The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP015937	Legionella pneumophila strain C6_S chromosome, complete genome	3404196	922905	929745	3404196		Acinetobacter_phage(42.86%)	9	NA	NA
WP_010946569.1|922905_923682_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	48.2	3.3e-57
WP_010946570.1|923674_924709_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	47.6	3.5e-75
WP_010946571.1|924686_925265_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	53.2	1.0e-55
WP_010946572.1|925298_926024_-	LPS export ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.3	3.1e-17
WP_010946573.1|926020_926530_-	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
WP_010946574.1|926510_927080_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_011213328.1|927076_927604_-	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	47.7	1.4e-27
WP_010946576.1|927617_928580_-	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	34.1	4.2e-38
WP_010946577.1|928947_929745_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	33.8	1.3e-21
>prophage 2
NZ_CP015937	Legionella pneumophila strain C6_S chromosome, complete genome	3404196	1312125	1318062	3404196		Staphylococcus_phage(50.0%)	6	NA	NA
WP_010946911.1|1312125_1313199_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	27.8	2.8e-30
WP_010946912.1|1313183_1313798_+	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	38.4	3.5e-22
WP_010946913.1|1313794_1315003_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.7	5.4e-99
WP_010946914.1|1315010_1315478_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	49.1	9.2e-23
WP_010946915.1|1315603_1317241_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	52.3	3.6e-154
WP_010946916.1|1317237_1318062_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	43.9	1.8e-53
>prophage 3
NZ_CP015937	Legionella pneumophila strain C6_S chromosome, complete genome	3404196	2221598	2231722	3404196		Bacillus_phage(16.67%)	7	NA	NA
WP_010947735.1|2221598_2223287_-	S8 family serine peptidase	NA	A0A1B0T6A2	Bacillus_phage	30.4	8.0e-16
WP_015444337.1|2223418_2224426_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_010947737.1|2224549_2225875_-	adenosylhomocysteinase	NA	S4VPF6	Pandoravirus	31.2	1.4e-47
WP_010947738.1|2225893_2227042_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	58.5	1.3e-126
WP_015444336.1|2227250_2228363_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	35.2	2.9e-51
WP_010947740.1|2228458_2229598_-	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	26.9	1.6e-23
WP_015444335.1|2229787_2231722_-	molecular chaperone DnaK	NA	G8DDB7	Micromonas_pusilla_virus	49.6	1.3e-147
>prophage 4
NZ_CP015937	Legionella pneumophila strain C6_S chromosome, complete genome	3404196	2273550	2328575	3404196	transposase	Wolbachia_phage(25.0%)	53	NA	NA
WP_010947782.1|2273550_2275002_+|transposase	IS4-like element ISLpn5 family transposase	transposase	Q9JMP3	Wolbachia_phage	56.8	6.1e-158
WP_010947783.1|2275072_2276593_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	48.2	7.9e-124
WP_010947785.1|2277440_2277815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010947786.1|2278012_2279620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015444248.1|2279622_2280114_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010947788.1|2280124_2280961_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	48.9	4.9e-67
WP_010947789.1|2281553_2282645_-	DUF4917 family protein	NA	NA	NA	NA	NA
WP_010947790.1|2282876_2288822_-	conjugative transfer relaxase/helicase TraI	NA	NA	NA	NA	NA
WP_010947791.1|2288842_2290735_-	type IV conjugative transfer system coupling protein TraD	NA	NA	NA	NA	NA
WP_021437030.1|2290799_2291264_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015444244.1|2291267_2293988_-	conjugal transfer protein TraG N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_010947793.1|2293993_2295379_-	conjugal transfer protein TraH	NA	NA	NA	NA	NA
WP_010947794.1|2295375_2295798_-	type-F conjugative transfer system pilin assembly thiol-disulfide isomerase TrbB	NA	NA	NA	NA	NA
WP_010947795.1|2295787_2296570_-	type-F conjugative transfer system pilin assembly protein TraF	NA	NA	NA	NA	NA
WP_010947796.1|2296562_2298374_-	type-F conjugative transfer system mating-pair stabilization protein TraN	NA	NA	NA	NA	NA
WP_015444243.1|2298373_2299042_-	type-F conjugative transfer system pilin assembly protein TrbC	NA	NA	NA	NA	NA
WP_010947798.1|2299057_2300053_-	TraU family protein	NA	NA	NA	NA	NA
WP_010947799.1|2300049_2300658_-	type-F conjugative transfer system protein TraW	NA	NA	NA	NA	NA
WP_015444242.1|2300654_2300990_-	TrbI F-type domain-containing protein	NA	NA	NA	NA	NA
WP_015444241.1|2300982_2303535_-	type IV secretion system protein TraC	NA	NA	NA	NA	NA
WP_010947801.1|2303546_2303897_-	type IV conjugative transfer system lipoprotein TraV	NA	NA	NA	NA	NA
WP_015444240.1|2303910_2305197_-	TraB/VirB10 family protein	NA	NA	NA	NA	NA
WP_010947803.1|2305198_2305912_-	type-F conjugative transfer system secretin TraK	NA	NA	NA	NA	NA
WP_010947804.1|2305914_2306478_-	type IV conjugative transfer system protein TraE	NA	NA	NA	NA	NA
WP_010947805.1|2306481_2306775_-	type IV conjugative transfer system protein TraL	NA	NA	NA	NA	NA
WP_010947806.1|2306776_2307079_-	fimbrial protein	NA	NA	NA	NA	NA
WP_010947807.1|2307093_2307330_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	52.9	2.5e-08
WP_025520140.1|2307343_2307721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010947808.1|2307668_2308553_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015444237.1|2308725_2309406_+	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	28.1	1.6e-07
WP_016356978.1|2309554_2310229_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_010947811.1|2310677_2311250_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_015444236.1|2311233_2311731_+	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_010947813.1|2311723_2312311_-	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_010947814.1|2312315_2314451_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_010947815.1|2314469_2315351_-	sterol desaturase family protein	NA	NA	NA	NA	NA
WP_010947816.1|2315457_2315604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010947817.1|2315795_2315972_+	MAPEG family protein	NA	NA	NA	NA	NA
WP_010947818.1|2316141_2316639_-	DoxX family protein	NA	NA	NA	NA	NA
WP_010947819.1|2316628_2317408_-	DUF2063 domain-containing protein	NA	NA	NA	NA	NA
WP_010947820.1|2317400_2318255_-	DUF692 domain-containing protein	NA	NA	NA	NA	NA
WP_010947821.1|2318269_2318563_-	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_010947822.1|2318752_2319274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015444234.1|2319578_2320037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015444232.1|2320610_2320838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010947824.1|2320995_2321517_-	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_010947825.1|2321688_2322243_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_010947826.1|2322676_2322877_+	ATP-dependent DNA helicase	NA	NA	NA	NA	NA
WP_010947827.1|2322970_2323354_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_010947828.1|2323407_2324361_-	Abi family protein	NA	A3QSC6	Clostridium_virus	31.8	4.8e-34
WP_015444229.1|2324870_2326289_+|transposase	IS4-like element ISLpn3 family transposase	transposase	Q9JMP3	Wolbachia_phage	32.9	2.3e-56
WP_010947829.1|2326321_2327497_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	21.2	5.2e-14
WP_010947830.1|2327549_2328575_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP015937	Legionella pneumophila strain C6_S chromosome, complete genome	3404196	2625724	2688993	3404196	protease,integrase,transposase,tRNA	Erysipelothrix_phage(18.75%)	57	2631632:2631678	2687664:2687710
WP_010948063.1|2625724_2626726_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	50.7	5.8e-91
WP_010948064.1|2626930_2627170_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_010948065.1|2627372_2627816_+	lpg2359 family Dot/Icm T4SS effector	NA	A0A292GL36	Xanthomonas_phage	43.8	6.3e-21
WP_014842314.1|2627824_2629558_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	35.5	4.6e-59
WP_011216252.1|2629644_2631510_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	32.8	1.3e-35
2631632:2631678	attL	CTCATAATCCGTTGGTCCTAGGTTCAAGTCCTAGTGGGCCCACCAAT	NA	NA	NA	NA
WP_187297743.1|2631768_2632896_-|integrase	site-specific integrase	integrase	A0A059VF45	Pseudomonas_phage	47.3	2.2e-86
WP_061466610.1|2633276_2633462_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061466612.1|2633454_2634231_+	methylase	NA	NA	NA	NA	NA
WP_061634671.1|2634364_2635180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061466974.1|2635221_2636532_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061466975.1|2636661_2638143_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	24.8	9.4e-29
WP_061466976.1|2638296_2638539_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061466977.1|2638773_2638968_+	helix-turn-helix domain-containing protein	NA	A0A1B1IUF9	uncultured_Mediterranean_phage	60.3	4.8e-18
WP_061634672.1|2638995_2642271_+	DEAD/DEAH box helicase family protein	NA	A0A2K5B2B9	Erysipelothrix_phage	42.8	4.8e-235
WP_061466985.1|2642263_2642926_+	DUF4391 domain-containing protein	NA	NA	NA	NA	NA
WP_061634673.1|2642945_2644901_+	site-specific DNA-methyltransferase	NA	A0A2K5B2C1	Erysipelothrix_phage	36.1	2.0e-103
WP_061466981.1|2644918_2647951_+	DEAD/DEAH box helicase family protein	NA	A0A2K5B2C2	Erysipelothrix_phage	33.4	1.7e-130
WP_061634674.1|2648026_2649826_+	DUF4209 domain-containing protein	NA	NA	NA	NA	NA
WP_061466952.1|2649822_2650506_-	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	33.3	6.5e-17
WP_061466938.1|2650707_2651592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042234550.1|2651611_2651923_+	Vir protein	NA	NA	NA	NA	NA
WP_042234461.1|2651939_2652212_+	carbon storage regulator	NA	A0A0U1UNS3	Pseudomonas_phage	41.8	5.0e-05
WP_042234463.1|2652239_2653205_+	P-type conjugative transfer ATPase TrbB	NA	NA	NA	NA	NA
WP_042234466.1|2653216_2653594_+	TrbC/VirB2 family protein	NA	NA	NA	NA	NA
WP_061466939.1|2653590_2653890_+	VirB3 family type IV secretion system protein	NA	NA	NA	NA	NA
WP_061466940.1|2653886_2656421_+	conjugal transfer protein TrbE	NA	NA	NA	NA	NA
WP_061466941.1|2656417_2657116_+	conjugal transfer protein TrbF	NA	NA	NA	NA	NA
WP_061466942.1|2657112_2657988_+	P-type conjugative transfer protein TrbG	NA	NA	NA	NA	NA
WP_061466943.1|2657990_2658398_+	conjugal transfer protein TrbH	NA	NA	NA	NA	NA
WP_061466944.1|2658403_2659651_+	TrbI/VirB10 family protein	NA	NA	NA	NA	NA
WP_061466945.1|2659662_2660403_+	P-type conjugative transfer protein TrbJ	NA	NA	NA	NA	NA
WP_061466946.1|2660425_2660638_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061466947.1|2660642_2662025_+	P-type conjugative transfer protein TrbL	NA	NA	NA	NA	NA
WP_061466948.1|2662021_2663911_+	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_061466949.1|2663907_2664453_+	conjugative transfer signal peptidase TraF	NA	NA	NA	NA	NA
WP_187297749.1|2664449_2664614_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061466950.1|2664606_2666793_+	DUF1738 domain-containing protein	NA	A0A1B1IRD0	uncultured_Mediterranean_phage	33.9	1.1e-36
WP_061634675.1|2666922_2668518_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061466916.1|2668827_2670690_-	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_058450394.1|2670686_2671040_-	conjugal transfer transcriptional regulator TraJ	NA	NA	NA	NA	NA
WP_058450393.1|2671433_2671778_+	TraK family protein	NA	NA	NA	NA	NA
WP_058450392.1|2671777_2672503_+	conjugal transfer protein TraL	NA	NA	NA	NA	NA
WP_061466918.1|2672502_2672940_+	conjugal transfer protein TraM	NA	NA	NA	NA	NA
WP_061466920.1|2673187_2674249_-	DUF4116 domain-containing protein	NA	NA	NA	NA	NA
WP_080444600.1|2674671_2676306_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_040146985.1|2676260_2676653_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_058450390.1|2677134_2677377_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061466923.1|2677619_2679560_+	DUF2779 domain-containing protein	NA	NA	NA	NA	NA
WP_044496813.1|2679639_2680491_-	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_044496821.1|2680487_2681096_-	AbiEi antitoxin N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_058450388.1|2681903_2682308_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	33.1	1.1e-08
WP_080444601.1|2682265_2682391_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_044496812.1|2682515_2683568_+	LD-carboxypeptidase	NA	NA	NA	NA	NA
WP_061466925.1|2683574_2684792_-	MFS transporter	NA	NA	NA	NA	NA
WP_052585449.1|2684821_2685868_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A223W0B1	Agrobacterium_phage	32.4	1.5e-25
WP_061466927.1|2685869_2686934_-	ThiF family adenylyltransferase	NA	NA	NA	NA	NA
WP_015444121.1|2687817_2688993_-|transposase	ISL3 family transposase	transposase	A9YX10	Burkholderia_phage	23.2	3.8e-17
2687664:2687710	attR	CTCATAATCCGTTGGTCCTAGGTTCAAGTCCTAGTGGGCCCACCAAT	NA	NA	NA	NA
