The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP017353	Pseudomonas aeruginosa strain FA-HZ1, complete genome	6866790	915579	999833	6866790	portal,integrase,capsid,head,terminase,holin,tRNA,tail,plate,protease	Pseudomonas_virus(72.09%)	93	961330:961345	1002225:1002240
WP_003085573.1|915579_916548_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_003101974.1|916638_917385_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_003101972.1|917377_918079_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_003085566.1|918139_919057_-	GTPase Era	NA	NA	NA	NA	NA
WP_003085565.1|919049_919739_-	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	31.4	7.2e-24
WP_023086589.1|919735_920113_-	DUF4845 domain-containing protein	NA	NA	NA	NA	NA
WP_003101969.1|920281_921136_-	signal peptidase I	NA	NA	NA	NA	NA
WP_023102293.1|921141_922941_-	elongation factor 4	NA	A0A2K9L2P9	Tupanvirus	38.5	3.3e-20
WP_003101964.1|923090_924515_-|protease	DegQ family serine endoprotease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	32.0	3.4e-28
WP_003110245.1|924554_925010_-	positive regulator for alginate biosynthesis MucC	NA	NA	NA	NA	NA
WP_003101960.1|925006_925957_-	sigma factor AlgU regulatory protein MucB	NA	NA	NA	NA	NA
WP_003101958.1|925965_926550_-	sigma-E factor negative regulatory protein	NA	NA	NA	NA	NA
WP_003085543.1|926581_927163_-	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_003114182.1|927571_929188_+	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_003114181.1|929156_929609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003085532.1|929592_929847_-	succinate dehydrogenase assembly factor 2	NA	NA	NA	NA	NA
WP_003101947.1|930119_931064_+	folate-binding protein YgfZ	NA	NA	NA	NA	NA
WP_003085528.1|931164_932001_+	HDOD domain-containing protein	NA	A0A1C3NFB0	Phage_NCTB	36.6	2.5e-26
WP_010793854.1|932009_933392_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_003085524.1|933384_934056_-	response regulator	NA	NA	NA	NA	NA
WP_003116508.1|934266_935550_+	OprD family porin	NA	NA	NA	NA	NA
WP_003085519.1|935579_936563_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_023114050.1|936611_937082_+	tripartite tricarboxylate transporter TctB family protein	NA	NA	NA	NA	NA
WP_003120784.1|937092_938610_+	tripartite tricarboxylate transporter permease	NA	NA	NA	NA	NA
WP_003114172.1|938602_939640_+	AbrB family transcriptional regulator	NA	NA	NA	NA	NA
WP_003106436.1|939766_940462_-	uracil-DNA glycosylase	NA	A0A0A7D9F8	Equid_alphaherpesvirus	45.2	1.0e-49
WP_003106439.1|940561_941383_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003106441.1|941439_942321_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_023114048.1|942453_943962_+	CoA-acylating methylmalonate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_023114047.1|943973_945137_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_019372102.1|946078_947182_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_023114046.1|947293_948190_+	3-hydroxyisobutyrate dehydrogenase	NA	NA	NA	NA	NA
WP_003085490.1|948246_948891_+	two pore domain potassium channel family protein	NA	NA	NA	NA	NA
WP_003110820.1|949006_949648_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_023112778.1|949682_951659_-	alkyl/aryl-sulfatase	NA	M1I0S7	Paramecium_bursaria_Chlorella_virus	44.9	8.1e-161
WP_003116515.1|951761_952676_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003098351.1|952679_952868_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003085479.1|952990_953236_-	DUF1145 domain-containing protein	NA	NA	NA	NA	NA
WP_003114164.1|953352_953808_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003098355.1|953903_954083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003114162.1|954315_955392_+	DUF2157 domain-containing protein	NA	NA	NA	NA	NA
WP_003098357.1|955388_956204_+	DUF4824 family protein	NA	NA	NA	NA	NA
WP_003120794.1|956224_956497_+	cysteine-rich CWC family protein	NA	NA	NA	NA	NA
WP_003114159.1|956496_957189_+	16S rRNA pseudouridine(516) synthase	NA	NA	NA	NA	NA
WP_003098363.1|957324_958368_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_003114158.1|958447_959185_+	murein L,D-transpeptidase catalytic domain family protein	NA	NA	NA	NA	NA
WP_016263849.1|959636_960539_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
961330:961345	attL	TGGCGGCGCTGTGCAG	NA	NA	NA	NA
WP_023114045.1|961551_962607_-|portal	phage portal protein	portal	Q9ZXM6	Pseudomonas_virus	97.1	1.7e-197
WP_031275675.1|962603_964367_-|terminase	terminase ATPase subunit family protein	terminase	Q9ZXM5	Pseudomonas_virus	100.0	0.0e+00
WP_023089196.1|964522_965344_+|capsid	GPO family capsid scaffolding protein	capsid	Q9ZXM4	Pseudomonas_virus	99.6	3.4e-129
WP_023091259.1|965379_966396_+|capsid	phage major capsid protein, P2 family	capsid	Q9ZXM3	Pseudomonas_virus	99.4	1.7e-191
WP_023114941.1|966401_967103_+|terminase	terminase endonuclease subunit	terminase	Q9ZXM2	Pseudomonas_virus	98.7	1.1e-123
WP_023083460.1|967206_967668_+|head	head completion/stabilization protein	head	Q9ZXM1	Pseudomonas_virus	98.0	3.1e-79
WP_003098378.1|967667_967880_+|tail	tail protein X	tail	Q9ZXL9	Pseudomonas_virus	94.1	4.9e-32
WP_003098379.1|967904_968258_+	hypothetical protein	NA	Q9ZXL8	Pseudomonas_virus	100.0	6.0e-59
WP_003098380.1|968259_968532_+|holin	phage holin family protein	holin	Q9ZXL7	Pseudomonas_virus	97.8	2.6e-38
WP_023115051.1|968528_969335_+	DUF3380 domain-containing protein	NA	Q9ZXL6	Pseudomonas_virus	96.2	1.0e-141
WP_016852029.1|969331_969574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016852030.1|969570_970032_+	peptidase	NA	Q9ZXL5	Pseudomonas_virus	87.6	5.3e-63
WP_016852031.1|970109_970646_+|tail	phage tail protein	tail	Q9ZXL3	Pseudomonas_virus	98.9	7.9e-95
WP_016852032.1|970638_971097_+	phage virion morphogenesis protein	NA	Q9ZXL2	Pseudomonas_virus	89.5	7.0e-68
WP_016852033.1|971166_971739_+|plate	phage baseplate assembly protein V	plate	Q9ZXL0	Pseudomonas_virus	98.9	3.6e-93
WP_016852034.1|971735_972080_+|plate	phage baseplate protein	plate	Q9ZXK9	Pseudomonas_virus	97.4	7.9e-56
WP_023115050.1|972076_972991_+|plate	baseplate assembly protein	plate	Q9ZXK8	Pseudomonas_virus	94.1	4.4e-154
WP_015967199.1|972990_973527_+|tail	phage tail protein I	tail	Q9ZXK7	Pseudomonas_virus	100.0	1.4e-99
WP_023115049.1|973528_975919_+	hypothetical protein	NA	Q9ZXK6	Pseudomonas_virus	89.2	0.0e+00
WP_023115048.1|975970_976432_+	hypothetical protein	NA	Q9ZXK5	Pseudomonas_virus	53.9	8.5e-37
WP_023115047.1|976522_977698_+|tail	phage tail sheath protein	tail	Q9ZXK4	Pseudomonas_virus	98.5	2.3e-219
WP_057427955.1|977754_978270_+|tail	phage major tail tube protein	tail	Q9ZXK3	Pseudomonas_virus	94.2	7.4e-90
WP_016852041.1|978324_978654_+|tail	phage tail assembly protein	tail	Q9ZXK2	Pseudomonas_virus	95.4	1.5e-48
WP_023115045.1|978770_981530_+|tail	phage tail tape measure protein	tail	Q9ZXK0	Pseudomonas_virus	92.3	0.0e+00
WP_003098399.1|981535_981976_+|tail	phage tail protein	tail	Q9ZXJ9	Pseudomonas_virus	99.3	1.8e-76
WP_023115044.1|981972_983256_+	phage late control D family protein	NA	Q9ZXJ8	Pseudomonas_virus	97.4	1.4e-235
WP_023114951.1|983316_984120_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1S5PRR3	Streptococcus_phage	37.3	1.5e-44
WP_023114952.1|984116_985313_-	DGQHR domain-containing protein	NA	NA	NA	NA	NA
WP_124119585.1|985309_985807_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031637493.1|986014_986485_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_020750421.1|986511_986742_+	phage-associated protein, BcepMu gp16 family	NA	NA	NA	NA	NA
WP_031637512.1|986771_987245_+	hypothetical protein	NA	Q9ZXJ2	Pseudomonas_virus	69.5	3.3e-52
WP_023114954.1|987252_987471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023089222.1|987469_987661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003098408.1|987663_987957_+	ogr/Delta-like zinc finger family protein	NA	Q9ZXJ1	Pseudomonas_virus	99.0	1.1e-50
WP_003098409.1|987953_988304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023115041.1|988375_988609_+	hypothetical protein	NA	Q9ZXI9	Pseudomonas_virus	98.7	2.9e-38
WP_079860037.1|988605_991326_+	bifunctional DNA primase/helicase	NA	Q9ZXI8	Pseudomonas_virus	98.9	0.0e+00
WP_023114956.1|991370_991724_+	hypothetical protein	NA	Q9ZXI7	Pseudomonas_virus	97.4	2.4e-60
WP_003098417.1|991735_991942_+	TraR/DksA family transcriptional regulator	NA	Q9ZXI6	Pseudomonas_virus	100.0	7.3e-33
WP_023115039.1|992245_994156_+	hypothetical protein	NA	A0A0U1T6D1	Pseudomonas_phage	94.3	6.6e-285
WP_023115038.1|994152_995385_+	phosphoadenosine phosphosulfate reductase family protein	NA	R9TRT5	Rhizobium_phage	72.1	7.2e-176
WP_016852059.1|995568_995937_+	ASCH domain-containing protein	NA	A0A291AUQ6	Sinorhizobium_phage	50.4	2.7e-30
WP_003098423.1|996129_996333_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_023115037.1|996339_997542_-|integrase	integrase family protein	integrase	A0A248SL35	Klebsiella_phage	30.9	2.2e-36
WP_018076254.1|997979_999833_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0U1UNT3	Pseudomonas_phage	51.0	1.1e-103
1002225:1002240	attR	TGGCGGCGCTGTGCAG	NA	NA	NA	NA
>prophage 2
NZ_CP017353	Pseudomonas aeruginosa strain FA-HZ1, complete genome	6866790	2146225	2236038	6866790	portal,integrase,capsid,head,terminase,holin,tRNA,tail,plate,protease,transposase	Pseudomonas_virus(75.0%)	96	2196397:2196412	2241936:2241951
WP_003104666.1|2146225_2146687_+|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
WP_003096050.1|2146745_2147237_-	protein-export chaperone SecB	NA	NA	NA	NA	NA
WP_023114929.1|2147273_2147528_-	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	43.4	4.7e-13
WP_003096058.1|2147529_2147949_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_003114478.1|2148273_2149821_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_014603391.1|2150134_2150953_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_031637483.1|2151102_2152389_+	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	39.8	2.9e-10
WP_003123646.1|2152417_2153728_+	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	29.0	5.0e-26
WP_003096069.1|2153727_2154501_+	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_010793678.1|2154569_2156051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003106330.1|2156991_2157744_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003106334.1|2158751_2159522_-	imidazole glycerol phosphate synthase subunit HisF	NA	NA	NA	NA	NA
WP_003106336.1|2159532_2160270_-	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino]imidazole-4- carboxamide isomerase	NA	NA	NA	NA	NA
WP_003112624.1|2160318_2160579_-	DUF2164 domain-containing protein	NA	NA	NA	NA	NA
WP_003096087.1|2160582_2161221_-	imidazole glycerol phosphate synthase subunit HisH	NA	NA	NA	NA	NA
WP_003096088.1|2161220_2161814_-	imidazoleglycerol-phosphate dehydratase HisB	NA	NA	NA	NA	NA
WP_003112623.1|2161974_2162373_+	acetyl-CoA sensor PanZ family protein	NA	NA	NA	NA	NA
WP_003112622.1|2162409_2162646_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003112621.1|2162642_2163749_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003105535.1|2163842_2166095_+	AsmA family protein	NA	NA	NA	NA	NA
WP_004352428.1|2166091_2167159_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_003096100.1|2167202_2167475_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_003112619.1|2167502_2168585_+	oxidoreductase	NA	NA	NA	NA	NA
WP_124033777.1|2168800_2169985_+|integrase	site-specific integrase	integrase	W6MYA3	Pseudomonas_phage	38.4	5.5e-48
WP_154070651.1|2170296_2172375_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023114933.1|2172726_2173119_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023114934.1|2173261_2173924_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023114935.1|2173942_2175145_+	ImmA/IrrE family metallo-endopeptidase	NA	B6SBZ6	Clostridium_virus	30.1	1.5e-40
WP_023114936.1|2175696_2176743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_124033778.1|2177010_2177346_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023114937.1|2177346_2179602_-	DotA/TraY family protein	NA	NA	NA	NA	NA
WP_124033779.1|2179598_2179913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_124033780.1|2179900_2180149_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_124074571.1|2180774_2180996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031637489.1|2181051_2181504_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086009326.1|2182052_2183190_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	38.7	7.7e-47
WP_094868201.1|2183217_2184723_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_003096148.1|2185071_2185809_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_023114939.1|2185967_2186657_+	DUF502 domain-containing protein	NA	NA	NA	NA	NA
WP_003096153.1|2186905_2187679_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.1	9.3e-20
WP_003096156.1|2187693_2188446_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016562461.1|2188507_2189203_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003096163.1|2189199_2189892_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003110596.1|2191578_2192049_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003112617.1|2192052_2193531_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_003105511.1|2193545_2194730_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_003096173.1|2194740_2196270_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
2196397:2196412	attL	TTCGACTCCTGGTGCC	NA	NA	NA	NA
WP_071534457.1|2197332_2197860_+	SocA family protein	NA	NA	NA	NA	NA
WP_124033784.1|2198290_2198710_+	hypothetical protein	NA	L7TJK7	Pseudomonas_virus	38.8	2.2e-23
WP_023114940.1|2198706_2199762_-|portal	phage portal protein	portal	Q9ZXM6	Pseudomonas_virus	96.5	6.0e-195
WP_031643136.1|2199761_2201522_-|terminase	terminase ATPase subunit family protein	terminase	Q9ZXM5	Pseudomonas_virus	99.8	0.0e+00
WP_023121181.1|2201677_2202499_+|capsid	GPO family capsid scaffolding protein	capsid	Q9ZXM4	Pseudomonas_virus	98.9	2.2e-128
WP_016852024.1|2202534_2203551_+|capsid	phage major capsid protein, P2 family	capsid	Q9ZXM3	Pseudomonas_virus	99.1	6.6e-191
WP_023083461.1|2203556_2204258_+|terminase	terminase endonuclease subunit	terminase	Q9ZXM2	Pseudomonas_virus	98.7	6.2e-124
WP_023116818.1|2204361_2204823_+|head	head completion/stabilization protein	head	Q9ZXM1	Pseudomonas_virus	97.4	6.8e-79
WP_003098378.1|2204822_2205035_+|tail	tail protein X	tail	Q9ZXL9	Pseudomonas_virus	94.1	4.9e-32
WP_003098379.1|2205059_2205413_+	hypothetical protein	NA	Q9ZXL8	Pseudomonas_virus	100.0	6.0e-59
WP_003098380.1|2205414_2205687_+|holin	phage holin family protein	holin	Q9ZXL7	Pseudomonas_virus	97.8	2.6e-38
WP_023114944.1|2205683_2206490_+	DUF3380 domain-containing protein	NA	Q9ZXL6	Pseudomonas_virus	96.9	9.0e-143
WP_016852029.1|2206486_2206729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016852030.1|2206725_2207187_+	peptidase	NA	Q9ZXL5	Pseudomonas_virus	87.6	5.3e-63
WP_016852031.1|2207264_2207801_+|tail	phage tail protein	tail	Q9ZXL3	Pseudomonas_virus	98.9	7.9e-95
WP_023089204.1|2207793_2208252_+	phage virion morphogenesis protein	NA	Q9ZXL2	Pseudomonas_virus	91.3	9.8e-70
WP_023089205.1|2208261_2208690_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_023089206.1|2208867_2209440_+|plate	phage baseplate assembly protein V	plate	Q9ZXL0	Pseudomonas_virus	96.8	9.7e-91
WP_023089207.1|2209436_2209781_+	hypothetical protein	NA	Q9ZXK9	Pseudomonas_virus	97.4	4.6e-56
WP_023114945.1|2209777_2210692_+|plate	baseplate assembly protein	plate	Q9ZXK8	Pseudomonas_virus	96.7	7.0e-160
WP_023091255.1|2210691_2211228_+|tail	phage tail protein I	tail	Q9ZXK7	Pseudomonas_virus	99.4	3.1e-99
WP_023089210.1|2211229_2213587_+|tail	phage tail fiber protein	tail	Q9ZXK6	Pseudomonas_virus	87.5	0.0e+00
WP_023114946.1|2213583_2214048_+	hypothetical protein	NA	Q9ZXK5	Pseudomonas_virus	60.7	2.3e-42
WP_023114947.1|2214138_2215314_+|tail	phage tail sheath protein	tail	Q9ZXK4	Pseudomonas_virus	98.5	2.3e-219
WP_023114948.1|2215370_2215886_+|tail	phage major tail tube protein	tail	Q9ZXK3	Pseudomonas_virus	94.2	2.1e-89
WP_023083449.1|2215940_2216270_+|tail	phage tail assembly protein	tail	Q9ZXK2	Pseudomonas_virus	96.3	5.3e-49
WP_003098394.1|2216278_2216398_+|tail	GpE family phage tail protein	tail	Q9ZXK1	Pseudomonas_virus	100.0	1.8e-15
WP_023114949.1|2216387_2219135_+|tail	phage tail tape measure protein	tail	Q9ZXK0	Pseudomonas_virus	94.1	0.0e+00
WP_003098399.1|2219140_2219581_+|tail	phage tail protein	tail	Q9ZXJ9	Pseudomonas_virus	99.3	1.8e-76
WP_069985552.1|2219577_2220846_+	phage late control D family protein	NA	Q9ZXJ8	Pseudomonas_virus	96.4	3.1e-230
WP_086009326.1|2220911_2222049_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	38.7	7.7e-47
WP_071534455.1|2222325_2222865_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_031633861.1|2222987_2223521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023096284.1|2223573_2223924_-	hypothetical protein	NA	Q9ZXJ5	Pseudomonas_virus	89.6	2.9e-53
WP_121334483.1|2224241_2224604_-	helix-turn-helix transcriptional regulator	NA	E5E3P4	Burkholderia_phage	42.1	2.1e-06
WP_031643139.1|2224682_2224895_+	hypothetical protein	NA	A0A2H4JE67	uncultured_Caudovirales_phage	46.8	1.9e-07
WP_031293865.1|2224924_2225395_+	hypothetical protein	NA	Q9ZXJ2	Pseudomonas_virus	93.6	2.5e-76
WP_003098408.1|2225391_2225685_+	ogr/Delta-like zinc finger family protein	NA	Q9ZXJ1	Pseudomonas_virus	99.0	1.1e-50
WP_023096288.1|2225681_2226032_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003098410.1|2226102_2226336_+	hypothetical protein	NA	Q9ZXI9	Pseudomonas_virus	100.0	7.8e-39
WP_023121183.1|2226332_2229053_+	hypothetical protein	NA	Q9ZXI8	Pseudomonas_virus	96.6	0.0e+00
WP_023114956.1|2229097_2229451_+	hypothetical protein	NA	Q9ZXI7	Pseudomonas_virus	97.4	2.4e-60
WP_003098417.1|2229462_2229669_+	TraR/DksA family transcriptional regulator	NA	Q9ZXI6	Pseudomonas_virus	100.0	7.3e-33
WP_023114957.1|2229972_2231658_+	hypothetical protein	NA	L7TH64	Pseudomonas_virus	90.8	4.8e-287
WP_023114958.1|2231668_2231857_+	hypothetical protein	NA	Q38017	Pseudomonas_virus	76.5	7.0e-06
WP_023114959.1|2231853_2232066_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_023114960.1|2232062_2233211_+	hypothetical protein	NA	V9IQN0	Stenotrophomonas_phage	40.5	1.8e-72
WP_023114962.1|2233677_2234184_+	type II toxin-antitoxin system death-on-curing family toxin	NA	NA	NA	NA	NA
WP_023114963.1|2234718_2236038_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	34.2	1.2e-64
2241936:2241951	attR	TTCGACTCCTGGTGCC	NA	NA	NA	NA
>prophage 3
NZ_CP017353	Pseudomonas aeruginosa strain FA-HZ1, complete genome	6866790	3336036	3393555	6866790	tail,tRNA,holin	Pseudomonas_phage(55.56%)	56	NA	NA
WP_009875776.1|3336036_3337062_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.1	8.3e-109
WP_003099587.1|3337792_3338146_+	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_003142783.1|3338136_3338679_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_022580735.1|3338651_3339884_-	multifunctional CCA addition/repair protein	NA	A0A076G5T8	Escherichia_phage	43.1	1.6e-77
WP_003085071.1|3339927_3340434_-	DUF4136 domain-containing protein	NA	NA	NA	NA	NA
WP_003099581.1|3340528_3342082_-	SpoVR family protein	NA	NA	NA	NA	NA
WP_003099579.1|3342078_3343350_-	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	37.2	4.2e-09
WP_003085078.1|3343450_3345373_-	PrkA family serine protein kinase	NA	NA	NA	NA	NA
WP_003099577.1|3345651_3345984_-	thiosulfate sulfurtransferase GlpE	NA	NA	NA	NA	NA
WP_003113213.1|3346027_3346879_-	symmetrical bis(5'-nucleosyl)-tetraphosphatase	NA	A0A2H4J0P0	uncultured_Caudovirales_phage	33.3	1.1e-08
WP_003085085.1|3346878_3347259_-	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
WP_023114717.1|3347295_3348102_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_023114716.1|3348217_3349204_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_003129198.1|3349200_3350493_-	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_004352244.1|3350473_3353257_-	LPS-assembly protein LptD	NA	NA	NA	NA	NA
WP_003109031.1|3353389_3355102_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	82.1	8.0e-282
WP_003158465.1|3356459_3357389_+	phosphotransferase	NA	NA	NA	NA	NA
WP_003099549.1|3357385_3358060_+	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_004352246.1|3358061_3358820_+	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_004352248.1|3358820_3359882_-	DUF3530 family protein	NA	NA	NA	NA	NA
WP_003459408.1|3360033_3362427_+	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_003085103.1|3362472_3363105_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_023114715.1|3363233_3364268_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_003085109.1|3364501_3365611_+	polyamine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.4	7.8e-28
WP_003099539.1|3365666_3366713_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003113206.1|3366827_3368075_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003099535.1|3368180_3369011_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003085122.1|3369134_3369809_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_003113204.1|3370698_3372177_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_003113203.1|3372495_3372810_-	transcription regulatory protein PrtN	NA	NA	NA	NA	NA
WP_003113202.1|3372909_3373680_-	helix-turn-helix transcriptional regulator	NA	A0A1B0Z078	Pseudomonas_phage	59.1	1.4e-71
WP_003085132.1|3374137_3374338_+	repressor PtrB	NA	W6ATC1	Enterobacter_phage	58.3	3.7e-05
WP_003113201.1|3374385_3374745_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003117965.1|3375201_3375549_+|holin	holin	holin	B5TK61	Pseudomonas_phage	51.8	3.9e-26
WP_003118917.1|3375564_3376194_+	glycoside hydrolase family 19 protein	NA	A0A125RNP1	Pseudomonas_phage	78.0	7.1e-87
WP_003142810.1|3376190_3376553_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003118919.1|3376549_3376807_+	hypothetical protein	NA	A0A125RNP3	Pseudomonas_phage	64.6	8.3e-18
WP_003113190.1|3377122_3377617_+	hypothetical protein	NA	A0A286S1Q8	Klebsiella_phage	56.5	1.4e-45
WP_004352265.1|3377628_3377976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003113188.1|3378005_3378260_+	hypothetical protein	NA	A0A2H4PI34	Pseudomonas_phage	38.4	6.3e-10
WP_023114714.1|3378306_3380145_+|tail	phage tail tape measure protein	tail	A0A0S2SYD9	Pseudomonas_phage	35.8	2.6e-28
WP_003113186.1|3380137_3380479_+|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	40.0	1.4e-17
WP_003118922.1|3380486_3381182_+|tail	phage minor tail protein L	tail	A0A1B0VNE0	Pseudomonas_phage	50.2	1.5e-69
WP_003129219.1|3381184_3381955_+	peptidase P60	NA	A0A2D1GNP8	Pseudomonas_phage	55.6	5.5e-81
WP_016252934.1|3382009_3382612_+|tail	tail assembly protein	tail	A0A1V0E8A0	Vibrio_phage	57.3	4.9e-53
WP_004352268.1|3382670_3386285_+|tail	phage tail protein	tail	A0A0S2SYC5	Pseudomonas_phage	55.3	0.0e+00
WP_004352269.1|3386520_3387309_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003115342.1|3387332_3388424_+	hypothetical protein	NA	A0A0S2SY45	Pseudomonas_phage	36.9	1.3e-46
WP_003113180.1|3388423_3388759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004352270.1|3388739_3388970_+	hypothetical protein	NA	A0A1W6JT87	Pseudomonas_phage	64.0	1.1e-18
WP_004352271.1|3389065_3390118_+	hypothetical protein	NA	A0A0H5AXZ9	Pseudomonas_phage	52.5	2.7e-62
WP_023114713.1|3390117_3390420_+	hypothetical protein	NA	A0A0H5B141	Pseudomonas_phage	70.0	6.3e-33
WP_003118930.1|3390416_3390647_+	hypothetical protein	NA	C8ZKF3	Pseudomonas_phage	71.6	1.4e-24
WP_003117978.1|3391065_3391671_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	66.3	2.1e-75
WP_003085203.1|3391672_3392722_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	57.8	1.8e-111
WP_003085205.1|3392718_3393555_+	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	56.9	2.1e-70
>prophage 4
NZ_CP017353	Pseudomonas aeruginosa strain FA-HZ1, complete genome	6866790	3574117	3617172	6866790	portal,integrase,lysis,holin,terminase,tRNA,protease	Pseudomonas_phage(89.47%)	64	3569815:3569831	3608654:3608670
3569815:3569831	attL	CGCTGCTGCAACTGGTC	NA	NA	NA	NA
WP_003129398.1|3574117_3575167_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JDJ8	uncultured_Caudovirales_phage	53.7	1.3e-101
WP_003158850.1|3575166_3575409_-	DUF4224 domain-containing protein	NA	A0A2H4JF29	uncultured_Caudovirales_phage	60.3	1.1e-16
WP_031637070.1|3575392_3575749_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023123491.1|3575753_3576443_-	hypothetical protein	NA	A0A0A0YUE3	Pseudomonas_phage	96.9	8.8e-123
WP_023093224.1|3576439_3576631_-	hypothetical protein	NA	A0A1W6JTB8	Pseudomonas_phage	100.0	5.4e-30
WP_049950182.1|3576743_3577271_-	hypothetical protein	NA	A0A0A0YRT2	Pseudomonas_phage	96.0	3.8e-49
WP_031637080.1|3578148_3578379_-	Arc family DNA-binding protein	NA	A0A1W6JTB4	Pseudomonas_phage	85.1	1.4e-27
WP_049250083.1|3578458_3579193_-	Rha family transcriptional regulator	NA	A0A1W6DWH5	Salmonella_phage	45.6	2.4e-17
WP_021205287.1|3579222_3579489_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021205288.1|3580008_3580242_-	hypothetical protein	NA	A0A0A0YQ28	Pseudomonas_phage	100.0	6.6e-38
WP_019396633.1|3580244_3580631_-	helix-turn-helix transcriptional regulator	NA	A0A1W6JTA9	Pseudomonas_phage	94.9	1.4e-53
WP_107236447.1|3580821_3580899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003085700.1|3580951_3581290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019396631.1|3581307_3581601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049950181.1|3582586_3582925_+	hypothetical protein	NA	A0A1W6JTD1	Pseudomonas_phage	50.0	6.5e-10
WP_023123496.1|3582921_3583422_+	hypothetical protein	NA	Q9XJS9	Pseudomonas_phage	53.6	1.6e-41
WP_031637084.1|3583574_3583925_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019396627.1|3583921_3584200_+	hypothetical protein	NA	A0A1W6JTC3	Pseudomonas_phage	97.8	4.9e-40
WP_019396626.1|3584196_3584505_+	hypothetical protein	NA	A0A0A0YWH5	Pseudomonas_phage	94.1	5.1e-46
WP_019396625.1|3584501_3584780_+	hypothetical protein	NA	A0A0A0YR77	Pseudomonas_phage	94.6	4.6e-38
WP_003123991.1|3584772_3585006_+	hypothetical protein	NA	A0A0A0YRU7	Pseudomonas_phage	97.4	3.7e-33
WP_003119036.1|3585131_3585494_+	hypothetical protein	NA	A0A0A0YUG0	Pseudomonas_phage	100.0	1.9e-63
WP_031637087.1|3585490_3586261_+	phage antirepressor protein	NA	A0A2H4J5H6	uncultured_Caudovirales_phage	45.2	4.9e-45
WP_010791987.1|3586257_3586488_+	hypothetical protein	NA	A0A1W6JTF8	Pseudomonas_phage	97.4	1.0e-38
WP_023094541.1|3586484_3586670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003123987.1|3587660_3588449_+	ATP-binding protein	NA	A0A0A0YRV1	Pseudomonas_phage	98.5	1.2e-144
WP_042176548.1|3588445_3589876_+	replicative DNA helicase	NA	A0A0A0YUG7	Pseudomonas_phage	96.2	1.8e-258
WP_031640233.1|3589935_3590244_+	hypothetical protein	NA	A0A0A0YQ44	Pseudomonas_phage	98.0	1.9e-48
WP_031640234.1|3590240_3590930_+	serine/threonine protein phosphatase	NA	A0A0A0YWI7	Pseudomonas_phage	98.3	1.8e-131
WP_010791980.1|3590926_3591205_+	hypothetical protein	NA	A0A1W6JTC1	Pseudomonas_phage	98.9	1.1e-44
WP_004353175.1|3591201_3591591_+	hypothetical protein	NA	A0A1W6JTD2	Pseudomonas_phage	99.2	2.2e-70
WP_021205299.1|3591958_3592657_+	Rha protein	NA	S5MQL6	Escherichia_phage	61.2	4.1e-27
WP_004353177.1|3592741_3593074_+|holin	phage holin, lambda family	holin	A0A1W6JTC7	Pseudomonas_phage	96.4	1.9e-54
WP_031637093.1|3593070_3593691_+	glycoside hydrolase family 19 protein	NA	A0A1W6JTC9	Pseudomonas_phage	91.7	2.3e-106
WP_031637094.1|3593687_3594158_+|lysis	lysis protein	lysis	A0A1B0Z001	Pseudomonas_phage	91.0	4.5e-70
WP_023086965.1|3594154_3594898_+	hypothetical protein	NA	A0A1B0Z000	Pseudomonas_phage	95.5	3.1e-129
WP_003159067.1|3595049_3595595_+	DNA packaging dimer small subunit	NA	A0A1B0Z033	Pseudomonas_phage	98.9	2.1e-95
WP_023086966.1|3595566_3597531_+|terminase	phage terminase large subunit family protein	terminase	A0A1B0Z2K0	Pseudomonas_phage	98.3	0.0e+00
WP_003159069.1|3597521_3597737_+	hypothetical protein	NA	A0A1W6JT66	Pseudomonas_phage	100.0	6.5e-32
WP_019486499.1|3597736_3599383_+|portal	phage portal protein	portal	A0A1W6JTB6	Pseudomonas_phage	99.8	0.0e+00
WP_154070655.1|3599482_3601435_+|protease	Clp protease ClpP	protease	A0A1W6JT88	Pseudomonas_phage	98.9	0.0e+00
WP_003129701.1|3601501_3601819_+	DUF2190 family protein	NA	A0A1W6JT93	Pseudomonas_phage	100.0	4.6e-50
WP_010791970.1|3601815_3602145_+	hypothetical protein	NA	A0A1W6JT71	Pseudomonas_phage	100.0	3.1e-57
WP_015980907.1|3602141_3602612_+	hypothetical protein	NA	A0A1W6JT75	Pseudomonas_phage	99.4	3.1e-87
WP_010791968.1|3602615_3602810_+	hypothetical protein	NA	A0A1W6JT79	Pseudomonas_phage	100.0	3.0e-28
WP_010791967.1|3602811_3603564_+	hypothetical protein	NA	A0A1W6JT83	Pseudomonas_phage	100.0	9.6e-139
WP_079860041.1|3603645_3604092_+	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	A0A1B0YZT9	Pseudomonas_phage	99.2	7.3e-62
WP_071535696.1|3604237_3604765_+	DUF4124 domain-containing protein	NA	A0A1B0Z2K9	Pseudomonas_phage	98.9	4.3e-93
WP_010791966.1|3604829_3605132_+	hypothetical protein	NA	A0A1B0YZV7	Pseudomonas_phage	99.0	7.0e-48
WP_023465052.1|3605234_3607718_+	tape measure protein	NA	A0A1B0YZV6	Pseudomonas_phage	98.2	0.0e+00
WP_016852557.1|3607757_3608279_+	hypothetical protein	NA	A0A1W6JT98	Pseudomonas_phage	98.3	3.7e-97
WP_031637099.1|3608278_3609976_+	hypothetical protein	NA	A0A1W6JTA3	Pseudomonas_phage	97.5	0.0e+00
3608654:3608670	attR	GACCAGTTGCAGCAGCG	NA	NA	NA	NA
WP_031637101.1|3609978_3610389_+	hypothetical protein	NA	A0A1W6JT78	Pseudomonas_phage	92.6	1.0e-54
WP_031637103.1|3610388_3610934_+	hypothetical protein	NA	A0A1B0YZV4	Pseudomonas_phage	97.2	7.8e-98
WP_033965873.1|3610944_3611349_+	hypothetical protein	NA	A0A0U4B0P9	Pseudomonas_phage	98.5	4.5e-66
WP_033943129.1|3611345_3613004_+	hypothetical protein	NA	A0A0A0YRR5	Pseudomonas_phage	95.4	0.0e+00
WP_031637107.1|3613033_3613621_+	hypothetical protein	NA	A0A1W6JT86	Pseudomonas_phage	93.3	3.4e-99
WP_019486485.1|3613613_3613805_+	hypothetical protein	NA	A0A1W6JT89	Pseudomonas_phage	100.0	2.0e-29
WP_031637108.1|3613807_3614368_+	hypothetical protein	NA	A0A0A0YWE7	Pseudomonas_phage	98.9	3.2e-99
WP_031637109.1|3614368_3614650_+	hypothetical protein	NA	A0A1W6JTD4	Pseudomonas_phage	96.8	1.5e-44
WP_071536897.1|3614642_3615206_+	hypothetical protein	NA	A0A0A0YRS1	Pseudomonas_phage	69.0	2.7e-61
WP_003451622.1|3615205_3615508_+	hypothetical protein	NA	A0A0S2SY61	Pseudomonas_phage	94.0	1.0e-46
WP_023464645.1|3615504_3615738_+	hypothetical protein	NA	A0A0A0YQ17	Pseudomonas_phage	96.0	9.8e-34
WP_003105684.1|3615933_3617172_+|tRNA	tyrosine--tRNA ligase	tRNA	A0A2C9CX69	Yersinia_phage	33.3	7.8e-53
>prophage 5
NZ_CP017353	Pseudomonas aeruginosa strain FA-HZ1, complete genome	6866790	4224209	4275580	6866790	portal,integrase,lysis,holin,terminase,tRNA,protease	Pseudomonas_phage(83.05%)	66	4232074:4232096	4272579:4272601
WP_023114621.1|4224209_4225277_+|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
WP_003092341.1|4225264_4226014_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	53.0	6.8e-68
WP_003098558.1|4226046_4226682_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	52.3	1.0e-40
WP_003115226.1|4226727_4227621_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A0S2SXL7	Bacillus_phage	34.3	3.0e-06
WP_003113871.1|4227725_4228730_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.3	7.0e-36
WP_003092272.1|4229156_4229480_-	ferredoxin family protein	NA	NA	NA	NA	NA
WP_079279453.1|4229546_4232126_-	DNA mismatch repair protein MutS	NA	A0A1V0SGG8	Hokovirus	22.1	3.2e-24
4232074:4232096	attL	TACTGCTGCATCATTGGCGTGTG	NA	NA	NA	NA
WP_023114620.1|4232185_4233160_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4J8E5	uncultured_Caudovirales_phage	57.3	1.9e-102
WP_071538228.1|4233169_4233379_-	DUF4224 domain-containing protein	NA	A0A1B0VMB6	Pseudomonas_phage	57.8	2.9e-13
WP_031637429.1|4233592_4233910_-	hypothetical protein	NA	A0A0U4JVQ0	Pseudomonas_phage	98.1	6.8e-54
WP_023114239.1|4233954_4234158_-	hypothetical protein	NA	A0A125RNQ4	Pseudomonas_phage	97.0	1.0e-31
WP_023114241.1|4234605_4234845_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012613684.1|4236102_4236351_-	hypothetical protein	NA	H2BD39	Pseudomonas_phage	92.7	1.2e-37
WP_023114616.1|4236433_4237114_-	hypothetical protein	NA	H2BDG4	Pseudomonas_virus	66.7	1.4e-80
WP_023114615.1|4237143_4237680_-	DUF4406 domain-containing protein	NA	A0A1B0YZW9	Pseudomonas_phage	96.6	5.0e-97
WP_023114614.1|4238136_4238439_-	hypothetical protein	NA	A0A0U4ISH7	Pseudomonas_phage	94.0	3.5e-39
WP_023517918.1|4238438_4238801_-	hypothetical protein	NA	A0A0U4KL54	Pseudomonas_phage	84.2	9.2e-47
WP_023114612.1|4239187_4239436_-	hypothetical protein	NA	A0A0U3TGX2	Pseudomonas_phage	84.1	8.3e-31
WP_023114611.1|4239446_4239830_-	helix-turn-helix transcriptional regulator	NA	A0A0U4IIG4	Pseudomonas_phage	95.3	1.1e-61
WP_124082060.1|4240170_4241112_-	hypothetical protein	NA	A0A1B0YZX8	Pseudomonas_phage	46.9	6.5e-60
WP_023114609.1|4241077_4241776_-	hypothetical protein	NA	A0A088FRV0	Escherichia_phage	48.4	1.0e-54
WP_023114608.1|4242024_4242318_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023114607.1|4242335_4242626_-	hypothetical protein	NA	A0A125RNS4	Pseudomonas_phage	92.0	7.9e-41
WP_023114606.1|4243168_4244263_-	hypothetical protein	NA	A0A1S5SAB0	Streptococcus_phage	42.7	3.2e-66
WP_023114605.1|4244358_4245078_-	helix-turn-helix transcriptional regulator	NA	A0A1W6JTC8	Pseudomonas_phage	55.7	4.9e-39
WP_031637426.1|4245173_4245386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023114604.1|4245539_4246244_+	hypothetical protein	NA	A0A1B0YZY9	Pseudomonas_phage	97.9	1.6e-124
WP_031637423.1|4246308_4247064_+	helix-turn-helix domain-containing protein	NA	A0A1B0YZZ0	Pseudomonas_phage	80.2	8.0e-77
WP_023114602.1|4247060_4247744_+	hypothetical protein	NA	A0A1B0YZY6	Pseudomonas_phage	97.8	3.0e-123
WP_023114601.1|4247740_4247947_+	hypothetical protein	NA	A0A1B0YZY8	Pseudomonas_phage	92.6	6.9e-31
WP_021205616.1|4247943_4248525_+	recombination protein NinG	NA	A0A0U4KL68	Pseudomonas_phage	95.3	6.6e-103
WP_023114600.1|4248521_4248818_+	hypothetical protein	NA	A0A1B0YZZ2	Pseudomonas_phage	83.7	1.2e-41
WP_014602588.1|4248819_4249194_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003129668.1|4249463_4249796_+|holin	phage holin, lambda family	holin	A0A1B0YZZ1	Pseudomonas_phage	100.0	5.1e-44
WP_023114599.1|4249792_4250410_+	glycoside hydrolase family 19 protein	NA	A0A1W6JTC9	Pseudomonas_phage	94.1	1.9e-108
WP_023875728.1|4250406_4250649_+	hypothetical protein	NA	A0A0H5AWC3	Pseudomonas_phage	51.9	3.2e-19
WP_031637422.1|4250645_4251116_+|lysis	lysis protein	lysis	A0A1B0Z001	Pseudomonas_phage	91.0	3.1e-71
WP_023114596.1|4251112_4251856_+	hypothetical protein	NA	A0A1B0Z000	Pseudomonas_phage	99.2	1.1e-134
WP_023114595.1|4251975_4252521_+	hypothetical protein	NA	A0A1W6JT69	Pseudomonas_phage	100.0	3.1e-94
WP_023114594.1|4252492_4254472_+|terminase	phage terminase large subunit family protein	terminase	A0A1W6JT68	Pseudomonas_phage	99.1	0.0e+00
WP_019486499.1|4254676_4256323_+|portal	phage portal protein	portal	A0A1W6JTB6	Pseudomonas_phage	99.8	0.0e+00
WP_113774872.1|4256282_4258376_+|protease	Clp protease ClpP	protease	A0A1W6JT88	Pseudomonas_phage	97.8	0.0e+00
WP_023110592.1|4258442_4258760_+	DUF2190 family protein	NA	A0A1B0YZT7	Pseudomonas_phage	100.0	1.6e-50
WP_023114592.1|4258756_4259086_+	hypothetical protein	NA	A0A1W6JT71	Pseudomonas_phage	97.2	1.5e-56
WP_023114591.1|4259082_4259553_+	hypothetical protein	NA	A0A1W6JT75	Pseudomonas_phage	98.7	9.1e-87
WP_023114590.1|4259556_4259751_+	hypothetical protein	NA	A0A1W6JT79	Pseudomonas_phage	96.9	5.7e-27
WP_015980909.1|4259752_4260505_+	hypothetical protein	NA	A0A1B0YZT8	Pseudomonas_phage	99.6	2.4e-137
WP_023114589.1|4260586_4261228_+	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	A0A1W6JT76	Pseudomonas_phage	93.9	6.8e-109
WP_019396608.1|4261289_4261592_+	hypothetical protein	NA	A0A1W6JT80	Pseudomonas_phage	100.0	4.1e-48
WP_023114588.1|4261694_4264178_+	tape measure protein	NA	A0A1B0YZV6	Pseudomonas_phage	98.5	0.0e+00
WP_023114587.1|4264217_4264739_+	hypothetical protein	NA	A0A1W6JT98	Pseudomonas_phage	99.4	4.4e-98
WP_023114586.1|4264738_4266448_+	hypothetical protein	NA	A0A1W6JTA3	Pseudomonas_phage	88.9	8.5e-300
WP_023114585.1|4266450_4266861_+	hypothetical protein	NA	A0A1W6JT78	Pseudomonas_phage	93.2	1.2e-53
WP_021205046.1|4266860_4267406_+	hypothetical protein	NA	A0A1B0YZV4	Pseudomonas_phage	92.3	1.2e-90
WP_021205047.1|4267416_4267821_+	hypothetical protein	NA	A0A0U4B0P9	Pseudomonas_phage	99.3	1.2e-66
WP_023114584.1|4267817_4269476_+	hypothetical protein	NA	A0A0U4IJ51	Pseudomonas_phage	98.5	0.0e+00
WP_023114583.1|4269505_4270093_+	hypothetical protein	NA	A0A0U4B0K9	Pseudomonas_phage	94.9	3.3e-102
WP_003159082.1|4270085_4270277_+	hypothetical protein	NA	A0A1B0Z2L3	Pseudomonas_phage	98.4	3.5e-29
WP_023114582.1|4270281_4270842_+	hypothetical protein	NA	A0A1B0YZW5	Pseudomonas_phage	98.4	5.5e-99
WP_023086976.1|4270841_4271123_+	hypothetical protein	NA	A0A1W6JTD4	Pseudomonas_phage	100.0	3.6e-46
WP_031637421.1|4271115_4271703_+	hypothetical protein	NA	X5I2N7	Pseudomonas_phage	77.0	2.0e-51
WP_023114581.1|4271702_4272017_+	hypothetical protein	NA	A0A0U4K5I1	Pseudomonas_phage	88.5	5.0e-49
WP_003098487.1|4272098_4272377_+	hypothetical protein	NA	A0A0U4JEI3	Pseudomonas_phage	100.0	1.1e-47
WP_003092265.1|4272744_4273752_-	TolB family protein	NA	NA	NA	NA	NA
4272579:4272601	attR	TACTGCTGCATCATTGGCGTGTG	NA	NA	NA	NA
WP_003092262.1|4273899_4274406_+	CinA family protein	NA	B5TK85	Pseudomonas_phage	76.0	8.1e-57
WP_003092260.1|4274539_4275580_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	59.5	1.5e-113
>prophage 6
NZ_CP017353	Pseudomonas aeruginosa strain FA-HZ1, complete genome	6866790	5502228	5509121	6866790	tRNA	uncultured_Caudovirales_phage(83.33%)	9	NA	NA
WP_003160440.1|5502228_5503509_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	45.4	4.8e-98
WP_003113366.1|5503510_5504908_+	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_023114465.1|5504912_5505887_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_003108776.1|5505974_5506958_-	glycosyl transferase family protein	NA	A0A2H4JBY5	uncultured_Caudovirales_phage	74.3	9.3e-142
WP_003090393.1|5506954_5507290_-	TusE/DsrC/DsvC family sulfur relay protein	NA	A0A2H4J8B6	uncultured_Caudovirales_phage	69.4	3.3e-38
WP_003090391.1|5507286_5507592_-	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_003090389.1|5507591_5507951_-	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	61.7	1.4e-34
WP_003090387.1|5507947_5508343_-	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	72.1	2.7e-47
WP_003090386.1|5508452_5509121_-	Bax inhibitor-1/YccA family protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	82.1	1.5e-90
>prophage 7
NZ_CP017353	Pseudomonas aeruginosa strain FA-HZ1, complete genome	6866790	6332098	6383519	6866790	integrase,head	Pseudomonas_phage(85.48%)	69	6343647:6343662	6382019:6382034
WP_003102455.1|6332098_6332365_-	hypothetical protein	NA	L7TP56	Pseudomonas_virus	98.9	1.8e-44
WP_069985580.1|6332400_6332664_-	hypothetical protein	NA	A0A125RNP3	Pseudomonas_phage	93.0	3.1e-36
WP_069985567.1|6332732_6333101_-	hypothetical protein	NA	H2BDA0	Pseudomonas_phage	84.4	6.1e-46
WP_023102118.1|6333097_6333580_-	glycoside hydrolase family 104 protein	NA	Q9MC90	Pseudomonas_phage	99.4	2.1e-86
WP_029528900.1|6333733_6334342_+	hypothetical protein	NA	Q9MC91	Pseudomonas_phage	96.5	5.2e-111
WP_033993395.1|6336961_6339685_-	hypothetical protein	NA	H2BD95	Pseudomonas_phage	83.4	0.0e+00
WP_023114285.1|6339656_6340064_-	hypothetical protein	NA	J7HX80	Pseudomonas_phage	98.5	2.2e-73
WP_033993394.1|6340068_6340560_-	DUF1833 family protein	NA	J7I404	Pseudomonas_phage	95.1	2.8e-86
WP_023114283.1|6340543_6341011_-	hypothetical protein	NA	H2BD92	Pseudomonas_phage	98.7	9.3e-92
WP_033993393.1|6341007_6343509_-	tape measure protein	NA	A0A127KNB7	Pseudomonas_phage	98.8	0.0e+00
WP_023098984.1|6343508_6344126_-	hypothetical protein	NA	A0A125RNN1	Pseudomonas_phage	100.0	3.0e-114
6343647:6343662	attL	GGCGCCGATCAGGCCG	NA	NA	NA	NA
WP_023114281.1|6344122_6345118_-	hypothetical protein	NA	J7HX84	Pseudomonas_phage	98.2	3.2e-166
WP_003127992.1|6345132_6345507_-	hypothetical protein	NA	J7I407	Pseudomonas_phage	100.0	5.7e-68
WP_033993392.1|6345503_6345908_-	hypothetical protein	NA	H2BD87	Pseudomonas_phage	99.3	3.6e-68
WP_033982952.1|6345909_6346230_-	hypothetical protein	NA	J7I4I8	Pseudomonas_phage	96.2	3.3e-56
WP_033993391.1|6346226_6346628_-	hypothetical protein	NA	J7HX89	Pseudomonas_phage	97.0	1.5e-69
WP_033993390.1|6346712_6347171_-	hypothetical protein	NA	A0A125RNM4	Pseudomonas_phage	68.4	7.6e-46
WP_033993389.1|6347181_6348273_-	hypothetical protein	NA	J7I0Q9	Pseudomonas_phage	89.8	1.6e-187
WP_023082510.1|6348288_6348738_-	hypothetical protein	NA	A0A125RNM2	Pseudomonas_phage	98.7	2.8e-77
WP_033993386.1|6348741_6350019_-	hypothetical protein	NA	H2BD80	Pseudomonas_phage	96.9	1.1e-211
WP_031637377.1|6350022_6350952_-|head	SPP1 gp7 family phage head morphogenesis protein	head	H2BD79	Pseudomonas_phage	98.4	1.3e-169
WP_014603761.1|6352280_6352478_-	hypothetical protein	NA	H2BD77	Pseudomonas_phage	100.0	2.3e-28
WP_023114272.1|6352477_6353941_-	hypothetical protein	NA	G0ZND4	Cronobacter_phage	84.0	5.3e-242
WP_023114271.1|6353930_6354410_-	DUF2280 domain-containing protein	NA	A0A125RNL6	Pseudomonas_phage	91.5	5.3e-66
WP_031285280.1|6354441_6355065_-	hypothetical protein	NA	A0A125RNL5	Pseudomonas_phage	99.0	1.2e-121
WP_023098997.1|6355061_6355334_-	hypothetical protein	NA	A0A125RNL4	Pseudomonas_phage	100.0	8.8e-42
WP_023434898.1|6355336_6355669_-	peptidase M48	NA	A0A125RNL3	Pseudomonas_phage	100.0	2.6e-56
WP_069985568.1|6356860_6357547_-	hypothetical protein	NA	A0A0S2SYA9	Pseudomonas_phage	97.4	4.8e-129
WP_033945916.1|6357617_6357935_-	hypothetical protein	NA	Q9MC45	Pseudomonas_phage	94.3	8.1e-47
WP_033993423.1|6357934_6358576_-	phage protein	NA	A0A0S2SY91	Pseudomonas_phage	95.7	1.9e-111
WP_023114268.1|6358569_6358887_-	hypothetical protein	NA	B5WZY6	Pseudomonas_phage	98.1	3.9e-57
WP_023114267.1|6358883_6359144_-	hypothetical protein	NA	A0A0S2SYB2	Pseudomonas_phage	44.8	1.3e-07
WP_003124795.1|6359140_6359728_-	DUF1367 family protein	NA	Q9MC49	Pseudomonas_phage	99.5	1.2e-109
WP_023114266.1|6359720_6359951_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033993424.1|6359943_6360219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023114265.1|6360211_6360463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023114264.1|6360462_6360666_-	hypothetical protein	NA	A0A0S2SYW7	Pseudomonas_phage	89.4	1.6e-27
WP_029528925.1|6360658_6360979_-	hypothetical protein	NA	A0A1P8DTU9	Salmonella_phage	65.0	1.3e-36
WP_031637374.1|6361091_6362465_-	AAA family ATPase	NA	A0A125RNK2	Pseudomonas_phage	99.8	2.4e-252
WP_023114260.1|6362488_6363283_-	phage replication protein O domain	NA	W6MYB0	Pseudomonas_phage	65.8	5.3e-47
WP_023114259.1|6363660_6363849_-	hypothetical protein	NA	B5WZX7	Pseudomonas_phage	58.1	3.6e-10
WP_023113651.1|6363862_6364042_-	hypothetical protein	NA	A0A0S2SYB8	Pseudomonas_phage	66.1	6.6e-14
WP_023114258.1|6364142_6364853_+	LexA family transcriptional regulator	NA	Q6J1N3	Burkholderia_virus	38.8	5.7e-32
WP_023114257.1|6365296_6366475_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_023110772.1|6366858_6367098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023114255.1|6367320_6367809_+	DUF1566 domain-containing protein	NA	H2BDH2	Pseudomonas_virus	82.1	2.1e-70
WP_079860042.1|6368005_6368518_+	DUF1566 domain-containing protein	NA	A0A0A0YR68	Pseudomonas_phage	45.2	2.7e-28
WP_023110774.1|6368527_6369022_+	hypothetical protein	NA	S5YLC4	Mycobacterium_phage	39.0	4.0e-24
WP_023110775.1|6369055_6369244_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023098762.1|6369457_6369682_+	hypothetical protein	NA	A0A0U4JX53	Pseudomonas_phage	100.0	3.7e-38
WP_069985570.1|6369678_6370044_+	hypothetical protein	NA	B5WZX0	Pseudomonas_phage	95.9	3.2e-63
WP_154070654.1|6370040_6370610_+	hypothetical protein	NA	Q9MC57	Pseudomonas_phage	47.3	6.4e-18
WP_033997386.1|6370606_6370900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023098765.1|6371006_6372038_+	DNA cytosine methyltransferase	NA	Q6J1P4	Burkholderia_virus	57.2	3.5e-107
WP_023114248.1|6372235_6373300_+	hypothetical protein	NA	A0A0S2SYC7	Pseudomonas_phage	97.7	4.6e-70
WP_023114247.1|6373307_6374054_+	phage recombination protein Bet	NA	A0A0S2SY88	Pseudomonas_phage	89.9	1.7e-127
WP_023114246.1|6374037_6374658_+	hypothetical protein	NA	A0A0S2SY31	Pseudomonas_phage	91.2	3.7e-104
WP_023114245.1|6374654_6374990_+	LytTR family transcriptional regulator	NA	H2BDF6	Pseudomonas_virus	83.8	1.9e-46
WP_016852532.1|6376927_6377209_+	DUF4031 domain-containing protein	NA	A0A125RNQ7	Pseudomonas_phage	100.0	3.6e-46
WP_033994106.1|6377201_6377408_+	hypothetical protein	NA	D4FUN0	Pseudomonas_phage	80.6	4.0e-23
WP_033994113.1|6377485_6377695_+	hypothetical protein	NA	A0A0A1IUI9	Pseudomonas_phage	89.8	2.8e-16
WP_014603741.1|6377691_6377895_+	hypothetical protein	NA	A0A125RNQ4	Pseudomonas_phage	97.0	8.0e-32
WP_123822976.1|6378487_6378691_+	hypothetical protein	NA	D4FUM8	Pseudomonas_phage	100.0	6.5e-34
WP_042853643.1|6379124_6379424_+	hypothetical protein	NA	A0A125RNP8	Pseudomonas_phage	52.6	1.3e-30
WP_079860043.1|6379501_6379759_+	hypothetical protein	NA	B5WZV2	Pseudomonas_phage	90.0	1.8e-28
WP_069985574.1|6379755_6379992_+	hypothetical protein	NA	Q9MC84	Pseudomonas_phage	81.6	5.1e-30
WP_069985575.1|6379988_6380402_+	DUF2591 family protein	NA	J7I4M3	Pseudomonas_phage	39.0	1.6e-15
WP_029528952.1|6380681_6381899_+|integrase	site-specific integrase	integrase	A0A125RNP5	Pseudomonas_phage	99.0	3.0e-230
WP_003111315.1|6381929_6383519_+	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.3	5.9e-61
6382019:6382034	attR	CGGCCTGATCGGCGCC	NA	NA	NA	NA
