The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP015945	Legionella pneumophila strain C11_O chromosome, complete genome	3416875	920650	927490	3416875		Acinetobacter_phage(42.86%)	9	NA	NA
WP_010946569.1|920650_921427_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	48.2	3.3e-57
WP_010946570.1|921419_922454_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	47.6	3.5e-75
WP_010946571.1|922431_923010_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	53.2	1.0e-55
WP_010946572.1|923043_923769_-	LPS export ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.3	3.1e-17
WP_010946573.1|923765_924275_-	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
WP_010946574.1|924255_924825_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_011213328.1|924821_925349_-	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	47.7	1.4e-27
WP_010946576.1|925362_926325_-	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	34.1	4.2e-38
WP_010946577.1|926692_927490_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	33.8	1.3e-21
>prophage 2
NZ_CP015945	Legionella pneumophila strain C11_O chromosome, complete genome	3416875	1310122	1316059	3416875		Staphylococcus_phage(50.0%)	6	NA	NA
WP_010946911.1|1310122_1311196_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	27.8	2.8e-30
WP_010946912.1|1311180_1311795_+	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	38.4	3.5e-22
WP_010946913.1|1311791_1313000_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.7	5.4e-99
WP_010946914.1|1313007_1313475_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	49.1	9.2e-23
WP_010946915.1|1313600_1315238_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	52.3	3.6e-154
WP_010946916.1|1315234_1316059_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	43.9	1.8e-53
>prophage 3
NZ_CP015945	Legionella pneumophila strain C11_O chromosome, complete genome	3416875	2221187	2231311	3416875		Bacillus_phage(16.67%)	7	NA	NA
WP_010947735.1|2221187_2222876_-	S8 family serine peptidase	NA	A0A1B0T6A2	Bacillus_phage	30.4	8.0e-16
WP_015444337.1|2223007_2224015_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_010947737.1|2224138_2225464_-	adenosylhomocysteinase	NA	S4VPF6	Pandoravirus	31.2	1.4e-47
WP_010947738.1|2225482_2226631_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	58.5	1.3e-126
WP_015444336.1|2226839_2227952_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	35.2	2.9e-51
WP_010947740.1|2228047_2229187_-	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	26.9	1.6e-23
WP_015444335.1|2229376_2231311_-	molecular chaperone DnaK	NA	G8DDB7	Micromonas_pusilla_virus	49.6	1.3e-147
>prophage 4
NZ_CP015945	Legionella pneumophila strain C11_O chromosome, complete genome	3416875	2273139	2328164	3416875	transposase	Wolbachia_phage(25.0%)	53	NA	NA
WP_010947782.1|2273139_2274591_+|transposase	IS4-like element ISLpn5 family transposase	transposase	Q9JMP3	Wolbachia_phage	56.8	6.1e-158
WP_010947783.1|2274661_2276182_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	48.2	7.9e-124
WP_010947785.1|2277029_2277404_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010947786.1|2277601_2279209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015444248.1|2279211_2279703_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010947788.1|2279713_2280550_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	48.9	4.9e-67
WP_010947789.1|2281142_2282234_-	DUF4917 family protein	NA	NA	NA	NA	NA
WP_010947790.1|2282465_2288411_-	conjugative transfer relaxase/helicase TraI	NA	NA	NA	NA	NA
WP_010947791.1|2288431_2290324_-	type IV conjugative transfer system coupling protein TraD	NA	NA	NA	NA	NA
WP_021437030.1|2290388_2290853_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015444244.1|2290856_2293577_-	conjugal transfer protein TraG N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_010947793.1|2293582_2294968_-	conjugal transfer protein TraH	NA	NA	NA	NA	NA
WP_010947794.1|2294964_2295387_-	type-F conjugative transfer system pilin assembly thiol-disulfide isomerase TrbB	NA	NA	NA	NA	NA
WP_010947795.1|2295376_2296159_-	type-F conjugative transfer system pilin assembly protein TraF	NA	NA	NA	NA	NA
WP_010947796.1|2296151_2297963_-	type-F conjugative transfer system mating-pair stabilization protein TraN	NA	NA	NA	NA	NA
WP_015444243.1|2297962_2298631_-	type-F conjugative transfer system pilin assembly protein TrbC	NA	NA	NA	NA	NA
WP_010947798.1|2298646_2299642_-	TraU family protein	NA	NA	NA	NA	NA
WP_010947799.1|2299638_2300247_-	type-F conjugative transfer system protein TraW	NA	NA	NA	NA	NA
WP_027223818.1|2300243_2300585_-	TrbI F-type domain-containing protein	NA	NA	NA	NA	NA
WP_015444241.1|2300571_2303124_-	type IV secretion system protein TraC	NA	NA	NA	NA	NA
WP_010947801.1|2303135_2303486_-	type IV conjugative transfer system lipoprotein TraV	NA	NA	NA	NA	NA
WP_015444240.1|2303499_2304786_-	TraB/VirB10 family protein	NA	NA	NA	NA	NA
WP_010947803.1|2304787_2305501_-	type-F conjugative transfer system secretin TraK	NA	NA	NA	NA	NA
WP_010947804.1|2305503_2306067_-	type IV conjugative transfer system protein TraE	NA	NA	NA	NA	NA
WP_010947805.1|2306070_2306364_-	type IV conjugative transfer system protein TraL	NA	NA	NA	NA	NA
WP_010947806.1|2306365_2306668_-	fimbrial protein	NA	NA	NA	NA	NA
WP_010947807.1|2306682_2306919_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	52.9	2.5e-08
WP_025520140.1|2306932_2307310_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010947808.1|2307257_2308142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015444237.1|2308314_2308995_+	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	28.1	1.6e-07
WP_016356978.1|2309143_2309818_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_010947811.1|2310266_2310839_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_015444236.1|2310822_2311320_+	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_010947813.1|2311312_2311900_-	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_010947814.1|2311904_2314040_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_010947815.1|2314058_2314940_-	sterol desaturase family protein	NA	NA	NA	NA	NA
WP_010947816.1|2315046_2315193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010947817.1|2315384_2315561_+	MAPEG family protein	NA	NA	NA	NA	NA
WP_010947818.1|2315730_2316228_-	DoxX family protein	NA	NA	NA	NA	NA
WP_010947819.1|2316217_2316997_-	DUF2063 domain-containing protein	NA	NA	NA	NA	NA
WP_010947820.1|2316989_2317844_-	DUF692 domain-containing protein	NA	NA	NA	NA	NA
WP_010947821.1|2317858_2318152_-	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_010947822.1|2318341_2318863_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015444234.1|2319167_2319626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015444232.1|2320199_2320427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010947824.1|2320584_2321106_-	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_010947825.1|2321277_2321832_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_010947826.1|2322265_2322466_+	ATP-dependent DNA helicase	NA	NA	NA	NA	NA
WP_010947827.1|2322559_2322943_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_010947828.1|2322996_2323950_-	Abi family protein	NA	A3QSC6	Clostridium_virus	31.8	4.8e-34
WP_015444229.1|2324459_2325878_+|transposase	IS4-like element ISLpn3 family transposase	transposase	Q9JMP3	Wolbachia_phage	32.9	2.3e-56
WP_010947829.1|2325910_2327086_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	21.2	5.2e-14
WP_010947830.1|2327138_2328164_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP015945	Legionella pneumophila strain C11_O chromosome, complete genome	3416875	2625312	2688581	3416875	transposase,protease,tRNA,integrase	Erysipelothrix_phage(18.75%)	57	2631220:2631266	2687252:2687298
WP_010948063.1|2625312_2626314_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	50.7	5.8e-91
WP_010948064.1|2626518_2626758_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_010948065.1|2626960_2627404_+	lpg2359 family Dot/Icm T4SS effector	NA	A0A292GL36	Xanthomonas_phage	43.8	6.3e-21
WP_014842314.1|2627412_2629146_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	35.5	4.6e-59
WP_011216252.1|2629232_2631098_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	32.8	1.3e-35
2631220:2631266	attL	CTCATAATCCGTTGGTCCTAGGTTCAAGTCCTAGTGGGCCCACCAAT	NA	NA	NA	NA
WP_187297743.1|2631356_2632484_-|integrase	site-specific integrase	integrase	A0A059VF45	Pseudomonas_phage	47.3	2.2e-86
WP_061466610.1|2632864_2633050_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061466612.1|2633042_2633819_+	methylase	NA	NA	NA	NA	NA
WP_061634671.1|2633952_2634768_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061466974.1|2634809_2636120_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061466975.1|2636249_2637731_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	24.8	9.4e-29
WP_061466976.1|2637884_2638127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061466977.1|2638361_2638556_+	helix-turn-helix domain-containing protein	NA	A0A1B1IUF9	uncultured_Mediterranean_phage	60.3	4.8e-18
WP_061634672.1|2638583_2641859_+	DEAD/DEAH box helicase family protein	NA	A0A2K5B2B9	Erysipelothrix_phage	42.8	4.8e-235
WP_061466985.1|2641851_2642514_+	DUF4391 domain-containing protein	NA	NA	NA	NA	NA
WP_061634673.1|2642533_2644489_+	site-specific DNA-methyltransferase	NA	A0A2K5B2C1	Erysipelothrix_phage	36.1	2.0e-103
WP_061466981.1|2644506_2647539_+	DEAD/DEAH box helicase family protein	NA	A0A2K5B2C2	Erysipelothrix_phage	33.4	1.7e-130
WP_061634674.1|2647614_2649414_+	DUF4209 domain-containing protein	NA	NA	NA	NA	NA
WP_061466952.1|2649410_2650094_-	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	33.3	6.5e-17
WP_061466938.1|2650295_2651180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042234550.1|2651199_2651511_+	Vir protein	NA	NA	NA	NA	NA
WP_042234461.1|2651527_2651800_+	carbon storage regulator	NA	A0A0U1UNS3	Pseudomonas_phage	41.8	5.0e-05
WP_042234463.1|2651827_2652793_+	P-type conjugative transfer ATPase TrbB	NA	NA	NA	NA	NA
WP_070065774.1|2652804_2653182_+	TrbC/VirB2 family protein	NA	NA	NA	NA	NA
WP_061466939.1|2653178_2653478_+	VirB3 family type IV secretion system protein	NA	NA	NA	NA	NA
WP_061466940.1|2653474_2656009_+	conjugal transfer protein TrbE	NA	NA	NA	NA	NA
WP_061466941.1|2656005_2656704_+	conjugal transfer protein TrbF	NA	NA	NA	NA	NA
WP_061466942.1|2656700_2657576_+	P-type conjugative transfer protein TrbG	NA	NA	NA	NA	NA
WP_061466943.1|2657578_2657986_+	conjugal transfer protein TrbH	NA	NA	NA	NA	NA
WP_070065775.1|2657991_2659239_+	TrbI/VirB10 family protein	NA	NA	NA	NA	NA
WP_061466945.1|2659250_2659991_+	P-type conjugative transfer protein TrbJ	NA	NA	NA	NA	NA
WP_061466946.1|2660013_2660226_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061466947.1|2660230_2661613_+	P-type conjugative transfer protein TrbL	NA	NA	NA	NA	NA
WP_061466948.1|2661609_2663499_+	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_061466949.1|2663495_2664041_+	conjugative transfer signal peptidase TraF	NA	NA	NA	NA	NA
WP_187297749.1|2664037_2664202_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061466950.1|2664194_2666381_+	DUF1738 domain-containing protein	NA	A0A1B1IRD0	uncultured_Mediterranean_phage	33.9	1.1e-36
WP_061634675.1|2666510_2668106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061466916.1|2668415_2670278_-	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_058450394.1|2670274_2670628_-	conjugal transfer transcriptional regulator TraJ	NA	NA	NA	NA	NA
WP_058450393.1|2671021_2671366_+	TraK family protein	NA	NA	NA	NA	NA
WP_058450392.1|2671365_2672091_+	conjugal transfer protein TraL	NA	NA	NA	NA	NA
WP_061466918.1|2672090_2672528_+	conjugal transfer protein TraM	NA	NA	NA	NA	NA
WP_061466920.1|2672775_2673837_-	DUF4116 domain-containing protein	NA	NA	NA	NA	NA
WP_080444600.1|2674259_2675894_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_040146985.1|2675848_2676241_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_058450390.1|2676722_2676965_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061466923.1|2677207_2679148_+	DUF2779 domain-containing protein	NA	NA	NA	NA	NA
WP_044496813.1|2679227_2680079_-	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_044496821.1|2680075_2680684_-	AbiEi antitoxin N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_058450388.1|2681491_2681896_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	33.1	1.1e-08
WP_080444601.1|2681853_2681979_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_044496812.1|2682103_2683156_+	LD-carboxypeptidase	NA	NA	NA	NA	NA
WP_061466925.1|2683162_2684380_-	MFS transporter	NA	NA	NA	NA	NA
WP_052585449.1|2684409_2685456_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A223W0B1	Agrobacterium_phage	32.4	1.5e-25
WP_061466927.1|2685457_2686522_-	ThiF family adenylyltransferase	NA	NA	NA	NA	NA
WP_015444121.1|2687405_2688581_-|transposase	ISL3 family transposase	transposase	A9YX10	Burkholderia_phage	23.2	3.8e-17
2687252:2687298	attR	CTCATAATCCGTTGGTCCTAGGTTCAAGTCCTAGTGGGCCCACCAAT	NA	NA	NA	NA
