The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP014529	Enterococcus faecium strain E745, complete genome	2765010	78985	120902	2765010	tRNA,transposase	Staphylococcus_phage(22.22%)	35	NA	NA
WP_002298563.1|78985_79732_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_002298562.1|80690_81497_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_002324277.1|81619_81988_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_010730439.1|82084_83257_+|transposase	IS256-like element IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	99.6	5.0e-134
WP_000997695.1|83675_84854_+|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_002317041.1|85085_85424_-	arsenic metallochaperone ArsD family protein	NA	NA	NA	NA	NA
WP_002301170.1|85420_85960_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010730438.1|86071_86731_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_002324522.1|86799_87708_+|transposase	IS982-like element ISEfm1 family transposase	transposase	NA	NA	NA	NA
WP_002298555.1|87830_90500_-	YfhO family protein	NA	NA	NA	NA	NA
WP_002290463.1|90737_90926_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_002294298.1|91195_91558_+	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_002298554.1|91609_93292_+	DAK2 domain-containing protein	NA	NA	NA	NA	NA
WP_002294296.1|93408_95445_+	ATP-dependent DNA helicase RecG	NA	A0A2H4JBQ0	uncultured_Caudovirales_phage	23.1	3.1e-06
WP_002289721.1|95493_96495_+	phosphate acyltransferase PlsX	NA	NA	NA	NA	NA
WP_002294295.1|96616_96859_+	acyl carrier protein	NA	NA	NA	NA	NA
WP_002297293.1|97237_98425_-|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	28.7	4.6e-26
WP_002287889.1|98746_99751_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.2	5.1e-18
WP_002297777.1|99751_100696_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.1	3.9e-20
WP_002287892.1|100695_101658_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002287893.1|101684_102599_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002297779.1|102624_104406_+	oligopeptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002287896.1|104753_105440_+	ribonuclease III	NA	K7YH73	Megavirus	32.3	9.1e-27
WP_002317044.1|105459_109041_+	chromosome segregation protein SMC	NA	NA	NA	NA	NA
WP_002317045.1|109049_109859_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_002317046.1|109870_110869_+	signal recognition particle-docking protein FtsY	NA	NA	NA	NA	NA
WP_002307330.1|111054_113322_+	bifunctional glutamate--cysteine ligase GshA/glutathione synthetase GshB	NA	NA	NA	NA	NA
WP_002287902.1|113409_113862_-	YueI family protein	NA	NA	NA	NA	NA
WP_002297787.1|114011_114962_+	iron chelate uptake ABC transporter family permease subunit	NA	A0A2H4IY97	uncultured_Caudovirales_phage	40.5	5.6e-67
WP_002317047.1|114954_115914_+	iron chelate uptake ABC transporter family permease subunit	NA	NA	NA	NA	NA
WP_002297790.1|115910_116666_+	ATP-binding cassette domain-containing protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.1	2.2e-13
WP_002317048.1|116688_117642_+	siderophore ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002333851.1|118307_119261_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_002325943.1|119339_119528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002317769.1|119729_120902_+|transposase	IS256-like element IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	100.0	3.5e-135
>prophage 2
NZ_CP014529	Enterococcus faecium strain E745, complete genome	2765010	201221	260126	2765010	tRNA,transposase,holin	uncultured_Mediterranean_phage(25.0%)	52	NA	NA
WP_002317082.1|201221_202397_-|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	Q6GZ03	Mycoplasma_phage	32.9	1.3e-17
WP_002296565.1|202589_203621_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_002294185.1|207046_207745_-	DUF975 family protein	NA	NA	NA	NA	NA
WP_002294183.1|207961_209107_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	40.9	2.5e-82
WP_002300794.1|209203_209584_+	preprotein translocase subunit YajC	NA	NA	NA	NA	NA
WP_000202380.1|209923_211243_-|transposase	IS1380-like element IS1678 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	82.7	4.8e-210
WP_002294180.1|211571_214169_+	bifunctional acetaldehyde-CoA/alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_002325869.1|214522_215476_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_002333852.1|215399_215588_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002317085.1|215740_217201_+	rhamnulokinase	NA	NA	NA	NA	NA
WP_002317086.1|217197_218454_+	L-rhamnose isomerase	NA	NA	NA	NA	NA
WP_002288248.1|218467_219313_+	rhamnulose-1-phosphate aldolase	NA	NA	NA	NA	NA
WP_002317087.1|219314_219626_+	L-rhamnose mutarotase	NA	NA	NA	NA	NA
WP_002317088.1|219707_220859_+	lactaldehyde reductase	NA	NA	NA	NA	NA
WP_002294170.1|220985_221744_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002288242.1|221843_222488_+	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_002298306.1|222494_223502_+	sugar kinase	NA	NA	NA	NA	NA
WP_002298305.1|223517_224360_+	5-dehydro-4-deoxy-D-glucuronate isomerase	NA	NA	NA	NA	NA
WP_002317093.1|225430_226495_-	type 2 isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_002288233.1|226491_227577_-	phosphomevalonate kinase	NA	NA	NA	NA	NA
WP_002317094.1|227589_228567_-	diphosphomevalonate decarboxylase	NA	NA	NA	NA	NA
WP_002288231.1|228559_229504_-	mevalonate kinase	NA	NA	NA	NA	NA
WP_002317095.1|229825_230479_+	deoxynucleoside kinase	NA	C1KFI3	Lactobacillus_virus	52.3	5.0e-59
WP_002294163.1|230563_231469_+	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_002294161.1|231470_232103_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_002293357.1|232422_232947_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.3	1.4e-14
WP_002289309.1|233018_233219_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_002289310.1|233271_233631_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_002317096.1|233882_235220_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002324306.1|235267_237397_+	hydantoinase/oxoprolinase	NA	NA	NA	NA	NA
WP_002317098.1|237371_238061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002289316.1|238371_239058_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002377012.1|239193_239388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002289317.1|239437_239878_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_002317100.1|239881_240727_-	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
WP_002294157.1|240875_242294_+	dipeptidase PepV	NA	NA	NA	NA	NA
WP_002324311.1|242350_242641_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002317103.1|243156_244113_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_002317104.1|244284_244638_-	peptidase	NA	NA	NA	NA	NA
WP_002317105.1|244836_245916_+	glutamyl aminopeptidase	NA	NA	NA	NA	NA
WP_002317106.1|246207_246528_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_002317107.1|246557_247025_+	universal stress protein	NA	NA	NA	NA	NA
WP_002317108.1|247334_247940_+	DUF4479 domain-containing protein	NA	NA	NA	NA	NA
WP_002324312.1|247997_249281_-	PDZ domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	29.3	6.7e-23
WP_002317110.1|249733_250213_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_113787899.1|250587_251750_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	50.9	4.6e-79
WP_002317111.1|251960_253091_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010778368.1|253258_254167_+|transposase	IS982-like element ISEfm1 family transposase	transposase	NA	NA	NA	NA
WP_002317112.1|254253_255108_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_002317113.1|255204_257454_+	alpha-galactosidase	NA	NA	NA	NA	NA
WP_002317114.1|257456_258629_+	MFS transporter	NA	NA	NA	NA	NA
WP_002317441.1|258806_260126_+|transposase	IS1380-like element IS1678 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	82.5	6.9e-209
>prophage 3
NZ_CP014529	Enterococcus faecium strain E745, complete genome	2765010	669345	677817	2765010		Streptococcus_phage(66.67%)	9	NA	NA
WP_002294039.1|669345_669990_+	dTMP kinase	NA	M1PSC7	Streptococcus_phage	52.6	4.2e-58
WP_002292340.1|670004_670334_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288071.1|670347_671286_+	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	34.4	3.3e-35
WP_002288073.1|671321_672146_+	stage 0 sporulation family protein	NA	NA	NA	NA	NA
WP_002288076.1|672138_672486_+	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	41.1	5.1e-18
WP_002288078.1|672554_673427_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	60.4	3.1e-88
WP_002294035.1|673535_674657_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_002288081.1|674710_675313_-	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A288TZV3	Enterococcus_phage	58.6	1.7e-53
WP_002288083.1|675627_677817_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A0C5KKX3	Enterococcus_phage	66.6	1.8e-286
>prophage 4
NZ_CP014529	Enterococcus faecium strain E745, complete genome	2765010	730827	791109	2765010	tRNA,protease,capsid,integrase,holin,tail,portal,terminase,head,transposase	Enterococcus_phage(29.41%)	76	746251:746267	796534:796550
WP_002286621.1|730827_733626_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2H4UVG0	Bodo_saltans_virus	26.4	1.6e-74
WP_002286618.1|733674_735201_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	35.3	8.9e-75
WP_002286616.1|735215_735863_-	metal-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_002286678.1|736046_736376_-	DUF4828 domain-containing protein	NA	NA	NA	NA	NA
WP_002286614.1|736552_737281_+	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_002317177.1|737296_738310_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_002286608.1|738309_739587_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	28.8	5.8e-35
WP_002286607.1|739649_742352_+	sigma-54-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_002286606.1|742503_742821_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002286604.1|742850_743171_+	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002286601.1|743278_744739_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002286598.1|744806_745028_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286596.1|745058_745241_+	DUF3188 domain-containing protein	NA	NA	NA	NA	NA
WP_002286592.1|745240_745654_+	DUF3284 domain-containing protein	NA	NA	NA	NA	NA
WP_002286589.1|745776_746958_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
746251:746267	attL	GAAGATGCAAAAGCTGC	NA	NA	NA	NA
WP_002286587.1|747488_748628_-|integrase	site-specific integrase	integrase	Q9AZR0	Lactococcus_phage	47.1	2.6e-95
WP_002296617.1|748926_749562_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296616.1|749674_750310_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002303013.1|750343_750805_-	DUF4429 domain-containing protein	NA	A0A0F6N4L7	Staphylococcus_phage	34.8	4.5e-06
WP_002296613.1|750934_751366_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_002296612.1|751383_751704_-	helix-turn-helix transcriptional regulator	NA	A0A1S5SDR1	Streptococcus_phage	40.2	2.0e-13
WP_002290310.1|752002_752779_+	phage antirepressor protein	NA	A0A1Q1PVU2	Staphylococcus_phage	53.8	1.1e-73
WP_002296611.1|752793_752997_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002286573.1|753012_753351_+	DUF771 domain-containing protein	NA	NA	NA	NA	NA
WP_002296610.1|753337_753517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286568.1|753559_754030_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002286562.1|754116_754815_+	phage regulatory protein	NA	D2IYT0	Enterococcus_phage	34.6	1.7e-25
WP_002286559.1|754992_755334_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286557.1|755326_755998_+	DUF1071 domain-containing protein	NA	A0A1B1P7F0	Bacillus_phage	47.4	4.2e-29
WP_069972674.1|756003_756690_+	hypothetical protein	NA	C9E2N1	Enterococcus_phage	68.6	2.0e-87
WP_002286552.1|756692_757442_+	helix-turn-helix domain-containing protein	NA	A0A1L2BY83	Clostridium_phage	54.0	1.7e-31
WP_002286696.1|757453_757723_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286695.1|757884_758187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296606.1|758183_758345_+	antitoxin	NA	NA	NA	NA	NA
WP_002286694.1|758341_758647_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286550.1|758646_759003_+	DUF1140 family protein	NA	A0A2H4JAZ4	uncultured_Caudovirales_phage	37.4	3.1e-10
WP_002296604.1|758962_759208_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286547.1|759204_759624_+	hypothetical protein	NA	D2IZL0	Enterococcus_phage	54.3	4.1e-30
WP_002286545.1|759620_760178_+	DUF1642 domain-containing protein	NA	A0A0C5KKV2	Enterococcus_phage	36.2	2.8e-10
WP_002286693.1|760174_760471_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286542.1|760547_760961_+	autolysin	NA	C9E2P5	Enterococcus_phage	81.0	1.5e-56
WP_002300143.1|761418_761694_-	hypothetical protein	NA	A0A2H4JEH2	uncultured_Caudovirales_phage	45.7	9.9e-17
WP_002311723.1|762147_762354_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296600.1|762549_762717_+	thymidylate synthase	NA	NA	NA	NA	NA
WP_002286540.1|762742_763087_+	HNH endonuclease	NA	A0A1B1P757	Bacillus_phage	57.1	3.8e-26
WP_002296599.1|763091_763373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286538.1|763475_763790_+|terminase	terminase	terminase	A0A1S7FYW6	Listeria_phage	37.9	3.3e-08
WP_002286533.1|763767_765462_+|terminase	terminase large subunit	terminase	A0A1B1P766	Bacillus_phage	49.6	3.0e-148
WP_002286530.1|765481_766660_+|portal	phage portal protein	portal	A0A1B1P754	Bacillus_phage	40.4	5.4e-80
WP_002286527.1|766622_767309_+|protease	Clp protease ClpP	protease	A0A2I6PDD0	Staphylococcus_phage	39.7	1.0e-30
WP_002286525.1|767308_768469_+|capsid	phage major capsid protein	capsid	A0A1B1P752	Bacillus_phage	50.1	1.8e-99
WP_002286524.1|768478_769354_+	hypothetical protein	NA	D2IYX3	Enterococcus_phage	74.2	5.6e-130
WP_002286523.1|769350_769662_+	hypothetical protein	NA	A0A1B1P751	Bacillus_phage	42.1	6.3e-12
WP_002286522.1|769651_770005_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_069972675.1|769994_770396_+	hypothetical protein	NA	A0A1B1P759	Bacillus_phage	33.3	1.1e-13
WP_050444277.1|770445_770793_+	hypothetical protein	NA	R4IBU7	Listeria_phage	30.6	1.3e-05
WP_002286512.1|770804_771413_+	hypothetical protein	NA	Q8W5Z9	Listeria_phage	41.1	3.0e-34
WP_002286510.1|771432_771795_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305377.1|771797_771980_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286502.1|771996_775428_+|tail	phage tail tape measure protein	tail	A0A1D3SNL5	Enterococcus_phage	44.4	3.1e-67
WP_002297218.1|775513_776809_-|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_069972676.1|777000_777738_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_002296595.1|777747_780039_+	hypothetical protein	NA	A0A1D3SNL1	Enterococcus_phage	30.0	1.6e-88
WP_002286495.1|780062_782189_+	hypothetical protein	NA	A0A060AI60	Enterococcus_phage	40.1	1.4e-62
WP_002286491.1|782351_782798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002290625.1|782799_782937_+	XkdX family protein	NA	NA	NA	NA	NA
WP_002349644.1|782974_783268_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286683.1|783264_783489_+|holin	holin	holin	NA	NA	NA	NA
WP_002286484.1|783485_784511_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A139ZVY1	Enterococcus_phage	61.3	2.1e-64
WP_087046766.1|785450_786612_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	54.2	4.1e-80
WP_002286474.1|787535_787943_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296902.1|787956_788358_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286473.1|788359_788731_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002330703.1|788766_789066_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002293622.1|789080_789302_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296840.1|789921_791109_+|transposase	IS256-like element IS16 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.3	8.2e-92
796534:796550	attR	GAAGATGCAAAAGCTGC	NA	NA	NA	NA
>prophage 5
NZ_CP014529	Enterococcus faecium strain E745, complete genome	2765010	957787	1015763	2765010	tRNA,capsid,integrase,portal,terminase,transposase	Staphylococcus_phage(20.0%)	57	1002686:1002712	1017494:1017520
WP_002287955.1|957787_958999_+|tRNA	tRNA 4-thiouridine(8) synthase ThiI	tRNA	NA	NA	NA	NA
WP_002287954.1|959571_960219_+	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_002287953.1|960611_963257_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	42.9	4.0e-163
WP_002294071.1|963566_964880_+	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_002287951.1|964869_965523_+	HAD family phosphatase	NA	NA	NA	NA	NA
WP_002294069.1|965577_966270_+	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_002294067.1|966419_966620_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	71.2	3.7e-21
WP_002287948.1|966873_968553_-	ribonuclease J	NA	NA	NA	NA	NA
WP_002287947.1|968554_968767_-	DNA-dependent RNA polymerase auxiliary subunit epsilon family protein	NA	NA	NA	NA	NA
WP_002296290.1|969159_970890_+	multidrug efflux ABC transporter subunit EfrA	NA	W8CYL7	Bacillus_phage	27.6	2.1e-43
WP_002289400.1|970886_972647_+	multidrug efflux ABC transporter subunit EfrB	NA	W8CYL7	Bacillus_phage	28.6	2.5e-52
WP_002296291.1|972741_972939_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002289401.1|973091_973577_+	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_002289402.1|973680_974274_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	55.6	8.9e-55
WP_002289403.1|974453_974981_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002289404.1|975071_975809_+	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	40.0	2.3e-12
WP_002289405.1|975812_976730_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_002289406.1|976731_977961_+	GTPase HflX	NA	NA	NA	NA	NA
WP_000222572.1|977994_978948_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_002287759.1|979598_981212_-	CoA-disulfide reductase	NA	NA	NA	NA	NA
WP_002296511.1|981352_982261_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002287757.1|982443_983568_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_002287755.1|983794_984712_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_002287754.1|984704_985538_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_002287753.1|985620_986739_+	glycosyl hydrolase family 88	NA	NA	NA	NA	NA
WP_002321415.1|986732_988631_+	DUF2264 domain-containing protein	NA	NA	NA	NA	NA
WP_002321414.1|988624_989848_+	glucuronyl hydrolase	NA	NA	NA	NA	NA
WP_002311250.1|989933_991868_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	31.9	1.1e-58
WP_002287746.1|992093_992750_+	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_002287745.1|992823_993177_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_002287744.1|993368_994298_+	permease	NA	NA	NA	NA	NA
WP_002287743.1|994308_995145_+	TIGR03943 family protein	NA	NA	NA	NA	NA
WP_002287742.1|995392_996169_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_002287741.1|996344_997088_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.9	3.6e-29
WP_002296509.1|997080_998661_+	ABC transporter	NA	NA	NA	NA	NA
WP_002289868.1|998911_999391_-	threonine/serine exporter	NA	NA	NA	NA	NA
WP_002289867.1|999406_1000159_-	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_002296505.1|1000706_1001432_+	DNA/RNA non-specific endonuclease	NA	NA	NA	NA	NA
WP_002290885.1|1001686_1001953_+	IreB family regulatory phosphoprotein	NA	NA	NA	NA	NA
WP_002296503.1|1001949_1002381_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_002290887.1|1002405_1002711_+	DUF1292 domain-containing protein	NA	NA	NA	NA	NA
1002686:1002712	attL	CATTCATGGCGGAAGAAGAAGAATAGA	NA	NA	NA	NA
WP_002296502.1|1002791_1003937_-|integrase	site-specific integrase	integrase	A0A1S5S7K9	Streptococcus_phage	33.3	2.0e-50
WP_002296501.1|1003997_1004645_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002296500.1|1004838_1005132_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296499.1|1005175_1005487_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296495.1|1006407_1006770_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296494.1|1006806_1007655_+	DNA replication protein	NA	A0A222ZGI2	Arthrobacter_phage	28.3	5.2e-08
WP_002296493.1|1007644_1009120_+	helicase	NA	Q4ZD27	Staphylococcus_phage	34.9	7.3e-66
WP_002296492.1|1009385_1009793_+	DUF3206 domain-containing protein	NA	NA	NA	NA	NA
WP_002296491.1|1009795_1010011_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002304527.1|1010014_1010395_+	endonuclease	NA	A0A2I7S865	Vibrio_phage	47.9	1.7e-11
WP_002296489.1|1010528_1010684_+	DUF2292 domain-containing protein	NA	NA	NA	NA	NA
WP_002296488.1|1010752_1011226_+|terminase	phage terminase small subunit P27 family	terminase	NA	NA	NA	NA
WP_002296487.1|1011222_1012917_+|terminase	terminase large subunit	terminase	A0A2H4JBN3	uncultured_Caudovirales_phage	43.8	9.1e-129
WP_002317249.1|1012882_1013068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296486.1|1013071_1014247_+|portal	phage portal protein	portal	A0A2H4J5A4	uncultured_Caudovirales_phage	35.6	3.2e-64
WP_002296485.1|1014239_1015763_+|capsid	phage major capsid protein	capsid	A0A1W6JPR8	Staphylococcus_phage	37.4	1.4e-48
1017494:1017520	attR	CATTCATGGCGGAAGAAGAAGAATAGA	NA	NA	NA	NA
>prophage 6
NZ_CP014529	Enterococcus faecium strain E745, complete genome	2765010	1189417	1304113	2765010	tRNA,integrase,transposase	Streptococcus_phage(41.3%)	101	1189825:1189840	1249835:1249850
WP_002317769.1|1189417_1190590_-|transposase	IS256-like element IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	100.0	3.5e-135
1189825:1189840	attL	CTTGGCATCTTTGCCA	NA	NA	NA	NA
WP_002302184.1|1190954_1192046_+	NAD-dependent epimerase/dehydratase family protein	NA	E3T4Y8	Cafeteria_roenbergensis_virus	29.3	1.2e-28
WP_002302186.1|1192113_1193592_-	nucleotide sugar dehydrogenase	NA	M1IB49	Acanthocystis_turfacea_Chlorella_virus	49.3	3.4e-103
WP_002302187.1|1193858_1194608_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002302188.1|1194750_1195701_+	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_002302189.1|1195682_1197146_+	PTS fructose transporter subunit IIC	NA	NA	NA	NA	NA
WP_002302190.1|1197142_1197601_+	PTS fructose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002302191.1|1197597_1198572_+	tagatose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_002302193.1|1198750_1199701_-	membrane protein insertase YidC	NA	NA	NA	NA	NA
WP_002289551.1|1200260_1200536_-	acylphosphatase	NA	NA	NA	NA	NA
WP_002294889.1|1200643_1201408_+	RNA methyltransferase	NA	A0A2D1A6G0	Rhodococcus_phage	26.1	1.7e-05
WP_002296302.1|1201530_1202034_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_002296301.1|1202442_1203084_+	elongation factor G-binding protein	NA	NA	NA	NA	NA
WP_002296300.1|1203253_1204522_+	voltage-gated chloride channel family protein	NA	A0A1X9I5Z9	Streptococcus_phage	32.3	4.4e-43
WP_002296299.1|1204548_1205748_-	YdcF family protein	NA	NA	NA	NA	NA
WP_002296298.1|1205868_1207176_-	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_002294874.1|1207646_1208765_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296295.1|1209267_1209588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288762.1|1210040_1210241_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	74.2	2.5e-22
WP_002288763.1|1210387_1213177_+	DNA polymerase III subunit epsilon	NA	A0A1X9I5C8	Streptococcus_phage	30.9	1.4e-89
WP_002321579.1|1213223_1213751_+	peptidase	NA	NA	NA	NA	NA
WP_002296294.1|1213771_1214962_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_002288767.1|1215001_1216300_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	30.3	1.2e-59
WP_002288769.1|1217475_1218150_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_002319756.1|1218146_1218488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288776.1|1218517_1218877_+	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_002296577.1|1219401_1221486_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	35.7	4.9e-116
WP_002288779.1|1221776_1223243_+	amino acid permease	NA	NA	NA	NA	NA
WP_002297185.1|1223713_1225009_-|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	3.8e-10
WP_002289037.1|1225256_1225796_+	transcriptional regulator	NA	A0A097BYE2	Leuconostoc_phage	34.5	3.8e-20
WP_002289038.1|1225869_1226310_+	CopY/TcrY family copper transport repressor	NA	NA	NA	NA	NA
WP_002289040.1|1226322_1226532_+	copper chaperone CopZ	NA	NA	NA	NA	NA
WP_002289041.1|1226531_1228718_+	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	38.6	1.5e-120
WP_002296533.1|1228737_1230909_+	copper/silver-translocating P-type ATPase CopB	NA	A0A218MNH6	uncultured_virus	32.3	5.0e-71
WP_002289045.1|1233181_1234123_-	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_002304700.1|1234267_1235116_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_002294839.1|1235469_1236282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002304701.1|1236435_1236759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002294835.1|1236832_1237402_+	prevent-host-death protein	NA	NA	NA	NA	NA
WP_002296536.1|1237577_1237844_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0P0I3D2	Lactobacillus_phage	56.5	1.4e-07
WP_002294831.1|1237838_1238531_+	N-acetylmuramoyl-L-alanine amidase	NA	Q9MCC6	Lactobacillus_phage	43.4	2.3e-30
WP_086953915.1|1238570_1239910_-|transposase	IS3-like element ISEnfa3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.7	2.6e-78
WP_000997695.1|1240019_1241198_-|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_086953915.1|1241367_1242706_+|transposase	IS3-like element ISEnfa3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.7	2.6e-78
WP_008266934.1|1242985_1243399_+	DUF4231 domain-containing protein	NA	NA	NA	NA	NA
WP_002295273.1|1243630_1243888_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002287107.1|1244173_1245424_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
WP_002287105.1|1245833_1246808_+	choloylglycine hydrolase family protein	NA	M1HVK5	Paramecium_bursaria_Chlorella_virus	31.8	5.4e-25
WP_002347285.1|1246963_1248259_-|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	5.0e-10
WP_074394542.1|1248868_1249060_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296840.1|1249081_1250269_+|transposase	IS256-like element IS16 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.3	8.2e-92
1249835:1249850	attR	TGGCAAAGATGCCAAG	NA	NA	NA	NA
WP_002326708.1|1250529_1250847_+	SdpI family protein	NA	NA	NA	NA	NA
WP_002289810.1|1250937_1251303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002289809.1|1251510_1251993_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002289807.1|1252189_1253080_+	phosphate ABC transporter substrate-binding protein PstS family protein	NA	NA	NA	NA	NA
WP_002296623.1|1253482_1254778_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	37.5	3.9e-55
WP_002320964.1|1254883_1256152_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	36.1	1.9e-54
WP_002297196.1|1256423_1258895_+	cation-translocating P-type ATPase	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	28.8	7.0e-45
WP_002297195.1|1258997_1260734_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	34.1	1.2e-27
WP_002293705.1|1260730_1261435_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.2	1.4e-38
WP_002293708.1|1262027_1262366_+	putative DNA-binding protein	NA	NA	NA	NA	NA
WP_002293709.1|1262386_1263805_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_069972679.1|1263916_1264495_+	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_002297192.1|1264498_1265020_+	dihydrofolate reductase	NA	NA	NA	NA	NA
WP_002293714.1|1265098_1265653_-	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	29.3	2.3e-12
WP_002290274.1|1265905_1266181_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_002290277.1|1266192_1266444_+	KH domain-containing protein	NA	NA	NA	NA	NA
WP_002297190.1|1266568_1267360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002293716.1|1267529_1268051_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_002293717.1|1268040_1268802_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_002286913.1|1268937_1269285_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_002286921.1|1269657_1270320_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286924.1|1270398_1273626_+	fibrinogen-binding MSCRAMM adhesin Fss3	NA	NA	NA	NA	NA
WP_002286925.1|1273739_1274054_+	YdcP family protein	NA	A0A1S5SF38	Streptococcus_phage	53.4	1.7e-25
WP_002286926.1|1274066_1274441_+	YdcP family protein	NA	A0A1S5SF96	Streptococcus_phage	62.9	1.1e-34
WP_002305701.1|1274441_1274795_+	DNA-damage-inducible protein J	NA	NA	NA	NA	NA
WP_024265280.1|1274865_1276011_+	DUF87 domain-containing protein	NA	A0A1S5SFB5	Streptococcus_phage	63.0	4.3e-130
WP_002297361.1|1276725_1278585_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	26.0	2.8e-30
WP_024265279.1|1278678_1278930_+	hypothetical protein	NA	A0A1S5SFB5	Streptococcus_phage	73.0	7.6e-24
WP_002286932.1|1278989_1280132_+	DNA cytosine methyltransferase	NA	A0A1S5SEK0	Streptococcus_phage	62.1	1.7e-126
WP_002286933.1|1280156_1280411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286934.1|1280666_1281851_+	XRE family transcriptional regulator	NA	A0A1S5SEX3	Streptococcus_phage	60.8	1.9e-141
WP_002305703.1|1281847_1281985_+	DUF3789 domain-containing protein	NA	NA	NA	NA	NA
WP_002286940.1|1282730_1284641_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	29.8	7.1e-37
WP_033657400.1|1284744_1284969_+	hypothetical protein	NA	A0A1S5SEY0	Streptococcus_phage	83.8	8.8e-24
WP_002288934.1|1284981_1285482_+	antirestriction protein ArdA	NA	A0A1S5SF25	Streptococcus_phage	59.6	7.0e-53
WP_002288935.1|1285578_1287426_+	PHP domain-containing protein	NA	NA	NA	NA	NA
WP_002297208.1|1287428_1288325_+	AAA family ATPase	NA	A0A1B1IUG5	uncultured_Mediterranean_phage	29.7	1.1e-16
WP_002288938.1|1288374_1288764_+	conjugal transfer protein	NA	A0A1S5SEX7	Streptococcus_phage	65.9	1.4e-40
WP_002321772.1|1288750_1291096_+	ATP-binding protein	NA	A0A1S5SF64	Streptococcus_phage	76.0	0.0e+00
WP_002296840.1|1291188_1292376_+|transposase	IS256-like element IS16 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.3	8.2e-92
WP_002289059.1|1292676_1294806_+	FUSC family protein	NA	A0A1S5SF30	Streptococcus_phage	60.3	3.1e-182
WP_002289057.1|1294802_1295810_+	lipoprotein	NA	A0A1S5SEZ8	Streptococcus_phage	63.9	4.8e-117
WP_002289055.1|1295826_1296738_+	conjugal transfer protein	NA	A0A1S5SF22	Streptococcus_phage	42.2	1.1e-59
WP_002289053.1|1296865_1297594_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	37.1	5.1e-36
WP_002321361.1|1297590_1299000_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_002289051.1|1299327_1300449_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_077828749.1|1300868_1301105_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002343922.1|1301057_1302011_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_002305710.1|1302349_1302859_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_087040414.1|1302951_1304113_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	53.5	1.6e-79
>prophage 7
NZ_CP014529	Enterococcus faecium strain E745, complete genome	2765010	1318024	1369541	2765010	tRNA,integrase,transposase	Streptococcus_phage(36.36%)	46	1311636:1311651	1326559:1326574
1311636:1311651	attL	AATGTAATAGGTGATT	NA	NA	NA	NA
WP_002299190.1|1318024_1319572_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_002311683.1|1319723_1320152_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288964.1|1320138_1320381_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002288966.1|1320680_1320896_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002300928.1|1321002_1321317_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002288969.1|1321420_1322599_+|integrase	site-specific integrase	integrase	S6C485	Thermus_phage	31.1	1.4e-30
WP_002288970.1|1323001_1323295_+	DUF2087 domain-containing protein	NA	NA	NA	NA	NA
WP_002305732.1|1324137_1326465_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_002288982.1|1329577_1330750_+	class C sortase	NA	NA	NA	NA	NA
1326559:1326574	attR	AATCACCTATTACATT	NA	NA	NA	NA
WP_002288983.1|1330911_1331406_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002321037.1|1331402_1331597_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002288984.1|1331991_1332414_+	HTH domain-containing protein	NA	NA	NA	NA	NA
WP_002288985.1|1332579_1333773_-	MFS transporter	NA	NA	NA	NA	NA
WP_002288986.1|1333996_1334374_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002321036.1|1334361_1334700_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002288989.1|1334833_1335277_+	LysR family transcriptional regulator substrate-binding protein	NA	NA	NA	NA	NA
WP_002297218.1|1335384_1336680_-|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002303949.1|1337060_1337876_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_002321035.1|1337885_1338101_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000997695.1|1338184_1339363_+|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_002289620.1|1340098_1341763_+	acetolactate synthase AlsS	NA	NA	NA	NA	NA
WP_002289619.1|1341775_1342486_+	acetolactate decarboxylase	NA	NA	NA	NA	NA
WP_002289618.1|1342615_1343113_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_002289617.1|1343297_1343558_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002321266.1|1343919_1344159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000997695.1|1344495_1345674_-|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_002323892.1|1345790_1346105_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000997695.1|1347212_1348391_+|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_002302293.1|1348594_1348897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002288592.1|1349653_1350427_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_002288595.1|1350570_1350921_+	SdpI family protein	NA	NA	NA	NA	NA
WP_002288590.1|1350901_1351618_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.7	1.0e-33
WP_002288588.1|1351617_1353066_+	HAMP domain-containing histidine kinase	NA	A0A1V0SGX0	Hokovirus	29.3	1.7e-19
WP_002288586.1|1353136_1353646_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296838.1|1353635_1354361_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002288584.1|1354583_1356704_-	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	58.1	2.8e-220
WP_002288581.1|1356933_1358112_+	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	48.9	3.9e-102
WP_002288579.1|1358127_1358886_+	type I 3-dehydroquinate dehydratase	NA	W6LP76	Streptococcus_phage	36.4	1.9e-25
WP_002288577.1|1358908_1359394_+|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
WP_002288576.1|1359464_1360718_-	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4PQX1	Staphylococcus_phage	55.3	7.7e-24
WP_002288575.1|1360834_1362184_+	NADP-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_002288574.1|1362295_1363642_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_002297218.1|1363993_1365289_-|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002288573.1|1365471_1365858_-	YxeA family protein	NA	NA	NA	NA	NA
WP_002312603.1|1366081_1367545_-|transposase	IS1182-like element ISEfa7 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	48.2	5.3e-125
WP_002311774.1|1368581_1369541_+|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	27.2	7.5e-11
>prophage 8
NZ_CP014529	Enterococcus faecium strain E745, complete genome	2765010	1373605	1419512	2765010	protease,capsid,integrase,holin,tail,portal,terminase,head,transposase	Enterococcus_phage(23.53%)	56	1363752:1363769	1415411:1415428
1363752:1363769	attL	AATAAGGGGCTGTGACAA	NA	NA	NA	NA
WP_002325884.1|1373605_1374559_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_002296337.1|1374830_1375175_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_002296336.1|1375175_1375595_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_002296335.1|1375686_1376037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296334.1|1376002_1377334_-	DUF1576 domain-containing protein	NA	NA	NA	NA	NA
WP_002296332.1|1377589_1378156_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_069972681.1|1378439_1379645_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1S5S7K9	Streptococcus_phage	37.4	7.3e-64
WP_060789858.1|1379782_1380223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069972682.1|1380361_1381015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002350678.1|1381064_1381493_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_002315392.1|1381497_1381872_-	helix-turn-helix transcriptional regulator	NA	O03970	Lactobacillus_phage	38.7	3.2e-18
WP_010722429.1|1382174_1382357_+	helix-turn-helix transcriptional regulator	NA	Q5YAA3	Bacillus_phage	55.0	1.1e-11
WP_002317757.1|1382372_1382693_+	DUF771 domain-containing protein	NA	NA	NA	NA	NA
WP_069972683.1|1383636_1384335_+	antirepressor	NA	D2IYT0	Enterococcus_phage	33.8	5.1e-25
WP_038809834.1|1384512_1384854_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010738857.1|1384846_1385518_+	DUF1071 domain-containing protein	NA	A0A1B1P7F0	Bacillus_phage	47.8	5.5e-29
WP_069972684.1|1385523_1386210_+	hypothetical protein	NA	C9E2N1	Enterococcus_phage	69.1	1.4e-88
WP_002286552.1|1386212_1386962_+	helix-turn-helix domain-containing protein	NA	A0A1L2BY83	Clostridium_phage	54.0	1.7e-31
WP_002338904.1|1386973_1387243_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002311435.1|1387404_1387710_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002326231.1|1387703_1387994_+	hypothetical protein	NA	D2IZR3	Enterococcus_phage	43.4	1.1e-13
WP_069972685.1|1387993_1388350_+	DUF1140 family protein	NA	A0A2H4JAZ4	uncultured_Caudovirales_phage	37.4	4.0e-10
WP_002296604.1|1388309_1388555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286547.1|1388551_1388971_+	hypothetical protein	NA	D2IZL0	Enterococcus_phage	54.3	4.1e-30
WP_069972686.1|1388967_1389534_+	DUF1642 domain-containing protein	NA	D2IZL3	Enterococcus_phage	32.8	2.8e-18
WP_069972687.1|1389633_1390323_-	hypothetical protein	NA	Q7Y4L3	Streptococcus_phage	40.1	2.7e-31
WP_069972688.1|1390579_1391056_+	DUF1492 domain-containing protein	NA	A0A2H4JFW6	uncultured_Caudovirales_phage	51.6	2.2e-27
WP_069972689.1|1391374_1391671_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069972690.1|1391731_1392118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069972691.1|1392098_1392485_+	hypothetical protein	NA	A0A1B1P7N8	Bacillus_phage	35.8	5.6e-10
WP_002304435.1|1392481_1392862_+	HNH endonuclease	NA	A0A1B1P7N1	Bacillus_phage	64.0	4.7e-41
WP_069972692.1|1392973_1393426_+|terminase	terminase small subunit	terminase	A0A2H4JFK0	uncultured_Caudovirales_phage	69.2	3.6e-48
WP_002353266.1|1393422_1395150_+|terminase	terminase large subunit	terminase	A0A2H4JDG5	uncultured_Caudovirales_phage	73.0	7.1e-262
WP_096948708.1|1395171_1396401_+|portal	phage portal protein	portal	A0A2H4J9C7	uncultured_Caudovirales_phage	65.5	4.6e-146
WP_002353264.1|1396366_1396942_+|head,protease	HK97 family phage prohead protease	head,protease	A0A1B2APW1	Phage_Wrath	72.2	3.3e-70
WP_069972693.1|1396954_1398316_+|capsid	phage major capsid protein	capsid	A0A1B2APY9	Phage_Wrath	69.6	4.9e-125
WP_002301326.1|1398317_1398596_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1C8E967	Bacillus_phage	62.7	3.5e-22
WP_002303041.1|1398576_1398903_+|head	phage head closure protein	head	A0A0N7IRA3	Lactobacillus_phage	53.4	2.9e-23
WP_002353261.1|1398892_1399231_+	hypothetical protein	NA	A0A1B1P7P2	Bacillus_phage	46.8	6.6e-23
WP_002353260.1|1399220_1399586_+	HK97 gp10 family phage protein	NA	A0A2H4JDG0	uncultured_Caudovirales_phage	41.1	7.7e-17
WP_002353259.1|1399592_1400219_+|tail	tail protein	tail	A0A2H4JGN2	uncultured_Caudovirales_phage	34.0	1.7e-27
WP_047649774.1|1400218_1400683_+	hypothetical protein	NA	A0A2H4J956	uncultured_Caudovirales_phage	41.0	5.7e-17
WP_069972694.1|1400877_1403187_+|tail	phage tail tape measure protein	tail	Q8W5Z7	Listeria_phage	49.0	1.2e-83
WP_002349218.1|1403198_1403903_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_069972695.1|1403899_1406605_+	peptidoglycan DD-metalloendopeptidase family protein	NA	Q9AZX5	Lactococcus_phage	40.4	5.0e-169
WP_025476995.1|1406579_1408337_+	DUF2479 domain-containing protein	NA	Q9AZ56	Lactococcus_phage	46.1	3.2e-36
WP_002349645.1|1408353_1409136_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002317324.1|1409135_1411202_+	DUF2479 domain-containing protein	NA	A0A096XSZ6	Enterococcus_phage	47.0	1.4e-86
WP_069972696.1|1411202_1411649_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002331002.1|1411650_1411788_+	XkdX family protein	NA	NA	NA	NA	NA
WP_069972697.1|1411824_1412118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002302122.1|1412140_1412338_+|holin	holin	holin	A0A0S2MYF6	Enterococcus_phage	85.9	7.8e-24
WP_069972698.1|1412348_1413368_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1G5SA77	Enterococcus_phage	68.6	7.1e-60
WP_096157805.1|1413407_1414747_-|transposase	IS3-like element ISEnfa3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.7	2.6e-78
WP_000997695.1|1416260_1417439_+|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
1415411:1415428	attR	TTGTCACAGCCCCTTATT	NA	NA	NA	NA
WP_002322125.1|1418048_1419512_+|transposase	IS1182-like element ISEfa7 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	48.0	2.0e-124
>prophage 9
NZ_CP014529	Enterococcus faecium strain E745, complete genome	2765010	1589623	1620617	2765010	tRNA,integrase,protease,transposase	Streptococcus_phage(22.22%)	30	1589451:1589468	1624142:1624159
1589451:1589468	attL	AAAATAAGAAAATGTTGT	NA	NA	NA	NA
WP_002297185.1|1589623_1590919_-|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	3.8e-10
WP_002288335.1|1591098_1591800_+|tRNA	tRNA (adenine-N(1))-methyltransferase	tRNA	NA	NA	NA	NA
WP_002288338.1|1591796_1592918_+	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_002288340.1|1592932_1594165_+	peptidase T	NA	NA	NA	NA	NA
WP_002288343.1|1594296_1595205_+	YegS/Rv2252/BmrU family lipid kinase	NA	NA	NA	NA	NA
WP_002288344.1|1595239_1595512_+	DUF1294 domain-containing protein	NA	NA	NA	NA	NA
WP_002288347.1|1595522_1596569_+	flippase-like domain-containing protein	NA	NA	NA	NA	NA
WP_002288348.1|1596819_1599429_+	ATP-dependent chaperone ClpB	NA	A0A2I7SAX5	Vibrio_phage	35.0	1.6e-132
WP_002288350.1|1599579_1600251_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002288352.1|1600243_1600738_-	nucleoside deoxyribosyltransferase	NA	A0A1W6JK28	Lactococcus_phage	56.5	7.2e-42
WP_002288353.1|1600757_1601978_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002288355.1|1602124_1603960_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.4	3.4e-20
WP_002288357.1|1604053_1605181_-|integrase	site-specific integrase	integrase	A0A2I7SCV1	Paenibacillus_phage	55.5	1.8e-109
WP_000222572.1|1605237_1606191_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_000997695.1|1606346_1607525_-|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_002321532.1|1607770_1608061_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002322258.1|1608178_1608439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002289415.1|1608575_1608989_-	Hsp20/alpha crystallin family protein	NA	A0A1B2LRT2	Wolbachia_phage	31.5	2.1e-07
WP_002303864.1|1609444_1609930_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002289418.1|1610068_1610284_-	DUF378 domain-containing protein	NA	NA	NA	NA	NA
WP_002289420.1|1610507_1611308_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	26.2	2.6e-09
WP_002289421.1|1611326_1613195_+	HTH domain-containing protein	NA	NA	NA	NA	NA
WP_002289422.1|1613187_1613679_+	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002289423.1|1613666_1614221_+	PTS sorbitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_002296760.1|1614238_1615234_+	PTS glucitol/sorbitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_002287107.1|1615375_1616626_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
WP_002296624.1|1617034_1617433_+	PTS glucitol/sorbitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_002311093.1|1617416_1618112_+	fructose-6-phosphate aldolase	NA	E3SKN5	Synechococcus_phage	31.5	1.0e-22
WP_002296627.1|1618705_1619593_-	rotamase	NA	NA	NA	NA	NA
WP_002296628.1|1619777_1620617_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
1624142:1624159	attR	AAAATAAGAAAATGTTGT	NA	NA	NA	NA
>prophage 10
NZ_CP014529	Enterococcus faecium strain E745, complete genome	2765010	1923829	1932890	2765010		Synechococcus_phage(16.67%)	9	NA	NA
WP_002288010.1|1923829_1924408_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	37.4	1.3e-26
WP_002321731.1|1924404_1925448_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.7	2.7e-62
WP_002288013.1|1925479_1926919_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	33.1	5.3e-53
WP_002288015.1|1926903_1929126_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	41.3	1.9e-150
WP_002288017.1|1929126_1929798_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_002295474.1|1929799_1930054_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_002288021.1|1930053_1930782_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	E3SPA9	Prochlorococcus_phage	41.4	4.6e-45
WP_002297115.1|1931037_1931415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288023.1|1931594_1932890_-	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	33.1	4.5e-19
>prophage 11
NZ_CP014529	Enterococcus faecium strain E745, complete genome	2765010	2206640	2258497	2765010	holin,integrase,transposase	Escherichia_phage(21.43%)	50	2208106:2208121	2255429:2255444
WP_002296127.1|2206640_2208188_-|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
2208106:2208121	attL	AGATTCTGAATGGTTT	NA	NA	NA	NA
WP_002287659.1|2208289_2208643_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_002285758.1|2208632_2208827_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002289149.1|2209082_2209376_-	iron-sulfur cluster biosynthesis protein	NA	NA	NA	NA	NA
WP_002289151.1|2209403_2210069_-	TrkA family potassium uptake protein	NA	NA	NA	NA	NA
WP_002295404.1|2210208_2210841_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_002312578.1|2210847_2211915_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_002295408.1|2211911_2212643_-	cell wall-active antibiotics response protein	NA	NA	NA	NA	NA
WP_002295409.1|2212810_2213290_-	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_002295410.1|2213425_2214601_-	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_002297066.1|2214765_2215926_+	serine hydrolase	NA	A0A2R4AS58	Mycobacterium_phage	25.2	3.2e-08
WP_002312603.1|2215958_2217422_-|transposase	IS1182-like element ISEfa7 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	48.2	5.3e-125
WP_002297065.1|2217522_2218470_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A1V0SKV4	Klosneuvirus	38.2	2.3e-52
WP_002297064.1|2218502_2219918_-	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_002321507.1|2219914_2221030_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_002321508.1|2221086_2222574_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002297061.1|2222644_2223619_-	glycosyltransferase	NA	A0A0F7L2F7	uncultured_marine_virus	35.2	2.5e-06
WP_002297060.1|2223663_2224629_-	glycosyltransferase	NA	A0A0F7L2F7	uncultured_marine_virus	34.6	2.5e-06
WP_002321509.1|2224621_2225689_-	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_002297058.1|2225696_2226398_-	2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_002312566.1|2226394_2227249_-	LicD family protein	NA	NA	NA	NA	NA
WP_002321510.1|2227281_2228085_-	glycosyltransferase	NA	F2Y1U7	Organic_Lake_phycodnavirus	31.5	5.1e-13
WP_002295430.1|2228143_2229535_-	sugar transferase	NA	NA	NA	NA	NA
WP_002297271.1|2229869_2230829_+|transposase	IS30-like element IS6770 family transposase	transposase	NA	NA	NA	NA
WP_002296538.1|2230896_2233035_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_002296539.1|2233073_2234660_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_002296541.1|2234649_2235870_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.4	3.3e-11
WP_002289081.1|2235881_2236688_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002296542.1|2236897_2238178_-	EpaQ family protein	NA	NA	NA	NA	NA
WP_002296543.1|2238221_2240255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002294531.1|2240289_2241141_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	39.0	1.3e-38
WP_002296544.1|2241238_2242267_-	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	43.2	2.2e-69
WP_002286442.1|2242288_2242861_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	49.2	8.3e-42
WP_002286449.1|2242874_2243741_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	62.5	3.7e-102
WP_002321540.1|2243840_2244575_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_002286453.1|2244552_2245380_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_002286455.1|2245379_2246180_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_002286457.1|2246172_2247312_-	undecaprenyl/decaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase	NA	NA	NA	NA	NA
WP_002286461.1|2247387_2248311_-	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_002294533.1|2248342_2249107_-	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_002286465.1|2249264_2249705_+	flavodoxin	NA	NA	NA	NA	NA
WP_002286467.1|2249882_2250452_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002286469.1|2250705_2251938_+	aminopeptidase	NA	NA	NA	NA	NA
WP_002286470.1|2252242_2252443_+|integrase	tyrosine-type recombinase/integrase	integrase	Q9AZR0	Lactococcus_phage	75.7	4.6e-08
WP_002286473.1|2253030_2253402_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296902.1|2253403_2253805_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002286474.1|2253818_2254226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087046766.1|2255148_2256311_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	54.2	4.1e-80
2255429:2255444	attR	AAACCATTCAGAATCT	NA	NA	NA	NA
WP_002286484.1|2257250_2258276_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A139ZVY1	Enterococcus_phage	61.3	2.1e-64
WP_002286683.1|2258272_2258497_-|holin	holin	holin	NA	NA	NA	NA
>prophage 12
NZ_CP014529	Enterococcus faecium strain E745, complete genome	2765010	2264007	2299082	2765010	protease,integrase,tail,portal,terminase,head	Enterococcus_phage(29.41%)	54	2259403:2259419	2299243:2299259
2259403:2259419	attL	TTTTTCATTTATTTCCC	NA	NA	NA	NA
WP_002317183.1|2264007_2266839_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A1P8BMB8	Lactococcus_phage	59.7	0.0e+00
WP_002311466.1|2266835_2267603_-|tail	phage tail protein	tail	D7RWD9	Brochothrix_phage	45.5	1.2e-59
WP_002311465.1|2267635_2270755_-|tail	phage tail tape measure protein	tail	Q9G097	Lactococcus_phage	79.2	1.8e-167
WP_002318903.1|2270771_2271059_-	hypothetical protein	NA	D7RWD7	Brochothrix_phage	44.3	2.4e-13
WP_002293018.1|2271112_2271481_-	hypothetical protein	NA	Q77RZ7	Lactococcus_phage	54.8	8.6e-24
WP_002311463.1|2271526_2272039_-|tail	phage major tail protein, TP901-1 family	tail	D7RWD5	Brochothrix_phage	66.3	7.4e-58
WP_002311462.1|2272049_2272442_-	hypothetical protein	NA	Q77K20	Lactococcus_phage	76.2	2.2e-49
WP_002311461.1|2272438_2272810_-	HK97 gp10 family phage protein	NA	Q77K21	Lactococcus_phage	51.2	6.8e-29
WP_002311460.1|2272806_2273133_-	hypothetical protein	NA	A0A1P8BMJ2	Lactococcus_phage	50.5	8.1e-18
WP_002311459.1|2273129_2273468_-|head,tail	phage head-tail connector protein	head,tail	A0A097BY74	Leuconostoc_phage	40.4	3.8e-10
WP_002311458.1|2273507_2273714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002311457.1|2273724_2274732_-	hypothetical protein	NA	C9E2J5	Enterococcus_phage	86.2	5.4e-161
WP_002311456.1|2274756_2275110_-	hypothetical protein	NA	C9E2J4	Enterococcus_phage	73.5	6.7e-42
WP_002311455.1|2275121_2275763_-	DUF4355 domain-containing protein	NA	C9E2J3	Enterococcus_phage	48.1	2.4e-37
WP_002311453.1|2275877_2276060_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002311451.1|2276397_2277351_-	hypothetical protein	NA	Q9AZ64	Lactococcus_phage	65.8	2.7e-114
WP_002311450.1|2277355_2277619_-	hypothetical protein	NA	A0A1S5SBT9	Streptococcus_phage	54.0	3.2e-17
WP_002318892.1|2277631_2277862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002311447.1|2277815_2279450_-|portal	phage portal protein	portal	C9E2I8	Enterococcus_phage	61.4	1.3e-185
WP_002311446.1|2279460_2280759_-|terminase	PBSX family phage terminase large subunit	terminase	D7RWC5	Brochothrix_phage	81.5	2.2e-207
WP_002311445.1|2280751_2281207_-|terminase	terminase small subunit	terminase	D7RWC4	Brochothrix_phage	41.4	2.7e-19
WP_002311444.1|2281232_2281457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002330493.1|2281955_2282135_+	YegP family protein	NA	NA	NA	NA	NA
WP_024265261.1|2282127_2282541_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002300143.1|2282831_2283107_+	hypothetical protein	NA	A0A2H4JEH2	uncultured_Caudovirales_phage	45.7	9.9e-17
WP_002286542.1|2283564_2283978_-	autolysin	NA	C9E2P5	Enterococcus_phage	81.0	1.5e-56
WP_002286693.1|2284054_2284351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002286545.1|2284347_2284905_-	DUF1642 domain-containing protein	NA	A0A0C5KKV2	Enterococcus_phage	36.2	2.8e-10
WP_002312822.1|2284901_2285297_-	hypothetical protein	NA	Q938M1	Temperate_phage	41.6	6.6e-14
WP_002311438.1|2285463_2285775_-	hypothetical protein	NA	D2IZY1	Enterococcus_phage	58.6	9.1e-27
WP_002311437.1|2285774_2286065_-	hypothetical protein	NA	D2IZR3	Enterococcus_phage	43.4	1.8e-13
WP_002322110.1|2286058_2286370_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002290675.1|2286366_2286528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002311433.1|2286524_2286827_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002311431.1|2286988_2287258_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002311430.1|2287269_2288121_-	replication protein	NA	A0A1S5SFJ6	Streptococcus_phage	66.4	2.7e-49
WP_002317389.1|2288229_2288745_-	HNH endonuclease	NA	E5DV63	Deep-sea_thermophilic_phage	37.5	2.9e-17
WP_002330486.1|2288752_2289445_-	hypothetical protein	NA	A0A0S2MYA3	Enterococcus_phage	52.3	9.7e-61
WP_002286557.1|2289450_2290122_-	DUF1071 domain-containing protein	NA	A0A1B1P7F0	Bacillus_phage	47.4	4.2e-29
WP_002311424.1|2290114_2290456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002311421.1|2290777_2290966_-	hypothetical protein	NA	D2IZW5	Enterococcus_phage	58.6	1.7e-07
WP_002311419.1|2290986_2291271_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002311418.1|2291318_2291618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296611.1|2291632_2291836_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002311416.1|2291850_2292597_-	hypothetical protein	NA	A0A0B5A507	Paenibacillus_phage	41.8	1.6e-48
WP_002322655.1|2292672_2292924_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002311412.1|2293110_2293299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002317392.1|2293746_2294067_+	helix-turn-helix transcriptional regulator	NA	A0A1S5SAD3	Streptococcus_phage	57.3	2.6e-21
WP_002290613.1|2294084_2294507_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_002311408.1|2294593_2294899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002311406.1|2294997_2296146_+|integrase	site-specific integrase	integrase	A0A1B1IMP1	Lactococcus_phage	48.4	3.9e-91
WP_002288864.1|2296234_2297860_-	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	56.8	2.2e-156
WP_002288862.1|2297910_2298195_-	co-chaperone GroES	NA	A0A221S4M3	uncultured_virus	40.2	2.0e-12
WP_002288860.1|2298419_2299082_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
2299243:2299259	attR	GGGAAATAAATGAAAAA	NA	NA	NA	NA
>prophage 13
NZ_CP014529	Enterococcus faecium strain E745, complete genome	2765010	2629988	2649596	2765010		Streptococcus_phage(87.5%)	20	NA	NA
WP_002297366.1|2629988_2630303_+	YdcP family protein	NA	A0A1S5SF38	Streptococcus_phage	53.4	1.0e-25
WP_002297365.1|2630315_2630690_+	YdcP family protein	NA	A0A1S5SF96	Streptococcus_phage	66.1	2.4e-34
WP_002311649.1|2630690_2631035_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002343904.1|2631117_2632263_+	DUF87 domain-containing protein	NA	A0A1S5SFB5	Streptococcus_phage	62.8	6.0e-132
WP_002297361.1|2632977_2634837_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	26.0	2.8e-30
WP_002297360.1|2634930_2635170_+	hypothetical protein	NA	A0A1S5SFB5	Streptococcus_phage	80.3	2.1e-23
WP_002297358.1|2635247_2635922_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_002321810.1|2636154_2636589_+	DNA (cytosine-5-)-methyltransferase	NA	A0A1S5SDW2	Streptococcus_phage	77.1	6.5e-63
WP_002297356.1|2636589_2637297_+	DNA methylase	NA	A0A1S5SEK0	Streptococcus_phage	50.4	5.8e-53
WP_002297354.1|2637286_2637577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002297353.1|2637835_2639020_+	XRE family transcriptional regulator	NA	A0A1S5SEX3	Streptococcus_phage	61.6	2.9e-142
WP_002317225.1|2639016_2639154_+	DUF3789 domain-containing protein	NA	NA	NA	NA	NA
WP_002286940.1|2639899_2641810_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	29.8	7.1e-37
WP_033658092.1|2641913_2642138_+	hypothetical protein	NA	A0A1S5SEY0	Streptococcus_phage	83.8	1.2e-23
WP_002297350.1|2642150_2642654_+	antirestriction protein ArdA	NA	A0A1S5SF25	Streptococcus_phage	59.9	9.2e-53
WP_002297349.1|2642713_2643103_+	conjugal transfer protein	NA	A0A1S5SEX7	Streptococcus_phage	68.3	3.9e-43
WP_002297348.1|2643089_2645537_+	ATP-binding protein	NA	A0A1S5SF64	Streptococcus_phage	76.0	0.0e+00
WP_002297347.1|2645541_2647665_+	hypothetical protein	NA	A0A1S5SF30	Streptococcus_phage	59.7	1.2e-181
WP_002297346.1|2647661_2648666_+	peptidase P60	NA	A0A1S5SEZ8	Streptococcus_phage	63.5	5.6e-118
WP_002297345.1|2648684_2649596_+	conjugal transfer protein	NA	A0A1S5SF22	Streptococcus_phage	44.0	2.2e-65
>prophage 1
NZ_CP014530	Enterococcus faecium strain E745 plasmid pl1, complete sequence	223688	9695	63601	223688	bacteriocin,holin,transposase,integrase	Streptococcus_phage(27.78%)	50	9557:9616	53809:55599
9557:9616	attL	TTAGTCTAATGGTGATAAGTCAAGATGAAATTTAAGATTTTCTTTATTGAGTAATATGTT	NA	NA	NA	NA
WP_002287107.1|9695_10946_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
WP_002317424.1|11355_13728_+	hypothetical protein	NA	B5SP25	Lactococcus_phage	32.5	1.8e-13
WP_002313123.1|13788_15258_+	DUF3991 domain-containing protein	NA	NA	NA	NA	NA
WP_002303486.1|15268_17278_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	52.6	1.6e-111
WP_002299811.1|17623_18220_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_002301800.1|18232_19132_+	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_002301801.1|19134_19266_+	single-stranded DNA-binding protein	NA	A8ATZ7	Listeria_phage	83.3	1.3e-11
WP_002305808.1|19287_19620_+	single-stranded DNA-binding protein	NA	W6LM61	Streptococcus_phage	53.2	6.1e-21
WP_002295625.1|19641_19899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002295624.1|20057_20180_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_002305809.1|20369_20594_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305810.1|21036_21243_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002300797.1|21242_21494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002300801.1|21674_21947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002300804.1|22391_22571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002311569.1|22629_22986_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000222572.1|23954_24908_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.8	3.7e-34
WP_002300807.1|25028_25292_+|bacteriocin	circular bacteriocin, circularin A/uberolysin family	bacteriocin	NA	NA	NA	NA
WP_000997695.1|25663_26842_+|transposase	IS256-like element ISEf1 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	25.6	3.0e-30
WP_002300833.1|27230_29177_+	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_002300835.1|29179_29635_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_002300836.1|29648_30977_+	PTS galactitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_002300838.1|31010_31295_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002300840.1|31296_31812_+	YjbQ family protein	NA	NA	NA	NA	NA
WP_002300841.1|31827_32490_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_002300842.1|32496_33069_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_002300843.1|33255_34776_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	31.6	1.1e-48
WP_002305884.1|35018_35204_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_002300846.1|35187_35370_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002301839.1|36323_36923_+|integrase	tyrosine-type recombinase/integrase	integrase	D2XR58	Bacillus_phage	36.1	1.3e-29
WP_002322465.1|36986_37586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002292418.1|38601_39474_-	ROK family protein	NA	NA	NA	NA	NA
WP_000195429.1|39666_40839_+|transposase	IS256-like element IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	100.0	3.5e-135
WP_002293868.1|41069_43016_-	PTS beta-glucoside transporter subunit IIBCA	NA	NA	NA	NA	NA
WP_002302078.1|43200_44640_+	sucrose-6-phosphate hydrolase	NA	S6ATV4	Bacillus_phage	25.1	1.4e-16
WP_002302077.1|44641_45604_+	LacI family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	25.8	2.3e-20
WP_086953894.1|45773_47200_-|transposase	IS3-like element ISEfa10 family transposase	transposase	A0A1B1P773	Bacillus_phage	40.2	2.3e-48
WP_002301718.1|47442_47898_+|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.6	1.3e-13
WP_002317441.1|48576_49896_-|transposase	IS1380-like element IS1678 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	82.5	6.9e-209
WP_002311711.1|50167_50398_-	resolvase	NA	NA	NA	NA	NA
WP_002289254.1|50627_51446_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002289253.1|51606_52296_+	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_002289252.1|52309_53812_+	PTS glucose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_002287107.1|53947_55198_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
WP_002300328.1|55607_56084_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
53809:55599	attR	TTAGTCTAATGGTGATAAGTCAAGATGAAATTTAAGATTTTCTTTATTGAGTAATATGTTTTGAAGCGCACGAAACTAGACCCGATCAAAATCAAATTTTTTTCGGGTTGATTCAAGGATTTGCGTCAATAACGGATTGTTATTTCTCTATCACACTCCTTGGTGGCGTATAGAGTTGGTGTTTACGTAGTAGCGTATCCACCAGACGCGTAAATTTTCTTGCGGTTAGGACGAGTGCACGTTTGTGTTGATGCTTTGGAACCTCCTTATATTTACTTTGATAAAAAGCTTTGTATTCAGGAAGATAATTTTTTACAGAGTTGGCAGCTTCAACTAAGTAGTATCTAAAATATCGATTTCCTTGTTTTGTCAGAGGTGTATTTTGCGACTGATAGTTTCCAGATTGGTTCACTTTCCAACTTAATCCAGCGTATTTTGCCAATTTTGTCTGATCTTCAAATCTTTCGATTTGACCAATTTCAGCGATTAAACCGGCAGCATAGACTTTACCAACGCCTGGAATACTGGTTAAGCATTGATATTCTGGAATGACAACAATTACTTGTTCGATGGCTTTATCTAATTCTTTGATATTTTTTTCAAGTGCTCGTATTTCTCGTACGAGAACACTTAAAACAACATTAATTGATTCTTGTGCAAGAGCACCTAGGCGGTAACTCATGGTAATTGCACGTTGAATTGCTTTAGCGATTTTTTCTGGTTGCTTGAAACGGCCTTTTCCTTTTTCTTGAAGTAAATCACAGAAAGCTTCTAAAGGAAGCTCAGCAAGTTCATCCAATGTGAAATCTTCCGTCATGAGTGAAATGAGGGTTGCACTAAAAAGACTCGTCGATTCGTCTCGCATTTCTCGAGCAAGCGTATTACATTTGTACGTTAGATTTTCAAGAAAATGTTGCTTTGTACGAATCAATTGCTTAATAAGTTGATAGCGAGTACGTGTTAAACGCTGTAAGGCCATGTATTTCTCTTCTTTGATAGGGGAAGTTGTGAATCGTTGAATACGCAAGAAATCAGCGATTCTTAATGCATCGTTTCGATCAGTTTTATTCTCATCAAACATGCGACTAAATTGTTTCACCCGAAAAGGATTTTCAATCGTTACAAGTGTGTTGAGCTTCTTTAGTTTCTCATCTTCATGAAAAAACATGGAAGGATGGAAGCTGTACATGGACGTTGACTCCATGCCAATCACAATTTGATCAAAGTGGTAGCTGTTATTGAATTCAAGAATTGTTTCTCGTATGAATGAAGCACCTTCGATGTCATTGGCAACAGAGATTTCAGATAAGATAGACAATTGATTGTCGTCTGTTAAAAAACAAACATCTAGTTTTTCAGAGCTAACGTCAATACCGACAAATAATTTCATGGAAGAAGGACCTCCTTTCGATATAAATTTTGGAAAATGCTTCGATACTGTGGGATTTCCCAGAAACTCACTGTATAGCCACAACCTCGCCTAATAGAATACGGTGATAAAAGAGCTAGAAGCTGCCTTCCAAACTACTATTTGAAAGTCTAGTCCATTATCGAAACAGCTAATGAGTTGGTAGTGATAACAGTGGTTCGGGTAACAGACTAAACAGGGTAGACAAACGCTACAGGAGGAAATAGCAAATTCCCGTTGGATCCTTTCCATACATCCATTGTACTCTGAGAAATCACACAATATCGAAACAAATTCCGTTAGGAATGTGTTATTCAATAAATTTTATAATCTAGAAACATTTTGAATAAAAACTATTAGACAAATGATATTTTACGAGGAGG	NA	NA	NA	NA
WP_106913781.1|56180_56381_-	hypothetical protein	NA	NA	NA	NA	NA
WP_127843772.1|56581_57696_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	51.3	1.5e-79
WP_002287870.1|58860_59379_+	ClbS/DfsB family four-helix bundle protein	NA	NA	NA	NA	NA
WP_002301591.1|61454_62540_+	tyrosine recombinase XerS	NA	NA	NA	NA	NA
WP_000222572.1|62647_63601_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.8	3.7e-34
>prophage 2
NZ_CP014530	Enterococcus faecium strain E745 plasmid pl1, complete sequence	223688	69706	198684	223688	integrase,transposase	Streptococcus_phage(37.78%)	109	134405:134464	151100:151346
WP_141655267.1|69706_70821_-|transposase	IS3-like element IS1485 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	51.3	1.1e-79
WP_002322511.1|71089_71365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002287937.1|71496_72924_+|transposase	IS1182-like element ISEfa12 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	47.8	4.4e-124
WP_002287522.1|73131_73536_+|transposase	IS200/IS605-like element ISEfa4 family transposase	transposase	A0A286QN76	Streptococcus_phage	73.8	1.3e-52
WP_002330559.1|73552_74701_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A288TXV8	Enterococcus_phage	91.0	1.0e-200
WP_002317307.1|74940_76326_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_002317308.1|76338_77679_-	glycoside hydrolase family 32 protein	NA	S6ATV4	Bacillus_phage	23.3	1.4e-10
WP_002322539.1|77832_78687_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_002322538.1|78761_80882_+	family 10 glycosylhydrolase	NA	NA	NA	NA	NA
WP_002317311.1|80874_81339_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_096157807.1|81649_82812_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	50.9	5.9e-79
WP_096157805.1|83069_84408_+|transposase	IS3-like element ISEnfa3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.7	2.6e-78
WP_002297185.1|86244_87540_-|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	29.8	5.3e-44
WP_002287522.1|87935_88340_+|transposase	IS200/IS605-like element ISEfa4 family transposase	transposase	A0A286QN76	Streptococcus_phage	73.8	1.3e-52
WP_002287525.1|88356_89505_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A288TXV8	Enterococcus_phage	93.4	1.2e-204
WP_002313174.1|89778_90039_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000997695.1|90194_91373_+|transposase	IS256-like element ISEf1 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	25.6	3.0e-30
WP_002300494.1|91462_92782_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_002285815.1|92778_93432_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	33.2	4.0e-24
WP_010729615.1|93719_94994_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	36.1	1.7e-55
WP_032494987.1|95048_96614_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	31.6	2.4e-19
WP_002288609.1|96973_97906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002288608.1|97945_99607_-	hyaluronate lyase	NA	NA	NA	NA	NA
WP_002305865.1|99603_102585_-	glycoside hydrolase family 42	NA	L0N6M2	Herpes_simplex_virus	28.8	2.2e-122
WP_002304880.1|102712_104626_-	beta-N-acetylhexosaminidase	NA	NA	NA	NA	NA
WP_002304878.1|104655_105267_-	DUF624 domain-containing protein	NA	NA	NA	NA	NA
WP_002304876.1|105318_106791_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_002289655.1|106814_107726_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_002304874.1|107737_108676_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_002304873.1|108904_110479_+	ATP-binding protein	NA	Q9EYF3	Enterobacteria_phage	30.0	1.6e-10
WP_002302980.1|110456_111185_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_002340466.1|111567_112842_-|transposase	ISL3-like element IS1476 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	36.4	2.3e-55
WP_002302261.1|113064_114096_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.6	1.8e-26
WP_002304872.1|114102_114933_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033605953.1|114929_115736_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_002302267.1|115741_116566_-	type I phosphodiesterase/nucleotide pyrophosphatase	NA	NA	NA	NA	NA
WP_002302268.1|116555_117656_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_002302270.1|117833_118619_+	histidinol phosphate phosphatase	NA	NA	NA	NA	NA
WP_002317021.1|118651_119035_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077828694.1|119110_119242_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002322470.1|119210_119447_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_002302275.1|119524_120496_-	radical SAM protein	NA	NA	NA	NA	NA
WP_002326809.1|123052_124348_+|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	29.5	5.3e-44
WP_002296127.1|124434_125982_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	28.9	1.7e-44
WP_002285758.1|126425_126620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002298085.1|126929_128306_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002298083.1|128305_128962_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.1	1.3e-22
WP_002301194.1|128971_130249_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_111944785.1|130498_131660_+|transposase	IS3-like element ISEfa8 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	54.2	1.8e-80
WP_010706480.1|132297_132648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115250354.1|133114_134276_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	53.8	5.9e-79
134405:134464	attL	CAACCAATCTAATCGAGTCTTTCAATAAGCAAATTAAAAGATACAGCCGTAGAAAAGAGC	NA	NA	NA	NA
WP_002305939.1|135232_136192_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	33.9	4.5e-32
WP_002305121.1|136178_136784_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002343836.1|137023_138172_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A288TXV8	Enterococcus_phage	90.8	3.9e-200
WP_002287522.1|138188_138593_-|transposase	IS200/IS605-like element ISEfa4 family transposase	transposase	A0A286QN76	Streptococcus_phage	73.8	1.3e-52
WP_002301108.1|138841_139396_-|integrase	tyrosine-type recombinase/integrase	integrase	W8CYP1	Bacillus_phage	46.1	8.6e-36
WP_010706260.1|139892_140801_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_002311756.1|141222_141828_-	cell division protein Fic	NA	NA	NA	NA	NA
WP_002317381.1|142429_142729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002302055.1|142913_143867_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.9	9.6e-35
WP_002311759.1|143979_144630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002294762.1|144729_145239_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	34.8	2.8e-17
WP_002301446.1|145555_146119_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_002292292.1|146133_147177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002292291.1|147324_147729_-	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
WP_002292290.1|147928_148177_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_060854031.1|148296_149475_+|transposase	IS256-like element ISEf1 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	25.6	4.0e-30
WP_000997695.1|150965_152144_-|transposase	IS256-like element ISEf1 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	25.6	3.0e-30
151100:151346	attR	GCTCTTTTCTACGGCTGTATCTTTTAATTTGCTTATTGAAAGACTCGATTAGATTGGTTGAGTAAATGGTTCTACGAATGCTAGGTGGAAAATCATAAAAAGTTAATAAGTCTTGGTTTTCTATGAGTGACTGCGTCACTTTAGGATAGTTTTTCTTCCATTTCTCAATCATGCCGGATAAGAAGGTATTCGCTTCTTCTTTTGAGTTAGCTTGATAAACAGCCTTAAAGTCATCACAGATTTCTTT	NA	NA	NA	NA
WP_002343830.1|152779_153658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002343829.1|153654_154614_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.9	8.8e-36
WP_002311502.1|155457_156912_-	PTS sugar transporter	NA	NA	NA	NA	NA
WP_069972708.1|157190_158486_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	37.2	1.1e-54
WP_002289586.1|158702_159545_-	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_002289584.1|159581_161048_-	glycoside hydrolase family 1 protein	NA	NA	NA	NA	NA
WP_002289583.1|161102_162947_-	PTS beta-glucoside transporter subunit EIIBCA	NA	NA	NA	NA	NA
WP_102829706.1|163330_164017_+|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.1	1.7e-126
WP_002301682.1|164577_165387_-	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
WP_002301683.1|165386_166133_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002301684.1|166150_166618_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002301685.1|166617_167028_-	PTS fructose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002301686.1|167038_168052_-	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_002301687.1|168268_169003_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002317374.1|168986_169685_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002322453.1|171077_171905_-	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_002311505.1|172803_173436_-	HAD family phosphatase	NA	A0A1D8KNV9	Synechococcus_phage	28.4	1.0e-08
WP_002343825.1|173448_176172_-	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_002322451.1|176287_177253_-	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_002298371.1|177306_178119_-	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
WP_002298373.1|178132_178906_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002298375.1|178919_179390_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002343823.1|179386_179803_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002311511.1|180127_180970_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_002330559.1|181319_182468_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A288TXV8	Enterococcus_phage	91.0	1.0e-200
WP_002287522.1|182484_182889_-|transposase	IS200/IS605-like element ISEfa4 family transposase	transposase	A0A286QN76	Streptococcus_phage	73.8	1.3e-52
WP_002311512.1|183255_184680_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_002322527.1|184679_185285_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	34.6	4.2e-20
WP_096948718.1|185307_185987_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	94.7	1.1e-122
WP_002287937.1|186184_187612_-|transposase	IS1182-like element ISEfa12 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	47.8	4.4e-124
WP_002292681.1|187756_188305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002292680.1|188305_189163_-	ParA family protein	NA	F0PIG8	Enterococcus_phage	30.7	8.1e-33
WP_002292679.1|189448_189736_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_002292678.1|189725_190055_-	AbrB family transcriptional regulator	NA	NA	NA	NA	NA
WP_002343821.1|190227_190908_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	98.7	1.3e-126
WP_002290394.1|191420_191738_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_002290397.1|191738_191993_-	AbrB family transcriptional regulator	NA	NA	NA	NA	NA
WP_029744575.1|192754_192937_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002326809.1|194508_195804_+|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	29.5	5.3e-44
WP_002326809.1|195948_197244_+|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	29.5	5.3e-44
WP_002326809.1|197388_198684_+|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	29.5	5.3e-44
>prophage 1
NZ_CP014531	Enterococcus faecium strain E745 plasmid pl2, complete sequence	32423	0	741	32423		Aeromonas_phage(100.0%)	1	NA	NA
WP_002332580.1|123_741_-	recombinase family protein	NA	A0A219YA40	Aeromonas_phage	36.1	4.5e-17
>prophage 2
NZ_CP014531	Enterococcus faecium strain E745 plasmid pl2, complete sequence	32423	4748	16119	32423	transposase	Streptococcus_phage(42.86%)	12	NA	NA
WP_002354485.1|4748_5435_+|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	2.0e-127
WP_000402347.1|5704_6313_-	D-Ala-D-Ala dipeptidase VanX-A	NA	NA	NA	NA	NA
WP_001079845.1|6318_7350_-	D-alanine--(R)-lactate ligase VanA	NA	NA	NA	NA	NA
WP_001059542.1|7342_8311_-	D-lactate dehydrogenase VanH-A	NA	M1HUW8	Acanthocystis_turfacea_Chlorella_virus	33.1	3.5e-40
WP_002305818.1|8525_9680_-	VanA-type vancomycin resistance histidine kinase VanS	NA	W8CYF6	Bacillus_phage	23.3	1.5e-13
WP_001280781.1|9657_10353_-	VanA-type vancomycin resistance DNA-binding response regulator VanR	NA	W8CYM9	Bacillus_phage	37.7	4.9e-36
WP_002354485.1|10467_11154_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	2.0e-127
WP_069972710.1|11185_11482_-	type III secretion system protein PrgN	NA	NA	NA	NA	NA
WP_000947691.1|11616_13110_-	replication protein RepR	NA	NA	NA	NA	NA
WP_000429439.1|13721_14675_+	ParA family protein	NA	F0PIG8	Enterococcus_phage	26.1	7.7e-16
WP_001196543.1|14646_14922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002354485.1|15432_16119_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	2.0e-127
>prophage 3
NZ_CP014531	Enterococcus faecium strain E745 plasmid pl2, complete sequence	32423	20417	27184	32423	transposase	Streptococcus_phage(50.0%)	6	NA	NA
WP_002354485.1|20417_21104_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	2.0e-127
WP_002354485.1|23162_23849_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	2.0e-127
WP_002321606.1|25375_25981_+	recombinase family protein	NA	A0A219YA40	Aeromonas_phage	33.2	1.2e-19
WP_000824191.1|26025_26193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000366408.1|26226_26526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001224538.1|26566_27184_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	33.1	5.1e-13
>prophage 1
NZ_CP014534	Enterococcus faecium strain E745 plasmid pl5, complete sequence	55167	0	9887	55167		Streptococcus_phage(66.67%)	7	NA	NA
WP_069972717.1|1586_3290_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069972718.1|3350_4811_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069972719.1|4821_7026_+	type IA DNA topoisomerase	NA	A0A1X9I6W8	Streptococcus_phage	51.2	2.1e-117
WP_002330563.1|7264_7858_+	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002322787.1|7873_8773_+	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_002296241.1|8775_9261_+	single-stranded DNA-binding protein	NA	W6LM61	Streptococcus_phage	59.9	3.4e-44
WP_002296240.1|9626_9887_+	hypothetical protein	NA	A0A0S2MYI8	Enterococcus_phage	51.4	3.4e-11
>prophage 2
NZ_CP014534	Enterococcus faecium strain E745 plasmid pl5, complete sequence	55167	13468	17872	55167		Clostridium_phage(33.33%)	5	NA	NA
WP_002318230.1|13468_14083_-	recombinase family protein	NA	M9Q1K0	Clostridium_phage	31.9	2.6e-17
WP_002319870.1|14532_15858_+	Y-family DNA polymerase	NA	M1Q231	Streptococcus_phage	43.6	1.2e-99
WP_002323028.1|15850_16201_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002326890.1|16416_16710_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002323027.1|17029_17872_+	ParA family protein	NA	F0PIG8	Enterococcus_phage	31.5	8.0e-25
>prophage 3
NZ_CP014534	Enterococcus faecium strain E745 plasmid pl5, complete sequence	55167	22235	22577	55167		Enterococcus_phage(100.0%)	1	NA	NA
WP_002314399.1|22235_22577_+	DUF5406 domain-containing protein	NA	F0PIH7	Enterococcus_phage	63.4	4.0e-36
>prophage 4
NZ_CP014534	Enterococcus faecium strain E745 plasmid pl5, complete sequence	55167	38327	40244	55167		Pseudomonas_phage(100.0%)	1	NA	NA
WP_002351219.1|38327_40244_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	27.6	8.4e-30
>prophage 1
NZ_CP014535	Enterococcus faecium strain E745 plasmid pl6, complete sequence	65558	0	2729	65558		Bacillus_virus(100.0%)	3	NA	NA
WP_002311819.1|403_967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002354451.1|953_1838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000868795.1|2231_2729_+	trimethoprim-resistant dihydrofolate reductase DfrG	NA	G3MBI7	Bacillus_virus	49.1	4.0e-40
>prophage 2
NZ_CP014535	Enterococcus faecium strain E745 plasmid pl6, complete sequence	65558	8967	14106	65558		Streptococcus_phage(100.0%)	5	NA	NA
WP_002311832.1|8967_11331_+	type IA DNA topoisomerase	NA	A0A1X9I6W8	Streptococcus_phage	33.4	6.0e-54
WP_002317408.1|11648_12248_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002311835.1|12359_12584_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002311837.1|12935_13172_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002311838.1|13251_14106_+	ParA family protein	NA	A0A1X9I765	Streptococcus_phage	31.4	6.4e-30
>prophage 3
NZ_CP014535	Enterococcus faecium strain E745 plasmid pl6, complete sequence	65558	30223	32140	65558		Pseudomonas_phage(100.0%)	1	NA	NA
WP_002351219.1|30223_32140_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	27.6	8.4e-30
>prophage 4
NZ_CP014535	Enterococcus faecium strain E745 plasmid pl6, complete sequence	65558	39453	40590	65558		Streptococcus_phage(100.0%)	1	NA	NA
WP_002311861.1|39453_40590_+	hypothetical protein	NA	A0A1S5SEZ8	Streptococcus_phage	39.3	1.6e-52
>prophage 5
NZ_CP014535	Enterococcus faecium strain E745 plasmid pl6, complete sequence	65558	48789	49863	65558		Brevibacillus_phage(100.0%)	1	NA	NA
WP_002311873.1|48789_49863_+	hypothetical protein	NA	A0A0K2CPF9	Brevibacillus_phage	36.5	2.1e-17
>prophage 6
NZ_CP014535	Enterococcus faecium strain E745 plasmid pl6, complete sequence	65558	55303	63383	65558	transposase	Streptococcus_phage(33.33%)	9	NA	NA
WP_002287659.1|55303_55657_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	38.7	5.7e-17
WP_002301317.1|55758_57306_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	28.9	1.7e-44
WP_002305129.1|58089_58467_-	antitoxin HicB	NA	A0A1X9I5X0	Streptococcus_phage	52.1	6.9e-29
WP_002305130.1|58512_58701_-	type II toxin-antitoxin system HicA family toxin	NA	A0A1X9I5T5	Streptococcus_phage	66.1	1.7e-15
WP_002305131.1|58871_59414_+	helix-turn-helix transcriptional regulator	NA	Q9AZH9	Lactococcus_phage	45.0	3.8e-12
WP_002305840.1|59608_60505_+	helix-turn-helix transcriptional regulator	NA	Q9AZH9	Lactococcus_phage	40.7	9.1e-11
WP_002305133.1|60553_61936_+	helix-turn-helix domain-containing protein	NA	I3VYY8	Thermoanaerobacterium_phage	32.2	5.9e-09
WP_002305134.1|61949_62732_+	helix-turn-helix domain-containing protein	NA	A0A1X9I5A1	Streptococcus_phage	35.2	5.0e-05
WP_002305817.1|62771_63383_+	recombinase family protein	NA	A0A1V0E035	Clostridioides_phage	39.2	3.4e-17
