The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP015939	Legionella pneumophila strain C8_S chromosome, complete genome	3420000	870402	915044	3420000	tRNA,protease,transposase	Pseudomonas_phage(22.22%)	36	NA	NA
WP_011213315.1|870402_871698_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_010947893.1|871950_873357_-|transposase	IS4-like element ISLpn6 family transposase	transposase	Q9JMP3	Wolbachia_phage	34.1	1.0e-72
WP_010946524.1|873547_874084_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_011213316.1|874422_875589_+	DUF1574 family protein	NA	NA	NA	NA	NA
WP_010946526.1|875585_877028_+	MBOAT family protein	NA	A0A125RNP0	Pseudomonas_phage	40.5	3.9e-72
WP_010946527.1|877126_878503_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_011213317.1|878707_879409_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_011213318.1|879574_880834_+	MFS transporter	NA	NA	NA	NA	NA
WP_011213319.1|882688_883339_+	lpg0796 family Dot/Icm T4SS effector	NA	NA	NA	NA	NA
WP_010946534.1|883618_884005_+	DUF3757 domain-containing protein	NA	NA	NA	NA	NA
WP_010946535.1|884108_885452_-	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_010946536.1|885526_887176_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_010946537.1|887172_888543_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	49.7	2.2e-112
WP_010946538.1|888695_890399_+	sulfate permease	NA	A0A2H4J153	uncultured_Caudovirales_phage	26.5	6.5e-42
WP_010946539.1|890601_892305_-	acyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_010946540.1|892534_893533_-	linear amide C-N hydrolase	NA	NA	NA	NA	NA
WP_010946541.1|893757_896145_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	38.1	7.0e-175
WP_010946542.1|896386_897826_+	cation:proton antiporter	NA	NA	NA	NA	NA
WP_010946543.1|897822_898665_+	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_010946544.1|898661_899753_+	undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase	NA	NA	NA	NA	NA
WP_010946545.1|899727_901143_+	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_010946546.1|901234_901552_+	helix-hairpin-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011213320.1|901747_902785_+	rod shape-determining protein	NA	NA	NA	NA	NA
WP_010946548.1|902762_903671_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_010946549.1|903667_904147_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_011213321.1|904082_904685_-	pseudouridine synthase	NA	NA	NA	NA	NA
WP_010946551.1|904945_905644_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011213322.1|905753_907010_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	74.1	1.9e-14
WP_010946553.1|907411_907747_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A218MMY6	uncultured_virus	36.5	5.8e-11
WP_011213323.1|907778_910046_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.1	8.7e-167
WP_010946555.1|910346_911432_+|transposase	IS4-like element ISLpn9 family transposase	transposase	NA	NA	NA	NA
WP_010946556.1|911457_911751_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_010946557.1|911906_912686_+	glycosyltransferase family 2 protein	NA	S5WBE2	Pseudomonas_phage	30.8	6.9e-07
WP_010946558.1|912688_913939_+	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_011213324.1|913939_914275_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010946560.1|914444_915044_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
>prophage 2
NZ_CP015939	Legionella pneumophila strain C8_S chromosome, complete genome	3420000	925372	932212	3420000		Acinetobacter_phage(42.86%)	9	NA	NA
WP_010946569.1|925372_926149_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	48.2	3.3e-57
WP_010946570.1|926141_927176_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	47.6	3.5e-75
WP_010946571.1|927153_927732_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	53.2	1.0e-55
WP_010946572.1|927765_928491_-	LPS export ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.3	3.1e-17
WP_010946573.1|928487_928997_-	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
WP_010946574.1|928977_929547_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_011213328.1|929543_930071_-	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	47.7	1.4e-27
WP_010946576.1|930084_931047_-	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	34.1	4.2e-38
WP_010946577.1|931414_932212_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	33.8	1.3e-21
>prophage 3
NZ_CP015939	Legionella pneumophila strain C8_S chromosome, complete genome	3420000	1314844	1320781	3420000		Staphylococcus_phage(50.0%)	6	NA	NA
WP_010946911.1|1314844_1315918_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	27.8	2.8e-30
WP_010946912.1|1315902_1316517_+	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	38.4	3.5e-22
WP_010946913.1|1316513_1317722_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.7	5.4e-99
WP_010946914.1|1317729_1318197_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	49.1	9.2e-23
WP_010946915.1|1318322_1319960_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	52.3	3.6e-154
WP_010946916.1|1319956_1320781_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	43.9	1.8e-53
>prophage 4
NZ_CP015939	Legionella pneumophila strain C8_S chromosome, complete genome	3420000	2224320	2234444	3420000		Bacillus_phage(16.67%)	7	NA	NA
WP_010947735.1|2224320_2226009_-	S8 family serine peptidase	NA	A0A1B0T6A2	Bacillus_phage	30.4	8.0e-16
WP_015444337.1|2226140_2227148_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_010947737.1|2227271_2228597_-	adenosylhomocysteinase	NA	S4VPF6	Pandoravirus	31.2	1.4e-47
WP_010947738.1|2228615_2229764_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	58.5	1.3e-126
WP_015444336.1|2229972_2231085_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	35.2	2.9e-51
WP_010947740.1|2231180_2232320_-	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	26.9	1.6e-23
WP_015444335.1|2232509_2234444_-	molecular chaperone DnaK	NA	G8DDB7	Micromonas_pusilla_virus	49.6	1.3e-147
>prophage 5
NZ_CP015939	Legionella pneumophila strain C8_S chromosome, complete genome	3420000	2276272	2331297	3420000	transposase	Wolbachia_phage(25.0%)	53	NA	NA
WP_010947782.1|2276272_2277724_+|transposase	IS4-like element ISLpn5 family transposase	transposase	Q9JMP3	Wolbachia_phage	56.8	6.1e-158
WP_010947783.1|2277794_2279315_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	48.2	7.9e-124
WP_010947785.1|2280162_2280537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010947786.1|2280734_2282342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015444248.1|2282344_2282836_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010947788.1|2282846_2283683_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	48.9	4.9e-67
WP_010947789.1|2284275_2285367_-	DUF4917 family protein	NA	NA	NA	NA	NA
WP_010947790.1|2285598_2291544_-	conjugative transfer relaxase/helicase TraI	NA	NA	NA	NA	NA
WP_010947791.1|2291564_2293457_-	type IV conjugative transfer system coupling protein TraD	NA	NA	NA	NA	NA
WP_021437030.1|2293521_2293986_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015444244.1|2293989_2296710_-	conjugal transfer protein TraG N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_010947793.1|2296715_2298101_-	conjugal transfer protein TraH	NA	NA	NA	NA	NA
WP_010947794.1|2298097_2298520_-	type-F conjugative transfer system pilin assembly thiol-disulfide isomerase TrbB	NA	NA	NA	NA	NA
WP_010947795.1|2298509_2299292_-	type-F conjugative transfer system pilin assembly protein TraF	NA	NA	NA	NA	NA
WP_010947796.1|2299284_2301096_-	type-F conjugative transfer system mating-pair stabilization protein TraN	NA	NA	NA	NA	NA
WP_015444243.1|2301095_2301764_-	type-F conjugative transfer system pilin assembly protein TrbC	NA	NA	NA	NA	NA
WP_010947798.1|2301779_2302775_-	TraU family protein	NA	NA	NA	NA	NA
WP_010947799.1|2302771_2303380_-	type-F conjugative transfer system protein TraW	NA	NA	NA	NA	NA
WP_015444242.1|2303376_2303712_-	TrbI F-type domain-containing protein	NA	NA	NA	NA	NA
WP_015444241.1|2303704_2306257_-	type IV secretion system protein TraC	NA	NA	NA	NA	NA
WP_010947801.1|2306268_2306619_-	type IV conjugative transfer system lipoprotein TraV	NA	NA	NA	NA	NA
WP_015444240.1|2306632_2307919_-	TraB/VirB10 family protein	NA	NA	NA	NA	NA
WP_010947803.1|2307920_2308634_-	type-F conjugative transfer system secretin TraK	NA	NA	NA	NA	NA
WP_010947804.1|2308636_2309200_-	type IV conjugative transfer system protein TraE	NA	NA	NA	NA	NA
WP_010947805.1|2309203_2309497_-	type IV conjugative transfer system protein TraL	NA	NA	NA	NA	NA
WP_010947806.1|2309498_2309801_-	fimbrial protein	NA	NA	NA	NA	NA
WP_010947807.1|2309815_2310052_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	52.9	2.5e-08
WP_025520140.1|2310065_2310443_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010947808.1|2310390_2311275_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015444237.1|2311447_2312128_+	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	28.1	1.6e-07
WP_016356978.1|2312276_2312951_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_010947811.1|2313399_2313972_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_015444236.1|2313955_2314453_+	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_010947813.1|2314445_2315033_-	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_010947814.1|2315037_2317173_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_010947815.1|2317191_2318073_-	sterol desaturase family protein	NA	NA	NA	NA	NA
WP_010947816.1|2318179_2318326_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010947817.1|2318517_2318694_+	MAPEG family protein	NA	NA	NA	NA	NA
WP_010947818.1|2318863_2319361_-	DoxX family protein	NA	NA	NA	NA	NA
WP_010947819.1|2319350_2320130_-	DUF2063 domain-containing protein	NA	NA	NA	NA	NA
WP_010947820.1|2320122_2320977_-	DUF692 domain-containing protein	NA	NA	NA	NA	NA
WP_010947821.1|2320991_2321285_-	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_010947822.1|2321474_2321996_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015444234.1|2322300_2322759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015444232.1|2323332_2323560_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010947824.1|2323717_2324239_-	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_010947825.1|2324410_2324965_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_010947826.1|2325398_2325599_+	ATP-dependent DNA helicase	NA	NA	NA	NA	NA
WP_010947827.1|2325692_2326076_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_010947828.1|2326129_2327083_-	Abi family protein	NA	A3QSC6	Clostridium_virus	31.8	4.8e-34
WP_015444229.1|2327592_2329011_+|transposase	IS4-like element ISLpn3 family transposase	transposase	Q9JMP3	Wolbachia_phage	32.9	2.3e-56
WP_010947829.1|2329043_2330219_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	21.2	5.2e-14
WP_010947830.1|2330271_2331297_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP015939	Legionella pneumophila strain C8_S chromosome, complete genome	3420000	2628445	2691714	3420000	integrase,tRNA,protease,transposase	Erysipelothrix_phage(18.75%)	57	2634353:2634399	2690385:2690431
WP_010948063.1|2628445_2629447_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	50.7	5.8e-91
WP_010948064.1|2629651_2629891_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_010948065.1|2630093_2630537_+	lpg2359 family Dot/Icm T4SS effector	NA	A0A292GL36	Xanthomonas_phage	43.8	6.3e-21
WP_014842314.1|2630545_2632279_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	35.5	4.6e-59
WP_011216252.1|2632365_2634231_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	32.8	1.3e-35
2634353:2634399	attL	CTCATAATCCGTTGGTCCTAGGTTCAAGTCCTAGTGGGCCCACCAAT	NA	NA	NA	NA
WP_187297743.1|2634489_2635617_-|integrase	site-specific integrase	integrase	A0A059VF45	Pseudomonas_phage	47.3	2.2e-86
WP_061466610.1|2635997_2636183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061466612.1|2636175_2636952_+	methylase	NA	NA	NA	NA	NA
WP_061634671.1|2637085_2637901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061466974.1|2637942_2639253_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061466975.1|2639382_2640864_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	24.8	9.4e-29
WP_061466976.1|2641017_2641260_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061466977.1|2641494_2641689_+	helix-turn-helix domain-containing protein	NA	A0A1B1IUF9	uncultured_Mediterranean_phage	60.3	4.8e-18
WP_061634672.1|2641716_2644992_+	DEAD/DEAH box helicase family protein	NA	A0A2K5B2B9	Erysipelothrix_phage	42.8	4.8e-235
WP_061466985.1|2644984_2645647_+	DUF4391 domain-containing protein	NA	NA	NA	NA	NA
WP_061634673.1|2645666_2647622_+	site-specific DNA-methyltransferase	NA	A0A2K5B2C1	Erysipelothrix_phage	36.1	2.0e-103
WP_061466981.1|2647639_2650672_+	DEAD/DEAH box helicase family protein	NA	A0A2K5B2C2	Erysipelothrix_phage	33.4	1.7e-130
WP_061634674.1|2650747_2652547_+	DUF4209 domain-containing protein	NA	NA	NA	NA	NA
WP_061466952.1|2652543_2653227_-	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	33.3	6.5e-17
WP_061466938.1|2653428_2654313_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042234550.1|2654332_2654644_+	Vir protein	NA	NA	NA	NA	NA
WP_042234461.1|2654660_2654933_+	carbon storage regulator	NA	A0A0U1UNS3	Pseudomonas_phage	41.8	5.0e-05
WP_042234463.1|2654960_2655926_+	P-type conjugative transfer ATPase TrbB	NA	NA	NA	NA	NA
WP_042234466.1|2655937_2656315_+	TrbC/VirB2 family protein	NA	NA	NA	NA	NA
WP_061466939.1|2656311_2656611_+	VirB3 family type IV secretion system protein	NA	NA	NA	NA	NA
WP_061466940.1|2656607_2659142_+	conjugal transfer protein TrbE	NA	NA	NA	NA	NA
WP_061466941.1|2659138_2659837_+	conjugal transfer protein TrbF	NA	NA	NA	NA	NA
WP_061466942.1|2659833_2660709_+	P-type conjugative transfer protein TrbG	NA	NA	NA	NA	NA
WP_061466943.1|2660711_2661119_+	conjugal transfer protein TrbH	NA	NA	NA	NA	NA
WP_061466944.1|2661124_2662372_+	TrbI/VirB10 family protein	NA	NA	NA	NA	NA
WP_061466945.1|2662383_2663124_+	P-type conjugative transfer protein TrbJ	NA	NA	NA	NA	NA
WP_061466946.1|2663146_2663359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061466947.1|2663363_2664746_+	P-type conjugative transfer protein TrbL	NA	NA	NA	NA	NA
WP_061466948.1|2664742_2666632_+	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_061466949.1|2666628_2667174_+	conjugative transfer signal peptidase TraF	NA	NA	NA	NA	NA
WP_187297749.1|2667170_2667335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061466950.1|2667327_2669514_+	DUF1738 domain-containing protein	NA	A0A1B1IRD0	uncultured_Mediterranean_phage	33.9	1.1e-36
WP_061634675.1|2669643_2671239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061466916.1|2671548_2673411_-	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_058450394.1|2673407_2673761_-	conjugal transfer transcriptional regulator TraJ	NA	NA	NA	NA	NA
WP_058450393.1|2674154_2674499_+	TraK family protein	NA	NA	NA	NA	NA
WP_058450392.1|2674498_2675224_+	conjugal transfer protein TraL	NA	NA	NA	NA	NA
WP_061466918.1|2675223_2675661_+	conjugal transfer protein TraM	NA	NA	NA	NA	NA
WP_061466920.1|2675908_2676970_-	DUF4116 domain-containing protein	NA	NA	NA	NA	NA
WP_080444600.1|2677392_2679027_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_040146985.1|2678981_2679374_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_058450390.1|2679855_2680098_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061466923.1|2680340_2682281_+	DUF2779 domain-containing protein	NA	NA	NA	NA	NA
WP_044496813.1|2682360_2683212_-	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_044496821.1|2683208_2683817_-	AbiEi antitoxin N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_058450388.1|2684624_2685029_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	33.1	1.1e-08
WP_080444601.1|2684986_2685112_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_044496812.1|2685236_2686289_+	LD-carboxypeptidase	NA	NA	NA	NA	NA
WP_061466925.1|2686295_2687513_-	MFS transporter	NA	NA	NA	NA	NA
WP_052585449.1|2687542_2688589_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A223W0B1	Agrobacterium_phage	32.4	1.5e-25
WP_061466927.1|2688590_2689655_-	ThiF family adenylyltransferase	NA	NA	NA	NA	NA
WP_015444121.1|2690538_2691714_-|transposase	ISL3 family transposase	transposase	A9YX10	Burkholderia_phage	23.2	3.8e-17
2690385:2690431	attR	CTCATAATCCGTTGGTCCTAGGTTCAAGTCCTAGTGGGCCCACCAAT	NA	NA	NA	NA
>prophage 1
NZ_CP015940	Legionella pneumophila strain C8_S plasmid unnamed1, complete sequence	58092	32125	42777	58092		Vibrio_phage(28.57%)	8	NA	NA
WP_011212641.1|32125_35521_-	type I-F CRISPR-associated helicase Cas3	NA	A0A2I7RCU8	Vibrio_phage	30.3	3.8e-102
WP_011212642.1|35517_36486_-	type I-F CRISPR-associated endonuclease Cas1	NA	A0A2D0YFC9	Vibrio_phage	39.2	3.3e-51
WP_011212643.1|36672_36945_-	recombinase family protein	NA	A0A219Y912	Aeromonas_phage	46.1	7.0e-07
WP_011212644.1|37014_37992_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011212645.1|38416_39694_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	45.6	7.2e-94
WP_011212646.1|39680_40187_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	44.4	1.3e-27
WP_011212647.1|40322_40991_-	SOS response-associated peptidase	NA	A0A1P8CX02	Bacillus_phage	39.6	9.1e-24
WP_106184466.1|41760_42777_+	ParA family protein	NA	Q8JL10	Natrialba_phage	29.6	1.0e-13
