The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP015933	Legionella pneumophila strain C2_S chromosome, complete genome	3404162	922904	929744	3404162		Acinetobacter_phage(42.86%)	9	NA	NA
WP_010946569.1|922904_923681_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	48.2	3.3e-57
WP_010946570.1|923673_924708_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	47.6	3.5e-75
WP_010946571.1|924685_925264_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	53.2	1.0e-55
WP_010946572.1|925297_926023_-	LPS export ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.3	3.1e-17
WP_010946573.1|926019_926529_-	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
WP_010946574.1|926509_927079_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_011213328.1|927075_927603_-	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	47.7	1.4e-27
WP_010946576.1|927616_928579_-	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	34.1	4.2e-38
WP_010946577.1|928946_929744_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	33.8	1.3e-21
>prophage 2
NZ_CP015933	Legionella pneumophila strain C2_S chromosome, complete genome	3404162	1312124	1318061	3404162		Staphylococcus_phage(50.0%)	6	NA	NA
WP_010946911.1|1312124_1313198_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	27.8	2.8e-30
WP_010946912.1|1313182_1313797_+	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	38.4	3.5e-22
WP_070071185.1|1313793_1315002_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.7	5.4e-99
WP_010946914.1|1315009_1315477_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	49.1	9.2e-23
WP_010946915.1|1315602_1317240_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	52.3	3.6e-154
WP_010946916.1|1317236_1318061_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	43.9	1.8e-53
>prophage 3
NZ_CP015933	Legionella pneumophila strain C2_S chromosome, complete genome	3404162	2221595	2231719	3404162		Bacillus_phage(16.67%)	7	NA	NA
WP_010947735.1|2221595_2223284_-	S8 family serine peptidase	NA	A0A1B0T6A2	Bacillus_phage	30.4	8.0e-16
WP_015444337.1|2223415_2224423_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_010947737.1|2224546_2225872_-	adenosylhomocysteinase	NA	S4VPF6	Pandoravirus	31.2	1.4e-47
WP_010947738.1|2225890_2227039_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	58.5	1.3e-126
WP_015444336.1|2227247_2228360_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	35.2	2.9e-51
WP_010947740.1|2228455_2229595_-	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	26.9	1.6e-23
WP_015444335.1|2229784_2231719_-	molecular chaperone DnaK	NA	G8DDB7	Micromonas_pusilla_virus	49.6	1.3e-147
>prophage 4
NZ_CP015933	Legionella pneumophila strain C2_S chromosome, complete genome	3404162	2273547	2328572	3404162	transposase	Wolbachia_phage(25.0%)	53	NA	NA
WP_010947782.1|2273547_2274999_+|transposase	IS4-like element ISLpn5 family transposase	transposase	Q9JMP3	Wolbachia_phage	56.8	6.1e-158
WP_010947783.1|2275069_2276590_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	48.2	7.9e-124
WP_010947785.1|2277437_2277812_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010947786.1|2278009_2279617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015444248.1|2279619_2280111_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010947788.1|2280121_2280958_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	48.9	4.9e-67
WP_010947789.1|2281550_2282642_-	DUF4917 family protein	NA	NA	NA	NA	NA
WP_010947790.1|2282873_2288819_-	conjugative transfer relaxase/helicase TraI	NA	NA	NA	NA	NA
WP_010947791.1|2288839_2290732_-	type IV conjugative transfer system coupling protein TraD	NA	NA	NA	NA	NA
WP_021437030.1|2290796_2291261_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015444244.1|2291264_2293985_-	conjugal transfer protein TraG N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_010947793.1|2293990_2295376_-	conjugal transfer protein TraH	NA	NA	NA	NA	NA
WP_010947794.1|2295372_2295795_-	type-F conjugative transfer system pilin assembly thiol-disulfide isomerase TrbB	NA	NA	NA	NA	NA
WP_010947795.1|2295784_2296567_-	type-F conjugative transfer system pilin assembly protein TraF	NA	NA	NA	NA	NA
WP_010947796.1|2296559_2298371_-	type-F conjugative transfer system mating-pair stabilization protein TraN	NA	NA	NA	NA	NA
WP_015444243.1|2298370_2299039_-	type-F conjugative transfer system pilin assembly protein TrbC	NA	NA	NA	NA	NA
WP_010947798.1|2299054_2300050_-	TraU family protein	NA	NA	NA	NA	NA
WP_010947799.1|2300046_2300655_-	type-F conjugative transfer system protein TraW	NA	NA	NA	NA	NA
WP_015444242.1|2300651_2300987_-	TrbI F-type domain-containing protein	NA	NA	NA	NA	NA
WP_015444241.1|2300979_2303532_-	type IV secretion system protein TraC	NA	NA	NA	NA	NA
WP_010947801.1|2303543_2303894_-	type IV conjugative transfer system lipoprotein TraV	NA	NA	NA	NA	NA
WP_015444240.1|2303907_2305194_-	TraB/VirB10 family protein	NA	NA	NA	NA	NA
WP_010947803.1|2305195_2305909_-	type-F conjugative transfer system secretin TraK	NA	NA	NA	NA	NA
WP_010947804.1|2305911_2306475_-	type IV conjugative transfer system protein TraE	NA	NA	NA	NA	NA
WP_010947805.1|2306478_2306772_-	type IV conjugative transfer system protein TraL	NA	NA	NA	NA	NA
WP_010947806.1|2306773_2307076_-	fimbrial protein	NA	NA	NA	NA	NA
WP_010947807.1|2307090_2307327_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	52.9	2.5e-08
WP_025520140.1|2307340_2307718_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010947808.1|2307665_2308550_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015444237.1|2308722_2309403_+	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	28.1	1.6e-07
WP_016356978.1|2309551_2310226_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_010947811.1|2310674_2311247_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_015444236.1|2311230_2311728_+	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_010947813.1|2311720_2312308_-	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_010947814.1|2312312_2314448_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_010947815.1|2314466_2315348_-	sterol desaturase family protein	NA	NA	NA	NA	NA
WP_010947816.1|2315454_2315601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010947817.1|2315792_2315969_+	MAPEG family protein	NA	NA	NA	NA	NA
WP_010947818.1|2316138_2316636_-	DoxX family protein	NA	NA	NA	NA	NA
WP_010947819.1|2316625_2317405_-	DUF2063 domain-containing protein	NA	NA	NA	NA	NA
WP_010947820.1|2317397_2318252_-	DUF692 domain-containing protein	NA	NA	NA	NA	NA
WP_010947821.1|2318266_2318560_-	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_010947822.1|2318749_2319271_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015444234.1|2319575_2320034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015444232.1|2320607_2320835_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010947824.1|2320992_2321514_-	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_010947825.1|2321685_2322240_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_010947826.1|2322673_2322874_+	ATP-dependent DNA helicase	NA	NA	NA	NA	NA
WP_010947827.1|2322967_2323351_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_010947828.1|2323404_2324358_-	Abi family protein	NA	A3QSC6	Clostridium_virus	31.8	4.8e-34
WP_015444229.1|2324867_2326286_+|transposase	IS4-like element ISLpn3 family transposase	transposase	Q9JMP3	Wolbachia_phage	32.9	2.3e-56
WP_010947829.1|2326318_2327494_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	21.2	5.2e-14
WP_010947830.1|2327546_2328572_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP015933	Legionella pneumophila strain C2_S chromosome, complete genome	3404162	2625721	2688990	3404162	protease,tRNA,transposase,integrase	Erysipelothrix_phage(18.75%)	57	2631629:2631675	2687661:2687707
WP_010948063.1|2625721_2626723_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	50.7	5.8e-91
WP_010948064.1|2626927_2627167_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_010948065.1|2627369_2627813_+	lpg2359 family Dot/Icm T4SS effector	NA	A0A292GL36	Xanthomonas_phage	43.8	6.3e-21
WP_014842314.1|2627821_2629555_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	35.5	4.6e-59
WP_011216252.1|2629641_2631507_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	32.8	1.3e-35
2631629:2631675	attL	CTCATAATCCGTTGGTCCTAGGTTCAAGTCCTAGTGGGCCCACCAAT	NA	NA	NA	NA
WP_187297743.1|2631765_2632893_-|integrase	site-specific integrase	integrase	A0A059VF45	Pseudomonas_phage	47.3	2.2e-86
WP_061466610.1|2633273_2633459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061466612.1|2633451_2634228_+	methylase	NA	NA	NA	NA	NA
WP_061634671.1|2634361_2635177_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061466974.1|2635218_2636529_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061466975.1|2636658_2638140_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	24.8	9.4e-29
WP_061466976.1|2638293_2638536_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061466977.1|2638770_2638965_+	helix-turn-helix domain-containing protein	NA	A0A1B1IUF9	uncultured_Mediterranean_phage	60.3	4.8e-18
WP_061634672.1|2638992_2642268_+	DEAD/DEAH box helicase family protein	NA	A0A2K5B2B9	Erysipelothrix_phage	42.8	4.8e-235
WP_061466985.1|2642260_2642923_+	DUF4391 domain-containing protein	NA	NA	NA	NA	NA
WP_061634673.1|2642942_2644898_+	site-specific DNA-methyltransferase	NA	A0A2K5B2C1	Erysipelothrix_phage	36.1	2.0e-103
WP_061466981.1|2644915_2647948_+	DEAD/DEAH box helicase family protein	NA	A0A2K5B2C2	Erysipelothrix_phage	33.4	1.7e-130
WP_061634674.1|2648023_2649823_+	DUF4209 domain-containing protein	NA	NA	NA	NA	NA
WP_061466952.1|2649819_2650503_-	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	33.3	6.5e-17
WP_061466938.1|2650704_2651589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042234550.1|2651608_2651920_+	Vir protein	NA	NA	NA	NA	NA
WP_042234461.1|2651936_2652209_+	carbon storage regulator	NA	A0A0U1UNS3	Pseudomonas_phage	41.8	5.0e-05
WP_042234463.1|2652236_2653202_+	P-type conjugative transfer ATPase TrbB	NA	NA	NA	NA	NA
WP_042234466.1|2653213_2653591_+	TrbC/VirB2 family protein	NA	NA	NA	NA	NA
WP_061466939.1|2653587_2653887_+	VirB3 family type IV secretion system protein	NA	NA	NA	NA	NA
WP_061466940.1|2653883_2656418_+	conjugal transfer protein TrbE	NA	NA	NA	NA	NA
WP_061466941.1|2656414_2657113_+	conjugal transfer protein TrbF	NA	NA	NA	NA	NA
WP_061466942.1|2657109_2657985_+	P-type conjugative transfer protein TrbG	NA	NA	NA	NA	NA
WP_061466943.1|2657987_2658395_+	conjugal transfer protein TrbH	NA	NA	NA	NA	NA
WP_061466944.1|2658400_2659648_+	TrbI/VirB10 family protein	NA	NA	NA	NA	NA
WP_061466945.1|2659659_2660400_+	P-type conjugative transfer protein TrbJ	NA	NA	NA	NA	NA
WP_061466946.1|2660422_2660635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061466947.1|2660639_2662022_+	P-type conjugative transfer protein TrbL	NA	NA	NA	NA	NA
WP_061466948.1|2662018_2663908_+	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_061466949.1|2663904_2664450_+	conjugative transfer signal peptidase TraF	NA	NA	NA	NA	NA
WP_187297749.1|2664446_2664611_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061466950.1|2664603_2666790_+	DUF1738 domain-containing protein	NA	A0A1B1IRD0	uncultured_Mediterranean_phage	33.9	1.1e-36
WP_061634675.1|2666919_2668515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061466916.1|2668824_2670687_-	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_058450394.1|2670683_2671037_-	conjugal transfer transcriptional regulator TraJ	NA	NA	NA	NA	NA
WP_058450393.1|2671430_2671775_+	TraK family protein	NA	NA	NA	NA	NA
WP_070071199.1|2671774_2672500_+	conjugal transfer protein TraL	NA	NA	NA	NA	NA
WP_061466918.1|2672499_2672937_+	conjugal transfer protein TraM	NA	NA	NA	NA	NA
WP_061466920.1|2673184_2674246_-	DUF4116 domain-containing protein	NA	NA	NA	NA	NA
WP_080444600.1|2674668_2676303_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_040146985.1|2676257_2676650_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_058450390.1|2677131_2677374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061466923.1|2677616_2679557_+	DUF2779 domain-containing protein	NA	NA	NA	NA	NA
WP_044496813.1|2679636_2680488_-	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_044496821.1|2680484_2681093_-	AbiEi antitoxin N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_058450388.1|2681900_2682305_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	33.1	1.1e-08
WP_080444601.1|2682262_2682388_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_044496812.1|2682512_2683565_+	LD-carboxypeptidase	NA	NA	NA	NA	NA
WP_061466925.1|2683571_2684789_-	MFS transporter	NA	NA	NA	NA	NA
WP_052585449.1|2684818_2685865_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A223W0B1	Agrobacterium_phage	32.4	1.5e-25
WP_061466927.1|2685866_2686931_-	ThiF family adenylyltransferase	NA	NA	NA	NA	NA
WP_015444121.1|2687814_2688990_-|transposase	ISL3 family transposase	transposase	A9YX10	Burkholderia_phage	23.2	3.8e-17
2687661:2687707	attR	CTCATAATCCGTTGGTCCTAGGTTCAAGTCCTAGTGGGCCCACCAAT	NA	NA	NA	NA
