The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP015936	Legionella pneumophila strain C5_P chromosome, complete genome	3419720	923879	930719	3419720		Acinetobacter_phage(42.86%)	9	NA	NA
WP_010946569.1|923879_924656_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	48.2	3.3e-57
WP_010946570.1|924648_925683_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	47.6	3.5e-75
WP_010946571.1|925660_926239_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	53.2	1.0e-55
WP_010946572.1|926272_926998_-	LPS export ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.3	3.1e-17
WP_010946573.1|926994_927504_-	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
WP_010946574.1|927484_928054_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_011213328.1|928050_928578_-	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	47.7	1.4e-27
WP_010946576.1|928591_929554_-	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	34.1	4.2e-38
WP_010946577.1|929921_930719_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	33.8	1.3e-21
>prophage 2
NZ_CP015936	Legionella pneumophila strain C5_P chromosome, complete genome	3419720	1313278	1319215	3419720		Staphylococcus_phage(50.0%)	6	NA	NA
WP_010946911.1|1313278_1314352_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	27.8	2.8e-30
WP_010946912.1|1314336_1314951_+	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	38.4	3.5e-22
WP_010946913.1|1314947_1316156_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.7	5.4e-99
WP_010946914.1|1316163_1316631_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	49.1	9.2e-23
WP_010946915.1|1316756_1318394_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	52.3	3.6e-154
WP_010946916.1|1318390_1319215_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	43.9	1.8e-53
>prophage 3
NZ_CP015936	Legionella pneumophila strain C5_P chromosome, complete genome	3419720	2224048	2234172	3419720		Bacillus_phage(16.67%)	7	NA	NA
WP_010947735.1|2224048_2225737_-	S8 family serine peptidase	NA	A0A1B0T6A2	Bacillus_phage	30.4	8.0e-16
WP_015444337.1|2225868_2226876_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_010947737.1|2226999_2228325_-	adenosylhomocysteinase	NA	S4VPF6	Pandoravirus	31.2	1.4e-47
WP_010947738.1|2228343_2229492_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	58.5	1.3e-126
WP_070065786.1|2229700_2230813_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	34.9	1.9e-50
WP_010947740.1|2230908_2232048_-	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	26.9	1.6e-23
WP_015444335.1|2232237_2234172_-	molecular chaperone DnaK	NA	G8DDB7	Micromonas_pusilla_virus	49.6	1.3e-147
>prophage 4
NZ_CP015936	Legionella pneumophila strain C5_P chromosome, complete genome	3419720	2276000	2331025	3419720	transposase	Wolbachia_phage(25.0%)	53	NA	NA
WP_010947782.1|2276000_2277452_+|transposase	IS4-like element ISLpn5 family transposase	transposase	Q9JMP3	Wolbachia_phage	56.8	6.1e-158
WP_010947783.1|2277522_2279043_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	48.2	7.9e-124
WP_010947785.1|2279890_2280265_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010947786.1|2280462_2282070_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015444248.1|2282072_2282564_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010947788.1|2282574_2283411_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	48.9	4.9e-67
WP_010947789.1|2284003_2285095_-	DUF4917 family protein	NA	NA	NA	NA	NA
WP_010947790.1|2285326_2291272_-	conjugative transfer relaxase/helicase TraI	NA	NA	NA	NA	NA
WP_010947791.1|2291292_2293185_-	type IV conjugative transfer system coupling protein TraD	NA	NA	NA	NA	NA
WP_021437030.1|2293249_2293714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015444244.1|2293717_2296438_-	conjugal transfer protein TraG N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_010947793.1|2296443_2297829_-	conjugal transfer protein TraH	NA	NA	NA	NA	NA
WP_010947794.1|2297825_2298248_-	type-F conjugative transfer system pilin assembly thiol-disulfide isomerase TrbB	NA	NA	NA	NA	NA
WP_010947795.1|2298237_2299020_-	type-F conjugative transfer system pilin assembly protein TraF	NA	NA	NA	NA	NA
WP_010947796.1|2299012_2300824_-	type-F conjugative transfer system mating-pair stabilization protein TraN	NA	NA	NA	NA	NA
WP_015444243.1|2300823_2301492_-	type-F conjugative transfer system pilin assembly protein TrbC	NA	NA	NA	NA	NA
WP_010947798.1|2301507_2302503_-	TraU family protein	NA	NA	NA	NA	NA
WP_010947799.1|2302499_2303108_-	type-F conjugative transfer system protein TraW	NA	NA	NA	NA	NA
WP_027223818.1|2303104_2303446_-	TrbI F-type domain-containing protein	NA	NA	NA	NA	NA
WP_015444241.1|2303432_2305985_-	type IV secretion system protein TraC	NA	NA	NA	NA	NA
WP_010947801.1|2305996_2306347_-	type IV conjugative transfer system lipoprotein TraV	NA	NA	NA	NA	NA
WP_015444240.1|2306360_2307647_-	TraB/VirB10 family protein	NA	NA	NA	NA	NA
WP_010947803.1|2307648_2308362_-	type-F conjugative transfer system secretin TraK	NA	NA	NA	NA	NA
WP_010947804.1|2308364_2308928_-	type IV conjugative transfer system protein TraE	NA	NA	NA	NA	NA
WP_010947805.1|2308931_2309225_-	type IV conjugative transfer system protein TraL	NA	NA	NA	NA	NA
WP_010947806.1|2309226_2309529_-	fimbrial protein	NA	NA	NA	NA	NA
WP_010947807.1|2309543_2309780_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	52.9	2.5e-08
WP_025520140.1|2309793_2310171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010947808.1|2310118_2311003_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015444237.1|2311175_2311856_+	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	28.1	1.6e-07
WP_016356978.1|2312004_2312679_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_010947811.1|2313127_2313700_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_015444236.1|2313683_2314181_+	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_010947813.1|2314173_2314761_-	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_010947814.1|2314765_2316901_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_010947815.1|2316919_2317801_-	sterol desaturase family protein	NA	NA	NA	NA	NA
WP_010947816.1|2317907_2318054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010947817.1|2318245_2318422_+	MAPEG family protein	NA	NA	NA	NA	NA
WP_010947818.1|2318591_2319089_-	DoxX family protein	NA	NA	NA	NA	NA
WP_010947819.1|2319078_2319858_-	DUF2063 domain-containing protein	NA	NA	NA	NA	NA
WP_010947820.1|2319850_2320705_-	DUF692 domain-containing protein	NA	NA	NA	NA	NA
WP_010947821.1|2320719_2321013_-	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_010947822.1|2321202_2321724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015444234.1|2322028_2322487_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015444232.1|2323060_2323288_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010947824.1|2323445_2323967_-	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_010947825.1|2324138_2324693_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_010947826.1|2325126_2325327_+	ATP-dependent DNA helicase	NA	NA	NA	NA	NA
WP_010947827.1|2325420_2325804_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_010947828.1|2325857_2326811_-	Abi family protein	NA	A3QSC6	Clostridium_virus	31.8	4.8e-34
WP_015444229.1|2327320_2328739_+|transposase	IS4-like element ISLpn3 family transposase	transposase	Q9JMP3	Wolbachia_phage	32.9	2.3e-56
WP_010947829.1|2328771_2329947_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	21.2	5.2e-14
WP_010947830.1|2329999_2331025_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP015936	Legionella pneumophila strain C5_P chromosome, complete genome	3419720	2628173	2691442	3419720	protease,integrase,transposase,tRNA	Erysipelothrix_phage(18.75%)	57	2634081:2634127	2690113:2690159
WP_010948063.1|2628173_2629175_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	50.7	5.8e-91
WP_010948064.1|2629379_2629619_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_010948065.1|2629821_2630265_+	lpg2359 family Dot/Icm T4SS effector	NA	A0A292GL36	Xanthomonas_phage	43.8	6.3e-21
WP_014842314.1|2630273_2632007_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	35.5	4.6e-59
WP_011216252.1|2632093_2633959_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	32.8	1.3e-35
2634081:2634127	attL	CTCATAATCCGTTGGTCCTAGGTTCAAGTCCTAGTGGGCCCACCAAT	NA	NA	NA	NA
WP_187297743.1|2634217_2635345_-|integrase	site-specific integrase	integrase	A0A059VF45	Pseudomonas_phage	47.3	2.2e-86
WP_061466610.1|2635725_2635911_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061466612.1|2635903_2636680_+	methylase	NA	NA	NA	NA	NA
WP_061634671.1|2636813_2637629_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061466974.1|2637670_2638981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061466975.1|2639110_2640592_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	24.8	9.4e-29
WP_061466976.1|2640745_2640988_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061466977.1|2641222_2641417_+	helix-turn-helix domain-containing protein	NA	A0A1B1IUF9	uncultured_Mediterranean_phage	60.3	4.8e-18
WP_061634672.1|2641444_2644720_+	DEAD/DEAH box helicase family protein	NA	A0A2K5B2B9	Erysipelothrix_phage	42.8	4.8e-235
WP_061466985.1|2644712_2645375_+	DUF4391 domain-containing protein	NA	NA	NA	NA	NA
WP_061634673.1|2645394_2647350_+	site-specific DNA-methyltransferase	NA	A0A2K5B2C1	Erysipelothrix_phage	36.1	2.0e-103
WP_061466981.1|2647367_2650400_+	DEAD/DEAH box helicase family protein	NA	A0A2K5B2C2	Erysipelothrix_phage	33.4	1.7e-130
WP_061634674.1|2650475_2652275_+	DUF4209 domain-containing protein	NA	NA	NA	NA	NA
WP_061466952.1|2652271_2652955_-	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	33.3	6.5e-17
WP_061466938.1|2653156_2654041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042234550.1|2654060_2654372_+	Vir protein	NA	NA	NA	NA	NA
WP_042234461.1|2654388_2654661_+	carbon storage regulator	NA	A0A0U1UNS3	Pseudomonas_phage	41.8	5.0e-05
WP_042234463.1|2654688_2655654_+	P-type conjugative transfer ATPase TrbB	NA	NA	NA	NA	NA
WP_042234466.1|2655665_2656043_+	TrbC/VirB2 family protein	NA	NA	NA	NA	NA
WP_061466939.1|2656039_2656339_+	VirB3 family type IV secretion system protein	NA	NA	NA	NA	NA
WP_061466940.1|2656335_2658870_+	conjugal transfer protein TrbE	NA	NA	NA	NA	NA
WP_061466941.1|2658866_2659565_+	conjugal transfer protein TrbF	NA	NA	NA	NA	NA
WP_061466942.1|2659561_2660437_+	P-type conjugative transfer protein TrbG	NA	NA	NA	NA	NA
WP_061466943.1|2660439_2660847_+	conjugal transfer protein TrbH	NA	NA	NA	NA	NA
WP_061466944.1|2660852_2662100_+	TrbI/VirB10 family protein	NA	NA	NA	NA	NA
WP_061466945.1|2662111_2662852_+	P-type conjugative transfer protein TrbJ	NA	NA	NA	NA	NA
WP_061466946.1|2662874_2663087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061466947.1|2663091_2664474_+	P-type conjugative transfer protein TrbL	NA	NA	NA	NA	NA
WP_061466948.1|2664470_2666360_+	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_061466949.1|2666356_2666902_+	conjugative transfer signal peptidase TraF	NA	NA	NA	NA	NA
WP_187297749.1|2666898_2667063_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061466950.1|2667055_2669242_+	DUF1738 domain-containing protein	NA	A0A1B1IRD0	uncultured_Mediterranean_phage	33.9	1.1e-36
WP_061634675.1|2669371_2670967_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061466916.1|2671276_2673139_-	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_058450394.1|2673135_2673489_-	conjugal transfer transcriptional regulator TraJ	NA	NA	NA	NA	NA
WP_058450393.1|2673882_2674227_+	TraK family protein	NA	NA	NA	NA	NA
WP_058450392.1|2674226_2674952_+	conjugal transfer protein TraL	NA	NA	NA	NA	NA
WP_061466918.1|2674951_2675389_+	conjugal transfer protein TraM	NA	NA	NA	NA	NA
WP_061466920.1|2675636_2676698_-	DUF4116 domain-containing protein	NA	NA	NA	NA	NA
WP_080444600.1|2677120_2678755_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_040146985.1|2678709_2679102_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_058450390.1|2679583_2679826_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061466923.1|2680068_2682009_+	DUF2779 domain-containing protein	NA	NA	NA	NA	NA
WP_044496813.1|2682088_2682940_-	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_044496821.1|2682936_2683545_-	AbiEi antitoxin N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_058450388.1|2684352_2684757_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	33.1	1.1e-08
WP_080444601.1|2684714_2684840_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_044496812.1|2684964_2686017_+	LD-carboxypeptidase	NA	NA	NA	NA	NA
WP_061466925.1|2686023_2687241_-	MFS transporter	NA	NA	NA	NA	NA
WP_052585449.1|2687270_2688317_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A223W0B1	Agrobacterium_phage	32.4	1.5e-25
WP_061466927.1|2688318_2689383_-	ThiF family adenylyltransferase	NA	NA	NA	NA	NA
WP_015444121.1|2690266_2691442_-|transposase	ISL3 family transposase	transposase	A9YX10	Burkholderia_phage	23.2	3.8e-17
2690113:2690159	attR	CTCATAATCCGTTGGTCCTAGGTTCAAGTCCTAGTGGGCCCACCAAT	NA	NA	NA	NA
