3493785_3494454_-	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_011259765.1|3494450_3495224_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_103057773.1|3495797_3497864_-	ferrous iron transporter B	NA	NA	NA	NA	NA
WP_011259769.1|3498430_3499456_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_011409070.1|3499540_3500614_-	D-glycerate dehydrogenase	NA	M1HTA3	Paramecium_bursaria_Chlorella_virus	23.2	2.1e-14
WP_011259771.1|3500606_3501710_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	40.4	1.6e-73
WP_011259772.1|3501720_3502647_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_069959940.1|3502727_3503378_+	SCO family protein	NA	NA	NA	NA	NA
WP_069959941.1|3503374_3504223_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_069959942.1|3504773_3506357_-	transglycosylase SLT domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	31.5	4.2e-11
WP_103073413.1|3506543_3506999_+	DUF853 family protein	NA	A0A248XCZ8	Klebsiella_phage	43.6	5.4e-12
WP_011409074.1|3507067_3507535_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_103057205.1|3507779_3508997_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_153296738.1|3508957_3509245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069960098.1|3509355_3509862_+	transcription elongation factor GreB	NA	NA	NA	NA	NA
WP_044756621.1|3509983_3511384_-	30S ribosomal protein S12 methylthiotransferase RimO	NA	NA	NA	NA	NA
WP_011409077.1|3511646_3512222_+	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_011409078.1|3512218_3512653_+	HIT family protein	NA	NA	NA	NA	NA
WP_011259782.1|3512680_3512848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259783.1|3513512_3513698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259784.1|3513732_3514302_-	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	70.1	2.6e-72
WP_011259785.1|3514394_3515246_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_011259787.1|3516633_3518649_+	M13 family metallopeptidase	NA	NA	NA	NA	NA
WP_012445555.1|3518919_3519618_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_011409081.1|3519658_3520066_-	methylated-DNA--protein-cysteine methyltransferase	NA	NA	NA	NA	NA
WP_011409082.1|3520503_3521466_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011409084.1|3522749_3524000_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011409085.1|3524007_3525252_-	DUF418 domain-containing protein	NA	NA	NA	NA	NA
WP_011259794.1|3525479_3525959_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_027704197.1|3526069_3526606_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	40.5	3.2e-19
WP_011259796.1|3526715_3527465_+	C40 family peptidase	NA	A0A0K2SUC1	Clostridium_phage	38.5	1.2e-19
WP_011259797.1|3527672_3528164_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_011409088.1|3529277_3530597_-	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_011259800.1|3530741_3532448_+	alkaline phosphatase	NA	NA	NA	NA	NA
WP_011259801.1|3532481_3533786_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_011259802.1|3533817_3534078_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_011259803.1|3534079_3534955_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_027704198.1|3536789_3537254_-	DUF4870 domain-containing protein	NA	NA	NA	NA	NA
WP_012445570.1|3537305_3537494_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069959944.1|3537466_3537787_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012445571.1|3537783_3539151_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_044756609.1|3539296_3539878_+	ribosome-associated protein	NA	NA	NA	NA	NA
WP_011259808.1|3540134_3541580_-|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_011409097.1|3542426_3546347_-	TIGR02099 family protein	NA	NA	NA	NA	NA
WP_011259814.1|3546480_3547980_-	ribonuclease G	NA	NA	NA	NA	NA
WP_011409098.1|3547979_3548552_-	Maf-like protein	NA	NA	NA	NA	NA
WP_011409099.1|3548690_3549425_+	SIMPL domain-containing protein	NA	NA	NA	NA	NA
WP_011409100.1|3549896_3553010_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011409102.1|3554428_3554899_-	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_109181984.1|3555453_3555927_+	DUF839 domain-containing protein	NA	NA	NA	NA	NA
WP_011259821.1|3555984_3557100_-	J domain-containing protein	NA	NA	NA	NA	NA
WP_011259822.1|3557111_3557528_-	ribosome silencing factor	NA	NA	NA	NA	NA
WP_027703805.1|3557584_3558484_-	nicotinate-nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_011259823.1|3558480_3559509_-	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_011409105.1|3559531_3560167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259825.1|3560680_3563323_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	39.7	2.7e-172
WP_011259826.1|3563395_3564007_-	DUF998 domain-containing protein	NA	NA	NA	NA	NA
WP_011409107.1|3564211_3565069_+	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	41.8	1.3e-11
WP_011409108.1|3565324_3565774_+	DUF4442 domain-containing protein	NA	NA	NA	NA	NA
WP_109181928.1|3566073_3567039_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_094187715.1|3567163_3567926_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_027704065.1|3568536_3568830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259829.1|3569303_3569537_+	DUF378 domain-containing protein	NA	NA	NA	NA	NA
WP_011409111.1|3569570_3570584_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_011259831.1|3570551_3570743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115801901.1|3570833_3572153_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_041182217.1|3572240_3573455_-|transposase	IS4-like element ISXo14 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	1.1e-54
WP_011259834.1|3573600_3574128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041182722.1|3574124_3575090_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_094187771.1|3575330_3576093_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011409116.1|3576395_3578528_+	glycogen debranching protein GlgX	NA	NA	NA	NA	NA
WP_011258351.1|3579078_3580047_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	1.9e-99
WP_011258803.1|3580207_3581176_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.5e-99
WP_082323400.1|3582251_3582665_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
3582661:3582720	attL	GTTAACACATCCGAAGCCCATCAACGACCAGAACGAAGCTGAGGAAGCCAAGGAACATGA	NA	NA	NA	NA
WP_094187715.1|3582661_3583425_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_094187763.1|3584296_3585094_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011409118.1|3585127_3585520_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_027704094.1|3585610_3586003_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075239728.1|3588341_3588761_+|integrase	tyrosine-type recombinase/integrase	integrase	C8CLF4	Xylella_phage	65.2	5.1e-41
WP_012445601.1|3590477_3592262_-	autotransporter domain-containing esterase	NA	NA	NA	NA	NA
WP_011259851.1|3592452_3592653_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_011409125.1|3593188_3593983_+	thiazole synthase	NA	NA	NA	NA	NA
WP_011259853.1|3594284_3595043_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_011259854.1|3595118_3596981_+	SLC13 family permease	NA	NA	NA	NA	NA
WP_011409127.1|3597038_3597380_-	Rieske (2Fe-2S) protein	NA	NA	NA	NA	NA
WP_011259856.1|3597639_3597915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409129.1|3600962_3601676_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_012445603.1|3601736_3602159_+	large-conductance mechanosensitive channel protein MscL	NA	NA	NA	NA	NA
WP_094187715.1|3602290_3603054_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011409134.1|3606127_3607039_-	RNA methyltransferase	NA	NA	NA	NA	NA
3602290:3603101	attR	GTTAACACATCCGAAGCCCATCAACGACCAGAACGAAGCTGAGGAAGCCAAGGAACATGACATCCAGCTTCTCGAAGCGCGTGAAAATCCGTCGGTAGCCCTTCAAGCGACGGAACAGCCTCTCCACTTCGTTGCGCCGCTTGTACATTTCCTTGTCGTACTCCCAAGGATCGACCCGATTGGACTTGGGTGGAACCACCGGCACGAAGCCAAGATCGAGCGCCAACTGGCGGGTTTCATTGCCTTCGTAAGCGCGATCCATCAGCAGATGAACCGGCCGCTCCACTGGCCCCAGGTGTTCAAGCAACGCGCGGCCTGCGGGTGCGTCATGTGCGTTGCCAGGCGTCAATCCGAACGTGATGGCTGTTCGAGCATCTGCGGCAACCATATGAATTTTGGTGTTCCATCCGCCGCGCGATTTCCCGATGGATTGTGGGCCGTTTTTTTTAATGCGCCAGTGCCATCCGGATGCACCTTGATGCTGGTGGAGTCCAGCGAGACCGCTTCGATTTTGATGCGCACGATCTGGCAGGTCTGCAATTGGGCGAACATCCGGTCCAGCACACCGGACTTGGCCCAACGGTTAATGCGCGTGTACACCGTATGCCAGTTGCCAAAGCGCTCGGGCAGACCGCGCCATTTGCAGCCATGCTCTGCGACGTAAAGAAGGGCGTTGACTACCTGCAGGTTGGTCATGCTGACATTGCCGCGTTGCAAAGGTAGGCAATGCTCGATGAGTGCAAATTGTGCTGGCGTGATCTCCATGCCCAATAGTTTAATCGCTCGAGACATTAATGTTAACAGGCCCTAGC	NA	NA	NA	NA
WP_109182013.1|3608386_3609352_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
>prophage 26
NZ_CP013679	Xanthomonas oryzae pv. oryzae strain PXO602, complete genome	4951791	3656795	3733095	4951791	transposase,plate	Liberibacter_phage(15.38%)	52	NA	NA
WP_011407175.1|3656795_3657764_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	5.6e-99
WP_011407587.1|3658784_3659819_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	32.8	8.0e-43
WP_011259895.1|3660202_3660928_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_011409154.1|3661059_3661521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069970137.1|3662184_3663561_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	53.4	8.9e-74
WP_027704153.1|3663634_3665755_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_027704154.1|3666021_3666867_-	transporter	NA	NA	NA	NA	NA
WP_011259903.1|3667991_3669962_-	oligopeptide transporter, OPT family	NA	NA	NA	NA	NA
WP_011259904.1|3670390_3671788_+	endoproteinase ArgC	NA	NA	NA	NA	NA
WP_027704156.1|3671900_3672719_-	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_094187840.1|3673029_3676227_-	error-prone DNA polymerase	NA	A0A1B1PA77	Streptomyces_phage	24.8	1.7e-80
WP_011259908.1|3676462_3677881_-	DNA polymerase Y family protein	NA	NA	NA	NA	NA
WP_082348427.1|3677890_3678493_-	translesion DNA synthesis-associated protein ImuA	NA	NA	NA	NA	NA
WP_011259910.1|3678542_3679148_-	repressor LexA	NA	A0A1W6JNS2	Morganella_phage	39.2	8.6e-13
WP_011259911.1|3679297_3679519_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_011409165.1|3679528_3679954_+	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A1B3AYM0	Gordonia_phage	48.5	5.8e-08
WP_143690655.1|3680347_3680542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409167.1|3681468_3682248_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_011409168.1|3682462_3683092_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_027704159.1|3683152_3683908_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041182227.1|3684236_3685013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069964802.1|3685421_3686996_+	serine/threonine protein kinase	NA	NA	NA	NA	NA
WP_039440923.1|3687244_3687511_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069970138.1|3687788_3690968_-	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	30.8	6.4e-75
WP_094187841.1|3690967_3692119_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_011409179.1|3692534_3692969_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069970186.1|3692979_3694509_-	SAM-dependent DNA methyltransferase	NA	A0A2H4PQP4	Staphylococcus_phage	29.1	7.4e-45
WP_011409181.1|3694811_3695804_-	restriction endonuclease	NA	A0A1B1IUE7	uncultured_Mediterranean_phage	29.2	1.5e-30
WP_044756557.1|3695856_3696165_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_069970139.1|3696745_3700219_+	type I restriction-modification system endonuclease	NA	A0A1B1IW48	uncultured_Mediterranean_phage	21.9	1.9e-08
WP_041182233.1|3700358_3701357_+	Abi family protein	NA	NA	NA	NA	NA
WP_069960250.1|3701403_3702948_+	type I restriction-modification system subunit M	NA	A0A220A2U5	Liberibacter_phage	23.9	1.5e-13
WP_069964800.1|3704374_3704683_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_047340450.1|3704689_3704953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082323166.1|3705675_3706431_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_069970140.1|3706724_3707756_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082323403.1|3707764_3709699_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069963889.1|3709610_3710636_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082323435.1|3710638_3712651_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069959962.1|3713135_3714155_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082323404.1|3714159_3716103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069959963.1|3716014_3717037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082323405.1|3717046_3718990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069959964.1|3718901_3719918_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069959965.1|3719926_3722794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052658684.1|3722812_3723718_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_069970142.1|3723659_3726422_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	27.5	3.3e-43
WP_011259938.1|3726514_3726868_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259939.1|3726898_3729628_-	type VI secretion system ATPase TssH	NA	A0A223W0B1	Agrobacterium_phage	29.6	7.1e-91
WP_011259940.1|3729713_3730805_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_069959967.1|3730768_3732604_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_011409203.1|3732606_3733095_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 27
NZ_CP013679	Xanthomonas oryzae pv. oryzae strain PXO602, complete genome	4951791	3827489	3838316	4951791	transposase	Burkholderia_virus(28.57%)	8	NA	NA
WP_027703307.1|3827489_3828293_-	sulfotransferase	NA	M4QPS9	Synechococcus_phage	27.3	4.5e-25
WP_027703308.1|3828723_3828906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069960107.1|3829373_3832328_+	aminomethyl-transferring glycine dehydrogenase	NA	M4QFZ1	Prochlorococcus_phage	49.9	9.0e-257
WP_011260010.1|3832657_3833107_+	hypothetical protein	NA	A4JWV5	Burkholderia_virus	34.1	3.3e-09
WP_011409250.1|3833103_3833799_+	VRR-NUC domain-containing protein	NA	Q8W6S1	Burkholderia_virus	46.1	2.2e-36
WP_011409251.1|3833806_3834877_+	DUF3396 domain-containing protein	NA	E5E3X8	Burkholderia_phage	36.6	5.7e-60
WP_011409252.1|3834873_3835959_+	DUF3396 domain-containing protein	NA	E5E3X8	Burkholderia_phage	37.9	4.0e-61
WP_069960108.1|3837359_3838316_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.3	1.8e-41
>prophage 28
NZ_CP013679	Xanthomonas oryzae pv. oryzae strain PXO602, complete genome	4951791	4144565	4249945	4951791	transposase	Ralstonia_phage(16.67%)	70	NA	NA
WP_155296496.1|4144565_4146173_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_075242322.1|4146334_4146598_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_075242321.1|4146602_4147262_+	histidine kinase	NA	W8CYF6	Bacillus_phage	23.4	7.1e-13
WP_011260279.1|4147448_4148813_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_011409411.1|4149028_4149724_+	VIT family protein	NA	NA	NA	NA	NA
WP_011409413.1|4150670_4151294_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_011409414.1|4151495_4152236_+	cytochrome c4	NA	NA	NA	NA	NA
WP_011409415.1|4152329_4152980_+	thiol:disulfide interchange protein DsbA/DsbL	NA	NA	NA	NA	NA
WP_011260284.1|4153071_4153887_+	thiol:disulfide interchange protein DsbA/DsbL	NA	NA	NA	NA	NA
WP_069970187.1|4153936_4154674_+	endonuclease	NA	NA	NA	NA	NA
WP_011409419.1|4156602_4157592_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.2	7.5e-99
WP_041182588.1|4157714_4160288_+	pyridoxal-phosphate dependent enzyme	NA	NA	NA	NA	NA
WP_109182012.1|4160480_4161243_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011258802.1|4161316_4162285_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011409421.1|4163018_4163285_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_094187728.1|4164216_4165015_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011260292.1|4166661_4167894_+	multifunctional CCA addition/repair protein	NA	K4IEX3	Salmonella_phage	41.7	2.0e-72
WP_011409423.1|4167933_4168896_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011407237.1|4169071_4170028_-|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
WP_011258802.1|4170239_4171208_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_094187715.1|4171543_4172306_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_109182013.1|4175716_4176682_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_012444134.1|4177143_4177374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129593046.1|4178042_4180040_+	poly-beta-1,6 N-acetyl-D-glucosamine export porin PgaA	NA	NA	NA	NA	NA
WP_011409429.1|4180041_4181940_+	poly-beta-1,6-N-acetyl-D-glucosamine N-deacetylase PgaB	NA	NA	NA	NA	NA
WP_069970149.1|4181941_4183195_+	poly-beta-1,6 N-acetyl-D-glucosamine synthase	NA	NA	NA	NA	NA
WP_069959998.1|4183191_4183797_+	poly-beta-1,6-N-acetyl-D-glucosamine biosynthesis protein PgaD	NA	NA	NA	NA	NA
WP_044756434.1|4184216_4185371_-	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
WP_011260300.1|4185373_4186402_-	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_012444129.1|4186408_4187476_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_011260302.1|4187516_4188794_-	sugar MFS transporter	NA	NA	NA	NA	NA
WP_011409432.1|4188838_4189606_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_069959999.1|4189820_4190987_-	DUF1624 domain-containing protein	NA	NA	NA	NA	NA
WP_069964600.1|4193542_4196440_-	glycoside hydrolase family 2 protein	NA	L0N6M2	Herpes_simplex_virus	25.2	8.8e-23
WP_069960264.1|4196590_4199281_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011260311.1|4201360_4202545_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_011409442.1|4202612_4203350_+	pteridine reductase	NA	NA	NA	NA	NA
WP_011260313.1|4203518_4204034_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_011260314.1|4204125_4205628_-	hybrid sensor histidine kinase/response regulator	NA	A0A2K9L5I4	Tupanvirus	26.2	1.1e-08
WP_011260315.1|4205631_4206072_-	response regulator	NA	NA	NA	NA	NA
WP_011409443.1|4206068_4207880_-	PAS domain S-box protein	NA	A0A2K9L0Z8	Tupanvirus	28.3	3.5e-09
WP_011409444.1|4208165_4208528_-	BON domain-containing protein	NA	NA	NA	NA	NA
WP_011260318.1|4208687_4209740_+	oxidoreductase	NA	NA	NA	NA	NA
WP_011260319.1|4210079_4211021_-	decarboxylating 6-phosphogluconate dehydrogenase	NA	M4SJX8	Cyanophage	44.9	5.9e-69
WP_075239460.1|4211041_4212379_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409446.1|4212550_4212931_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_012444115.1|4213055_4213817_-	DUF2242 domain-containing protein	NA	NA	NA	NA	NA
WP_011409450.1|4216065_4217469_-	nicotinate phosphoribosyltransferase	NA	A0A218M332	Acidovorax_phage	51.5	8.1e-131
WP_011260326.1|4217591_4218647_-	bifunctional nicotinamide-nucleotide adenylyltransferase/Nudix hydroxylase	NA	A0A1B0V161	Roseobacter_phage	47.1	1.3e-80
WP_103057229.1|4218819_4219674_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_011260328.1|4219965_4222149_-	PDZ domain-containing protein	NA	A0A0R6PIZ1	Moraxella_phage	31.6	2.8e-82
WP_044756429.1|4222548_4223562_-	lipoyl synthase	NA	NA	NA	NA	NA
WP_027703467.1|4223576_4224275_-	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_011409453.1|4224262_4224541_-	YbeD family protein	NA	NA	NA	NA	NA
WP_069964757.1|4225606_4226812_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	41.2	2.7e-66
WP_011260335.1|4227312_4228728_-	septal ring lytic transglycosylase RlpA family protein	NA	F5B3X9	Synechococcus_phage	50.6	4.3e-15
WP_011260336.1|4228724_4229864_-	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_069963899.1|4232253_4233210_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	8.1e-42
WP_143698369.1|4233217_4233976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075239457.1|4233981_4235706_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A2H4JIA8	uncultured_Caudovirales_phage	24.3	2.6e-22
WP_082323410.1|4235702_4238471_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_011260340.1|4239232_4240351_-	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_011409461.1|4240347_4242408_-	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_011409462.1|4242411_4242897_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_069970150.1|4242893_4244270_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_012444096.1|4244442_4245489_-	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	21.2	4.6e-06
WP_069970151.1|4245764_4246697_+	carbohydrate kinase family protein	NA	NA	NA	NA	NA
WP_069960002.1|4247890_4248346_-	nucleoside deaminase	NA	NA	NA	NA	NA
WP_069960003.1|4248342_4248843_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_069970153.1|4248943_4249945_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 29
NZ_CP013679	Xanthomonas oryzae pv. oryzae strain PXO602, complete genome	4951791	4298267	4431653	4951791	tRNA,transposase	Ralstonia_phage(25.0%)	104	NA	NA
WP_094187715.1|4298267_4299031_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_027704042.1|4300078_4300864_+	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_011260388.1|4301117_4302791_+	alpha,alpha-trehalase TreA	NA	NA	NA	NA	NA
WP_011409497.1|4303334_4303781_-	autotransporter	NA	NA	NA	NA	NA
WP_012444053.1|4304111_4304396_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027703841.1|4304990_4305902_-	magnesium transporter	NA	NA	NA	NA	NA
WP_027703842.1|4306147_4307143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044757313.1|4307236_4308613_-	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_069960010.1|4309779_4311480_+	1,4-beta-cellobiosidase	NA	NA	NA	NA	NA
WP_012444044.1|4311888_4313661_+	cellulase family glycosylhydrolase	NA	NA	NA	NA	NA
WP_094187849.1|4313936_4314821_-	DMT family transporter	NA	NA	NA	NA	NA
WP_044757311.1|4315009_4315888_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080493954.1|4316087_4316483_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260398.1|4317927_4319019_+	DUF1615 domain-containing protein	NA	NA	NA	NA	NA
WP_011409507.1|4320921_4323246_+	S9 family peptidase	NA	NA	NA	NA	NA
WP_069960011.1|4323441_4325388_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_011409509.1|4325762_4325954_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260404.1|4326344_4327928_+	SDR family oxidoreductase	NA	M1NLX1	Moumouvirus	27.5	6.5e-36
WP_027704189.1|4328275_4328872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069960267.1|4330220_4331069_-	threonine aldolase	NA	NA	NA	NA	NA
WP_011409514.1|4331103_4332579_-	anthranilate synthase component I	NA	S4VT78	Pandoravirus	32.5	3.1e-40
WP_011260408.1|4333176_4334106_-	lipid kinase YegS	NA	NA	NA	NA	NA
WP_011260409.1|4334340_4334832_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011260410.1|4334828_4335500_-	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_011409516.1|4335894_4336224_-	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_044757306.1|4337831_4338509_+	NYN domain-containing protein	NA	A4JWQ6	Burkholderia_virus	60.3	8.8e-75
WP_011409520.1|4341026_4341512_+	DUF962 domain-containing protein	NA	NA	NA	NA	NA
WP_011409522.1|4342050_4344879_+	monovalent cation/H+ antiporter subunit A	NA	NA	NA	NA	NA
WP_011409523.1|4344878_4345253_+	Na+/H+ antiporter subunit C	NA	NA	NA	NA	NA
WP_069960013.1|4345249_4346794_+	monovalent cation/H+ antiporter subunit D	NA	NA	NA	NA	NA
WP_044756383.1|4346790_4347297_+	Na+/H+ antiporter subunit E	NA	NA	NA	NA	NA
WP_011260421.1|4347293_4347578_+	K+/H+ antiporter subunit F	NA	NA	NA	NA	NA
WP_011260422.1|4347574_4347928_+	Na+/H+ antiporter subunit G	NA	NA	NA	NA	NA
WP_094187715.1|4348479_4349242_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011258802.1|4349713_4350682_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011409528.1|4351113_4352439_-	homogentisate 1,2-dioxygenase	NA	NA	NA	NA	NA
WP_011409529.1|4352803_4353874_-	4-hydroxyphenylpyruvate dioxygenase	NA	NA	NA	NA	NA
WP_069960268.1|4354037_4354532_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011409530.1|4354888_4355479_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_044756377.1|4355490_4356999_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	33.8	1.3e-62
WP_011260428.1|4357441_4358335_-	tryptophan 2,3-dioxygenase	NA	NA	NA	NA	NA
WP_075242274.1|4359703_4360369_+	pyruvate dehydrogenase E1 subunit alpha	NA	NA	NA	NA	NA
WP_115801908.1|4361001_4361967_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011260435.1|4362499_4362880_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094187715.1|4363040_4363804_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_103073472.1|4363898_4364804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260437.1|4364872_4366168_+	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_069960017.1|4366283_4366808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260439.1|4367233_4368499_-	porphyrin biosynthesis protein	NA	NA	NA	NA	NA
WP_011409539.1|4368495_4369473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012444011.1|4369576_4370380_-	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_011260442.1|4370555_4371365_+	glycosyltransferase family 25 protein	NA	NA	NA	NA	NA
WP_109182023.1|4371372_4372171_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_094187851.1|4372213_4372861_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409543.1|4372955_4373531_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109181902.1|4373742_4375062_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011409545.1|4375211_4376180_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011260446.1|4376305_4377058_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_011260447.1|4377095_4377536_-	EF-hand domain-containing protein	NA	NA	NA	NA	NA
WP_011409547.1|4377742_4378084_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260449.1|4378309_4378687_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260450.1|4378897_4379095_-	CPXCG motif-containing cysteine-rich protein	NA	NA	NA	NA	NA
WP_069960019.1|4379401_4380148_-	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_044756487.1|4380555_4381770_-|transposase	IS4-like element ISXo14 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.7	8.2e-55
WP_069965058.1|4382627_4384040_+	NlpC-P60 family protein	NA	NA	NA	NA	NA
WP_011260454.1|4384036_4385134_+	dipeptide epimerase	NA	NA	NA	NA	NA
WP_094187763.1|4385288_4386087_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_099051302.1|4386140_4386939_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011409552.1|4387158_4388121_+|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_109182024.1|4388568_4389332_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011260456.1|4389613_4390390_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409554.1|4390386_4391703_+	amino acid permease	NA	NA	NA	NA	NA
WP_069960021.1|4392219_4393455_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011260459.1|4394048_4394330_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069960022.1|4394890_4395328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258802.1|4395330_4396299_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_115801874.1|4396511_4397831_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011409559.1|4398136_4399315_+	PQQ-dependent sugar dehydrogenase	NA	NA	NA	NA	NA
WP_069960023.1|4400310_4401273_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011260467.1|4403606_4405778_-	beta-glucosidase	NA	NA	NA	NA	NA
WP_011409563.1|4406005_4406362_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_011260469.1|4406440_4407505_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	57.1	8.6e-101
WP_002808376.1|4407785_4408001_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_069960024.1|4408308_4408755_+	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	45.9	4.7e-24
WP_069960025.1|4410232_4411195_+	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_011260472.1|4411284_4413033_+	DNA primase	NA	A0A1S5RF71	Helicobacter_phage	34.5	4.2e-44
WP_151420490.1|4413276_4414596_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_155296490.1|4414666_4414831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059317500.1|4414830_4415097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033013369.1|4415321_4416368_+	bile acid:sodium symporter	NA	NA	NA	NA	NA
WP_069960027.1|4416551_4418132_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_011409570.1|4418520_4419417_-	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
WP_011260477.1|4419419_4420583_-	heme A synthase	NA	NA	NA	NA	NA
WP_011260478.1|4420593_4421169_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409571.1|4421196_4421916_-	SURF1 family protein	NA	NA	NA	NA	NA
WP_012443949.1|4421976_4422195_+	twin transmembrane helix small protein	NA	NA	NA	NA	NA
WP_011260481.1|4422287_4423163_-	cytochrome c oxidase subunit 3	NA	NA	NA	NA	NA
WP_024743269.1|4423201_4423798_-	cytochrome c oxidase assembly protein	NA	NA	NA	NA	NA
WP_011409573.1|4423794_4423968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260484.1|4423948_4425553_-	cytochrome c oxidase subunit I	NA	NA	NA	NA	NA
WP_011260485.1|4425591_4426545_-	cytochrome c oxidase subunit II	NA	NA	NA	NA	NA
WP_011409574.1|4426561_4427038_-	DUF2244 domain-containing protein	NA	NA	NA	NA	NA
WP_011260487.1|4427314_4430515_+	bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase PutA	NA	NA	NA	NA	NA
WP_094187805.1|4430674_4431653_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	1.9e-38
>prophage 30
NZ_CP013679	Xanthomonas oryzae pv. oryzae strain PXO602, complete genome	4951791	4444951	4520740	4951791	tRNA,integrase,transposase	Acidithiobacillus_phage(23.08%)	55	4450821:4450841	4518940:4518960
WP_094187806.1|4444951_4446053_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.5	1.1e-39
WP_011409585.1|4446657_4448889_-	NADP-dependent isocitrate dehydrogenase	NA	NA	NA	NA	NA
WP_069960113.1|4449078_4450791_+	hypothetical protein	NA	NA	NA	NA	NA
4450821:4450841	attL	ATAGTCGCCCCTGAAAAACCG	NA	NA	NA	NA
WP_069960029.1|4450939_4452316_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	56.5	3.7e-80
WP_115801910.1|4454523_4455322_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_143699981.1|4456420_4456804_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075240159.1|4457422_4457653_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258802.1|4457910_4458879_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_069960033.1|4459045_4460017_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.9	7.2e-38
WP_011409594.1|4460209_4461394_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.8	5.0e-41
WP_011260517.1|4461861_4462677_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	35.8	7.4e-36
WP_069960034.1|4463435_4464752_-	amidohydrolase	NA	NA	NA	NA	NA
WP_011260520.1|4465011_4466256_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_011260521.1|4466348_4469597_+	MMPL family transporter	NA	NA	NA	NA	NA
WP_011409597.1|4469730_4472871_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_011409598.1|4473160_4474528_-	VOC family protein	NA	NA	NA	NA	NA
WP_012443929.1|4474537_4474747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109182121.1|4475272_4476238_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_027703675.1|4478084_4478555_+	thioesterase	NA	NA	NA	NA	NA
WP_011409601.1|4478583_4479006_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260528.1|4479081_4479516_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_011260529.1|4479625_4480141_+	protein-export chaperone SecB	NA	NA	NA	NA	NA
WP_011409602.1|4480156_4481182_+	NAD(P)-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_011260531.1|4481504_4482101_-	Ax21 family protein	NA	NA	NA	NA	NA
WP_069970157.1|4482458_4484186_+	ubiquinone-dependent pyruvate dehydrogenase	NA	NA	NA	NA	NA
WP_011260533.1|4484235_4485678_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_011260534.1|4485662_4487009_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_011409603.1|4487199_4487949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260536.1|4488050_4488662_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260537.1|4488766_4489990_+	MFS transporter	NA	NA	NA	NA	NA
WP_011260538.1|4490331_4490808_-|tRNA	tRNA (cytidine(34)-2'-O)-methyltransferase	tRNA	NA	NA	NA	NA
WP_011409604.1|4490834_4491296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010370565.1|4491681_4492002_+	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
WP_011260540.1|4492103_4493120_+	3-oxoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_011260541.1|4493191_4494355_+	Fic family protein	NA	NA	NA	NA	NA
WP_011260542.1|4494351_4495983_+	site-specific DNA-methyltransferase	NA	A0A2K5B2C1	Erysipelothrix_phage	37.5	1.7e-63
WP_042465275.1|4495984_4498486_+	helicase SNF2	NA	NA	NA	NA	NA
WP_011260544.1|4498482_4499385_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_011409606.1|4499606_4499990_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_011260546.1|4500308_4501979_+	AMP-binding protein	NA	NA	NA	NA	NA
WP_011409607.1|4502207_4503218_+	NAD-dependent epimerase/dehydratase family protein	NA	A0A0E3FNQ3	Synechococcus_phage	32.6	1.5e-14
WP_011260548.1|4503282_4503441_+	DUF1328 domain-containing protein	NA	NA	NA	NA	NA
WP_011260549.1|4503675_4505052_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.1	5.0e-77
WP_041182305.1|4505062_4505596_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011409609.1|4506024_4507284_-	HD-GYP domain-containing protein	NA	NA	NA	NA	NA
WP_011260552.1|4507422_4508730_-	MFS transporter	NA	NA	NA	NA	NA
WP_011407587.1|4510814_4511849_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	32.8	8.0e-43
WP_011409611.1|4512199_4512745_+	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_011409612.1|4512770_4513037_-	proteinase inhibitor	NA	NA	NA	NA	NA
WP_069970158.1|4513211_4515050_+	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
WP_069970159.1|4515280_4516156_-|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	48.5	5.3e-56
WP_082323438.1|4516239_4517616_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.8	3.5e-78
WP_012445230.1|4517642_4518878_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_103057293.1|4519299_4519563_-	xanthomonadin biosynthesis protein	NA	NA	NA	NA	NA
4518940:4518960	attR	CGGTTTTTCAGGGGCGACTAT	NA	NA	NA	NA
WP_069970161.1|4519756_4520740_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.5	2.6e-99
>prophage 31
NZ_CP013679	Xanthomonas oryzae pv. oryzae strain PXO602, complete genome	4951791	4641631	4699348	4951791	tRNA,transposase	Leptospira_phage(33.33%)	34	NA	NA
WP_109182036.1|4641631_4642597_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011260658.1|4642697_4643123_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_094187715.1|4643165_4643928_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011260659.1|4643990_4645022_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	42.9	2.0e-70
WP_011260660.1|4646382_4647639_+	alanine--glyoxylate aminotransferase family protein	NA	NA	NA	NA	NA
WP_011260661.1|4647635_4648526_+	allantoinase PuuE	NA	NA	NA	NA	NA
WP_012443820.1|4648522_4648918_+	DUF3225 domain-containing protein	NA	NA	NA	NA	NA
WP_075239612.1|4648937_4649516_+	2-oxo-4-hydroxy-4-carboxy-5-ureidoimidazoline decarboxylase	NA	NA	NA	NA	NA
WP_143698279.1|4649401_4650265_+	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
WP_155296491.1|4650261_4651581_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_094187715.1|4655023_4655787_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011260667.1|4657182_4659267_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_011260668.1|4659366_4661394_-	acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha	NA	NA	NA	NA	NA
WP_011260669.1|4661636_4663247_-	methylcrotonoyl-CoA carboxylase	NA	A0A1B2ITV7	Pike_perch_iridovirus	51.5	1.1e-19
WP_011260670.1|4663257_4664421_-	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_011409694.1|4664549_4665170_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012443812.1|4665500_4665689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260672.1|4665731_4666067_-	DUF3325 domain-containing protein	NA	NA	NA	NA	NA
WP_075242289.1|4667691_4668003_-	DUF3649 domain-containing protein	NA	NA	NA	NA	NA
WP_011409699.1|4669121_4669640_+	cytochrome c5 family protein	NA	NA	NA	NA	NA
WP_012443806.1|4669910_4671629_+	ExeM/NucH family extracellular endonuclease	NA	NA	NA	NA	NA
WP_011260679.1|4671719_4672106_-	MerC family mercury resistance protein	NA	NA	NA	NA	NA
WP_011260680.1|4672167_4673493_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_050580196.1|4673607_4674921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260682.1|4675019_4675745_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409701.1|4675961_4676624_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_011409702.1|4676702_4677797_+	cell division protein ZapE	NA	NA	NA	NA	NA
WP_011409705.1|4679301_4682061_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	35.9	3.5e-146
WP_011409706.1|4682313_4683903_-	sulfotransferase family protein	NA	NA	NA	NA	NA
WP_011409707.1|4683902_4686140_-|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_011409708.1|4686428_4687337_-|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_011409709.1|4687426_4689241_+	type II/IV secretion system protein	NA	NA	NA	NA	NA
WP_153303324.1|4689626_4698452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115801913.1|4698550_4699348_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 32
NZ_CP013679	Xanthomonas oryzae pv. oryzae strain PXO602, complete genome	4951791	4709524	4784231	4951791	tRNA,tail,transposase	Escherichia_phage(20.0%)	49	NA	NA
WP_011260702.1|4709524_4710442_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	62.5	3.1e-83
WP_011259480.1|4711045_4712383_+	xylose isomerase	NA	NA	NA	NA	NA
WP_011409721.1|4712608_4713676_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_011409722.1|4713851_4716047_+	alpha-glucuronidase	NA	NA	NA	NA	NA
WP_011409723.1|4716043_4718008_+	9-O-acetylesterase	NA	NA	NA	NA	NA
WP_011409724.1|4718019_4719279_+	D-galactonate dehydratase family protein	NA	Q6A202	Oenococcus_phage	26.0	3.5e-40
WP_011260707.1|4719278_4720979_+	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_080493943.1|4720981_4723696_+	glycoside hydrolase family 3 protein	NA	NA	NA	NA	NA
WP_011260709.1|4723918_4725391_+	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	32.1	4.5e-47
WP_069970164.1|4726368_4727424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069970165.1|4727651_4729070_-	glucuronate isomerase	NA	NA	NA	NA	NA
WP_069960283.1|4729110_4730088_-	endo-1,4-beta-xylanase	NA	NA	NA	NA	NA
WP_113014009.1|4731504_4732986_-	MFS transporter	NA	NA	NA	NA	NA
WP_155296492.1|4733327_4736201_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011409728.1|4736299_4737787_+	MFS transporter	NA	NA	NA	NA	NA
WP_011260718.1|4737818_4738853_+	family 43 glycosylhydrolase	NA	NA	NA	NA	NA
WP_094187716.1|4739269_4740067_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_082324403.1|4740943_4741081_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109182039.1|4741373_4742330_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_094187715.1|4743057_4743820_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075242372.1|4743837_4744938_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_011260725.1|4745003_4746125_-	acyl-CoA desaturase	NA	NA	NA	NA	NA
WP_011260726.1|4746134_4747229_-	ferredoxin reductase	NA	NA	NA	NA	NA
WP_011260727.1|4747303_4747984_+	HTH-type transcriptional repressor FabR	NA	NA	NA	NA	NA
WP_109182041.1|4748016_4748815_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011409735.1|4748943_4750263_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_069970189.1|4750365_4751322_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.6	4.0e-41
WP_011260733.1|4752788_4753247_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011409738.1|4753348_4753777_+	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
WP_069960048.1|4754023_4754887_-	DUF2884 family protein	NA	NA	NA	NA	NA
WP_042465346.1|4758063_4758330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260739.1|4758491_4758740_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011409743.1|4758948_4759707_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042465805.1|4759703_4760399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409745.1|4760497_4760830_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409747.1|4761301_4761736_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_069960049.1|4761851_4762097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260743.1|4762432_4762765_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260744.1|4763013_4763112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027703652.1|4763214_4764609_-	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_011260746.1|4765537_4765828_-	HigA family addiction module antidote protein	NA	M9MUN2	Rhodococcus_phage	53.8	1.5e-15
WP_012443754.1|4765845_4766127_-	plasmid maintenance system killer protein	NA	A0A222YWE2	Escherichia_phage	40.7	3.1e-10
WP_069960050.1|4766221_4768474_-	exodeoxyribonuclease V subunit alpha	NA	A0A0K2FLP8	Brevibacillus_phage	21.9	1.8e-10
WP_044756262.1|4768661_4772735_-	exodeoxyribonuclease V subunit beta	NA	S5MMD7	Bacillus_phage	22.5	4.1e-10
WP_044756261.1|4772731_4776145_-	exodeoxyribonuclease V subunit gamma	NA	NA	NA	NA	NA
WP_113175344.1|4776261_4776483_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082323416.1|4782561_4782804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409756.1|4783089_4783635_+|tail	phage tail protein	tail	A0A0U4JXW2	Arthrobacter_phage	32.9	1.9e-11
WP_011260754.1|4783703_4784231_+|tail	phage tail protein	tail	A0A218M5J0	Arthrobacter_phage	33.1	1.2e-15
