The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP015935	Legionella pneumophila strain C4_S chromosome, complete genome	3409361	914744	921584	3409361		Acinetobacter_phage(42.86%)	9	NA	NA
WP_010946569.1|914744_915521_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	48.2	3.3e-57
WP_010946570.1|915513_916548_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	47.6	3.5e-75
WP_010946571.1|916525_917104_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	53.2	1.0e-55
WP_010946572.1|917137_917863_-	LPS export ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.3	3.1e-17
WP_010946573.1|917859_918369_-	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
WP_010946574.1|918349_918919_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_011213328.1|918915_919443_-	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	47.7	1.4e-27
WP_010946576.1|919456_920419_-	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	34.1	4.2e-38
WP_010946577.1|920786_921584_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	33.8	1.3e-21
>prophage 2
NZ_CP015935	Legionella pneumophila strain C4_S chromosome, complete genome	3409361	1304216	1310153	3409361		Staphylococcus_phage(50.0%)	6	NA	NA
WP_010946911.1|1304216_1305290_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	27.8	2.8e-30
WP_010946912.1|1305274_1305889_+	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	38.4	3.5e-22
WP_010946913.1|1305885_1307094_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.7	5.4e-99
WP_010946914.1|1307101_1307569_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	49.1	9.2e-23
WP_010946915.1|1307694_1309332_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	52.3	3.6e-154
WP_010946916.1|1309328_1310153_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	43.9	1.8e-53
>prophage 3
NZ_CP015935	Legionella pneumophila strain C4_S chromosome, complete genome	3409361	2213692	2223816	3409361		Bacillus_phage(16.67%)	7	NA	NA
WP_010947735.1|2213692_2215381_-	S8 family serine peptidase	NA	A0A1B0T6A2	Bacillus_phage	30.4	8.0e-16
WP_015444337.1|2215512_2216520_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_010947737.1|2216643_2217969_-	adenosylhomocysteinase	NA	S4VPF6	Pandoravirus	31.2	1.4e-47
WP_010947738.1|2217987_2219136_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	58.5	1.3e-126
WP_015444336.1|2219344_2220457_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	35.2	2.9e-51
WP_010947740.1|2220552_2221692_-	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	26.9	1.6e-23
WP_015444335.1|2221881_2223816_-	molecular chaperone DnaK	NA	G8DDB7	Micromonas_pusilla_virus	49.6	1.3e-147
>prophage 4
NZ_CP015935	Legionella pneumophila strain C4_S chromosome, complete genome	3409361	2265644	2320669	3409361	transposase	Wolbachia_phage(25.0%)	53	NA	NA
WP_010947782.1|2265644_2267096_+|transposase	IS4-like element ISLpn5 family transposase	transposase	Q9JMP3	Wolbachia_phage	56.8	6.1e-158
WP_010947783.1|2267166_2268687_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	48.2	7.9e-124
WP_010947785.1|2269534_2269909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010947786.1|2270106_2271714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015444248.1|2271716_2272208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010947788.1|2272218_2273055_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	48.9	4.9e-67
WP_010947789.1|2273647_2274739_-	DUF4917 family protein	NA	NA	NA	NA	NA
WP_010947790.1|2274970_2280916_-	conjugative transfer relaxase/helicase TraI	NA	NA	NA	NA	NA
WP_010947791.1|2280936_2282829_-	type IV conjugative transfer system coupling protein TraD	NA	NA	NA	NA	NA
WP_021437030.1|2282893_2283358_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015444244.1|2283361_2286082_-	conjugal transfer protein TraG N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_010947793.1|2286087_2287473_-	conjugal transfer protein TraH	NA	NA	NA	NA	NA
WP_010947794.1|2287469_2287892_-	type-F conjugative transfer system pilin assembly thiol-disulfide isomerase TrbB	NA	NA	NA	NA	NA
WP_010947795.1|2287881_2288664_-	type-F conjugative transfer system pilin assembly protein TraF	NA	NA	NA	NA	NA
WP_010947796.1|2288656_2290468_-	type-F conjugative transfer system mating-pair stabilization protein TraN	NA	NA	NA	NA	NA
WP_015444243.1|2290467_2291136_-	type-F conjugative transfer system pilin assembly protein TrbC	NA	NA	NA	NA	NA
WP_010947798.1|2291151_2292147_-	TraU family protein	NA	NA	NA	NA	NA
WP_010947799.1|2292143_2292752_-	type-F conjugative transfer system protein TraW	NA	NA	NA	NA	NA
WP_027223818.1|2292748_2293090_-	TrbI F-type domain-containing protein	NA	NA	NA	NA	NA
WP_015444241.1|2293076_2295629_-	type IV secretion system protein TraC	NA	NA	NA	NA	NA
WP_010947801.1|2295640_2295991_-	type IV conjugative transfer system lipoprotein TraV	NA	NA	NA	NA	NA
WP_015444240.1|2296004_2297291_-	TraB/VirB10 family protein	NA	NA	NA	NA	NA
WP_010947803.1|2297292_2298006_-	type-F conjugative transfer system secretin TraK	NA	NA	NA	NA	NA
WP_010947804.1|2298008_2298572_-	type IV conjugative transfer system protein TraE	NA	NA	NA	NA	NA
WP_010947805.1|2298575_2298869_-	type IV conjugative transfer system protein TraL	NA	NA	NA	NA	NA
WP_010947806.1|2298870_2299173_-	fimbrial protein	NA	NA	NA	NA	NA
WP_010947807.1|2299187_2299424_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	52.9	2.5e-08
WP_025520140.1|2299437_2299815_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010947808.1|2299762_2300647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015444237.1|2300819_2301500_+	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	28.1	1.6e-07
WP_016356978.1|2301648_2302323_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_010947811.1|2302771_2303344_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_015444236.1|2303327_2303825_+	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_010947813.1|2303817_2304405_-	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_010947814.1|2304409_2306545_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_010947815.1|2306563_2307445_-	sterol desaturase family protein	NA	NA	NA	NA	NA
WP_010947816.1|2307551_2307698_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010947817.1|2307889_2308066_+	MAPEG family protein	NA	NA	NA	NA	NA
WP_010947818.1|2308235_2308733_-	DoxX family protein	NA	NA	NA	NA	NA
WP_010947819.1|2308722_2309502_-	DUF2063 domain-containing protein	NA	NA	NA	NA	NA
WP_010947820.1|2309494_2310349_-	DUF692 domain-containing protein	NA	NA	NA	NA	NA
WP_010947821.1|2310363_2310657_-	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_010947822.1|2310846_2311368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015444234.1|2311672_2312131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015444232.1|2312704_2312932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010947824.1|2313089_2313611_-	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_010947825.1|2313782_2314337_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_010947826.1|2314770_2314971_+	ATP-dependent DNA helicase	NA	NA	NA	NA	NA
WP_010947827.1|2315064_2315448_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_010947828.1|2315501_2316455_-	Abi family protein	NA	A3QSC6	Clostridium_virus	31.8	4.8e-34
WP_015444229.1|2316964_2318383_+|transposase	IS4-like element ISLpn3 family transposase	transposase	Q9JMP3	Wolbachia_phage	32.9	2.3e-56
WP_010947829.1|2318415_2319591_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	21.2	5.2e-14
WP_010947830.1|2319643_2320669_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP015935	Legionella pneumophila strain C4_S chromosome, complete genome	3409361	2617816	2681085	3409361	tRNA,transposase,integrase,protease	Erysipelothrix_phage(18.75%)	57	2623724:2623770	2679756:2679802
WP_010948063.1|2617816_2618818_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	50.7	5.8e-91
WP_010948064.1|2619022_2619262_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_010948065.1|2619464_2619908_+	lpg2359 family Dot/Icm T4SS effector	NA	A0A292GL36	Xanthomonas_phage	43.8	6.3e-21
WP_014842314.1|2619916_2621650_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	35.5	4.6e-59
WP_011216252.1|2621736_2623602_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	32.8	1.3e-35
2623724:2623770	attL	CTCATAATCCGTTGGTCCTAGGTTCAAGTCCTAGTGGGCCCACCAAT	NA	NA	NA	NA
WP_187297743.1|2623860_2624988_-|integrase	site-specific integrase	integrase	A0A059VF45	Pseudomonas_phage	47.3	2.2e-86
WP_061466610.1|2625368_2625554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061466612.1|2625546_2626323_+	methylase	NA	NA	NA	NA	NA
WP_061634671.1|2626456_2627272_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061466974.1|2627313_2628624_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061466975.1|2628753_2630235_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	24.8	9.4e-29
WP_061466976.1|2630388_2630631_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061466977.1|2630865_2631060_+	helix-turn-helix domain-containing protein	NA	A0A1B1IUF9	uncultured_Mediterranean_phage	60.3	4.8e-18
WP_061634672.1|2631087_2634363_+	DEAD/DEAH box helicase family protein	NA	A0A2K5B2B9	Erysipelothrix_phage	42.8	4.8e-235
WP_061466985.1|2634355_2635018_+	DUF4391 domain-containing protein	NA	NA	NA	NA	NA
WP_061634673.1|2635037_2636993_+	site-specific DNA-methyltransferase	NA	A0A2K5B2C1	Erysipelothrix_phage	36.1	2.0e-103
WP_061466981.1|2637010_2640043_+	DEAD/DEAH box helicase family protein	NA	A0A2K5B2C2	Erysipelothrix_phage	33.4	1.7e-130
WP_061634674.1|2640118_2641918_+	DUF4209 domain-containing protein	NA	NA	NA	NA	NA
WP_061466952.1|2641914_2642598_-	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	33.3	6.5e-17
WP_061466938.1|2642799_2643684_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042234550.1|2643703_2644015_+	Vir protein	NA	NA	NA	NA	NA
WP_042234461.1|2644031_2644304_+	carbon storage regulator	NA	A0A0U1UNS3	Pseudomonas_phage	41.8	5.0e-05
WP_042234463.1|2644331_2645297_+	P-type conjugative transfer ATPase TrbB	NA	NA	NA	NA	NA
WP_042234466.1|2645308_2645686_+	TrbC/VirB2 family protein	NA	NA	NA	NA	NA
WP_061466939.1|2645682_2645982_+	VirB3 family type IV secretion system protein	NA	NA	NA	NA	NA
WP_061466940.1|2645978_2648513_+	conjugal transfer protein TrbE	NA	NA	NA	NA	NA
WP_061466941.1|2648509_2649208_+	conjugal transfer protein TrbF	NA	NA	NA	NA	NA
WP_061466942.1|2649204_2650080_+	P-type conjugative transfer protein TrbG	NA	NA	NA	NA	NA
WP_061466943.1|2650082_2650490_+	conjugal transfer protein TrbH	NA	NA	NA	NA	NA
WP_061466944.1|2650495_2651743_+	TrbI/VirB10 family protein	NA	NA	NA	NA	NA
WP_061466945.1|2651754_2652495_+	P-type conjugative transfer protein TrbJ	NA	NA	NA	NA	NA
WP_061466946.1|2652517_2652730_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061466947.1|2652734_2654117_+	P-type conjugative transfer protein TrbL	NA	NA	NA	NA	NA
WP_061466948.1|2654113_2656003_+	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_061466949.1|2655999_2656545_+	conjugative transfer signal peptidase TraF	NA	NA	NA	NA	NA
WP_187297749.1|2656541_2656706_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061466950.1|2656698_2658885_+	DUF1738 domain-containing protein	NA	A0A1B1IRD0	uncultured_Mediterranean_phage	33.9	1.1e-36
WP_061634675.1|2659014_2660610_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061466916.1|2660919_2662782_-	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_058450394.1|2662778_2663132_-	conjugal transfer transcriptional regulator TraJ	NA	NA	NA	NA	NA
WP_058450393.1|2663525_2663870_+	TraK family protein	NA	NA	NA	NA	NA
WP_058450392.1|2663869_2664595_+	conjugal transfer protein TraL	NA	NA	NA	NA	NA
WP_061466918.1|2664594_2665032_+	conjugal transfer protein TraM	NA	NA	NA	NA	NA
WP_061466920.1|2665279_2666341_-	DUF4116 domain-containing protein	NA	NA	NA	NA	NA
WP_080444600.1|2666763_2668398_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_040146985.1|2668352_2668745_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_058450390.1|2669226_2669469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061466923.1|2669711_2671652_+	DUF2779 domain-containing protein	NA	NA	NA	NA	NA
WP_044496813.1|2671731_2672583_-	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_044496821.1|2672579_2673188_-	AbiEi antitoxin N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_058450388.1|2673995_2674400_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	33.1	1.1e-08
WP_080444601.1|2674357_2674483_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_044496812.1|2674607_2675660_+	LD-carboxypeptidase	NA	NA	NA	NA	NA
WP_061466925.1|2675666_2676884_-	MFS transporter	NA	NA	NA	NA	NA
WP_052585449.1|2676913_2677960_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A223W0B1	Agrobacterium_phage	32.4	1.5e-25
WP_061466927.1|2677961_2679026_-	ThiF family adenylyltransferase	NA	NA	NA	NA	NA
WP_015444121.1|2679909_2681085_-|transposase	ISL3 family transposase	transposase	A9YX10	Burkholderia_phage	23.2	3.8e-17
2679756:2679802	attR	CTCATAATCCGTTGGTCCTAGGTTCAAGTCCTAGTGGGCCCACCAAT	NA	NA	NA	NA
