The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP015951	Legionella pneumophila strain E5_N chromosome, complete genome	3419817	923190	930030	3419817		Acinetobacter_phage(42.86%)	9	NA	NA
WP_010946569.1|923190_923967_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	48.2	3.3e-57
WP_010946570.1|923959_924994_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	47.6	3.5e-75
WP_010946571.1|924971_925550_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	53.2	1.0e-55
WP_010946572.1|925583_926309_-	LPS export ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.3	3.1e-17
WP_010946573.1|926305_926815_-	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
WP_010946574.1|926795_927365_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_011213328.1|927361_927889_-	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	47.7	1.4e-27
WP_010946576.1|927902_928865_-	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	34.1	4.2e-38
WP_010946577.1|929232_930030_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	33.8	1.3e-21
>prophage 2
NZ_CP015951	Legionella pneumophila strain E5_N chromosome, complete genome	3419817	1314663	1320600	3419817		Staphylococcus_phage(50.0%)	6	NA	NA
WP_010946911.1|1314663_1315737_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	27.8	2.8e-30
WP_010946912.1|1315721_1316336_+	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	38.4	3.5e-22
WP_010946913.1|1316332_1317541_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.7	5.4e-99
WP_010946914.1|1317548_1318016_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	49.1	9.2e-23
WP_010946915.1|1318141_1319779_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	52.3	3.6e-154
WP_010946916.1|1319775_1320600_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	43.9	1.8e-53
>prophage 3
NZ_CP015951	Legionella pneumophila strain E5_N chromosome, complete genome	3419817	2224137	2234261	3419817		Bacillus_phage(16.67%)	7	NA	NA
WP_010947735.1|2224137_2225826_-	S8 family serine peptidase	NA	A0A1B0T6A2	Bacillus_phage	30.4	8.0e-16
WP_015444337.1|2225957_2226965_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_010947737.1|2227088_2228414_-	adenosylhomocysteinase	NA	S4VPF6	Pandoravirus	31.2	1.4e-47
WP_010947738.1|2228432_2229581_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	58.5	1.3e-126
WP_015444336.1|2229789_2230902_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	35.2	2.9e-51
WP_010947740.1|2230997_2232137_-	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	26.9	1.6e-23
WP_015444335.1|2232326_2234261_-	molecular chaperone DnaK	NA	G8DDB7	Micromonas_pusilla_virus	49.6	1.3e-147
>prophage 4
NZ_CP015951	Legionella pneumophila strain E5_N chromosome, complete genome	3419817	2276089	2331114	3419817	transposase	Wolbachia_phage(25.0%)	53	NA	NA
WP_010947782.1|2276089_2277541_+|transposase	IS4-like element ISLpn5 family transposase	transposase	Q9JMP3	Wolbachia_phage	56.8	6.1e-158
WP_010947783.1|2277611_2279132_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	48.2	7.9e-124
WP_010947785.1|2279979_2280354_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010947786.1|2280551_2282159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015444248.1|2282161_2282653_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010947788.1|2282663_2283500_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	48.9	4.9e-67
WP_010947789.1|2284092_2285184_-	DUF4917 family protein	NA	NA	NA	NA	NA
WP_010947790.1|2285415_2291361_-	conjugative transfer relaxase/helicase TraI	NA	NA	NA	NA	NA
WP_010947791.1|2291381_2293274_-	type IV conjugative transfer system coupling protein TraD	NA	NA	NA	NA	NA
WP_021437030.1|2293338_2293803_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015444244.1|2293806_2296527_-	conjugal transfer protein TraG N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_010947793.1|2296532_2297918_-	conjugal transfer protein TraH	NA	NA	NA	NA	NA
WP_010947794.1|2297914_2298337_-	type-F conjugative transfer system pilin assembly thiol-disulfide isomerase TrbB	NA	NA	NA	NA	NA
WP_010947795.1|2298326_2299109_-	type-F conjugative transfer system pilin assembly protein TraF	NA	NA	NA	NA	NA
WP_010947796.1|2299101_2300913_-	type-F conjugative transfer system mating-pair stabilization protein TraN	NA	NA	NA	NA	NA
WP_015444243.1|2300912_2301581_-	type-F conjugative transfer system pilin assembly protein TrbC	NA	NA	NA	NA	NA
WP_010947798.1|2301596_2302592_-	TraU family protein	NA	NA	NA	NA	NA
WP_010947799.1|2302588_2303197_-	type-F conjugative transfer system protein TraW	NA	NA	NA	NA	NA
WP_015444242.1|2303193_2303529_-	TrbI F-type domain-containing protein	NA	NA	NA	NA	NA
WP_015444241.1|2303521_2306074_-	type IV secretion system protein TraC	NA	NA	NA	NA	NA
WP_010947801.1|2306085_2306436_-	type IV conjugative transfer system lipoprotein TraV	NA	NA	NA	NA	NA
WP_015444240.1|2306449_2307736_-	TraB/VirB10 family protein	NA	NA	NA	NA	NA
WP_010947803.1|2307737_2308451_-	type-F conjugative transfer system secretin TraK	NA	NA	NA	NA	NA
WP_010947804.1|2308453_2309017_-	type IV conjugative transfer system protein TraE	NA	NA	NA	NA	NA
WP_010947805.1|2309020_2309314_-	type IV conjugative transfer system protein TraL	NA	NA	NA	NA	NA
WP_010947806.1|2309315_2309618_-	fimbrial protein	NA	NA	NA	NA	NA
WP_010947807.1|2309632_2309869_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	52.9	2.5e-08
WP_025520140.1|2309882_2310260_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010947808.1|2310207_2311092_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015444237.1|2311264_2311945_+	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	28.1	1.6e-07
WP_016356978.1|2312093_2312768_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_010947811.1|2313216_2313789_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_015444236.1|2313772_2314270_+	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_010947813.1|2314262_2314850_-	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_010947814.1|2314854_2316990_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_010947815.1|2317008_2317890_-	sterol desaturase family protein	NA	NA	NA	NA	NA
WP_010947816.1|2317996_2318143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010947817.1|2318334_2318511_+	MAPEG family protein	NA	NA	NA	NA	NA
WP_010947818.1|2318680_2319178_-	DoxX family protein	NA	NA	NA	NA	NA
WP_010947819.1|2319167_2319947_-	DUF2063 domain-containing protein	NA	NA	NA	NA	NA
WP_010947820.1|2319939_2320794_-	DUF692 domain-containing protein	NA	NA	NA	NA	NA
WP_010947821.1|2320808_2321102_-	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_010947822.1|2321291_2321813_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015444234.1|2322117_2322576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015444232.1|2323149_2323377_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010947824.1|2323534_2324056_-	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_010947825.1|2324227_2324782_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_010947826.1|2325215_2325416_+	ATP-dependent DNA helicase	NA	NA	NA	NA	NA
WP_010947827.1|2325509_2325893_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_010947828.1|2325946_2326900_-	Abi family protein	NA	A3QSC6	Clostridium_virus	31.8	4.8e-34
WP_015444229.1|2327409_2328828_+|transposase	IS4-like element ISLpn3 family transposase	transposase	Q9JMP3	Wolbachia_phage	32.9	2.3e-56
WP_010947829.1|2328860_2330036_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	21.2	5.2e-14
WP_010947830.1|2330088_2331114_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP015951	Legionella pneumophila strain E5_N chromosome, complete genome	3419817	2628262	2691531	3419817	protease,transposase,tRNA,integrase	Erysipelothrix_phage(18.75%)	57	2634170:2634216	2690202:2690248
WP_010948063.1|2628262_2629264_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	50.7	5.8e-91
WP_010948064.1|2629468_2629708_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_010948065.1|2629910_2630354_+	lpg2359 family Dot/Icm T4SS effector	NA	A0A292GL36	Xanthomonas_phage	43.8	6.3e-21
WP_014842314.1|2630362_2632096_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	35.5	4.6e-59
WP_011216252.1|2632182_2634048_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	32.8	1.3e-35
2634170:2634216	attL	CTCATAATCCGTTGGTCCTAGGTTCAAGTCCTAGTGGGCCCACCAAT	NA	NA	NA	NA
WP_187297743.1|2634306_2635434_-|integrase	site-specific integrase	integrase	A0A059VF45	Pseudomonas_phage	47.3	2.2e-86
WP_061466610.1|2635814_2636000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061466612.1|2635992_2636769_+	methylase	NA	NA	NA	NA	NA
WP_061634671.1|2636902_2637718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061466974.1|2637759_2639070_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061466975.1|2639199_2640681_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	24.8	9.4e-29
WP_061466976.1|2640834_2641077_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061466977.1|2641311_2641506_+	helix-turn-helix domain-containing protein	NA	A0A1B1IUF9	uncultured_Mediterranean_phage	60.3	4.8e-18
WP_061634672.1|2641533_2644809_+	DEAD/DEAH box helicase family protein	NA	A0A2K5B2B9	Erysipelothrix_phage	42.8	4.8e-235
WP_061466985.1|2644801_2645464_+	DUF4391 domain-containing protein	NA	NA	NA	NA	NA
WP_061634673.1|2645483_2647439_+	site-specific DNA-methyltransferase	NA	A0A2K5B2C1	Erysipelothrix_phage	36.1	2.0e-103
WP_061466981.1|2647456_2650489_+	DEAD/DEAH box helicase family protein	NA	A0A2K5B2C2	Erysipelothrix_phage	33.4	1.7e-130
WP_061634674.1|2650564_2652364_+	DUF4209 domain-containing protein	NA	NA	NA	NA	NA
WP_061466952.1|2652360_2653044_-	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	33.3	6.5e-17
WP_061466938.1|2653245_2654130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042234550.1|2654149_2654461_+	Vir protein	NA	NA	NA	NA	NA
WP_042234461.1|2654477_2654750_+	carbon storage regulator	NA	A0A0U1UNS3	Pseudomonas_phage	41.8	5.0e-05
WP_042234463.1|2654777_2655743_+	P-type conjugative transfer ATPase TrbB	NA	NA	NA	NA	NA
WP_042234466.1|2655754_2656132_+	TrbC/VirB2 family protein	NA	NA	NA	NA	NA
WP_061466939.1|2656128_2656428_+	VirB3 family type IV secretion system protein	NA	NA	NA	NA	NA
WP_061466940.1|2656424_2658959_+	conjugal transfer protein TrbE	NA	NA	NA	NA	NA
WP_061466941.1|2658955_2659654_+	conjugal transfer protein TrbF	NA	NA	NA	NA	NA
WP_061466942.1|2659650_2660526_+	P-type conjugative transfer protein TrbG	NA	NA	NA	NA	NA
WP_061466943.1|2660528_2660936_+	conjugal transfer protein TrbH	NA	NA	NA	NA	NA
WP_061466944.1|2660941_2662189_+	TrbI/VirB10 family protein	NA	NA	NA	NA	NA
WP_061466945.1|2662200_2662941_+	P-type conjugative transfer protein TrbJ	NA	NA	NA	NA	NA
WP_061466946.1|2662963_2663176_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061466947.1|2663180_2664563_+	P-type conjugative transfer protein TrbL	NA	NA	NA	NA	NA
WP_061466948.1|2664559_2666449_+	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_061466949.1|2666445_2666991_+	conjugative transfer signal peptidase TraF	NA	NA	NA	NA	NA
WP_187297749.1|2666987_2667152_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061466950.1|2667144_2669331_+	DUF1738 domain-containing protein	NA	A0A1B1IRD0	uncultured_Mediterranean_phage	33.9	1.1e-36
WP_061634675.1|2669460_2671056_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061466916.1|2671365_2673228_-	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_058450394.1|2673224_2673578_-	conjugal transfer transcriptional regulator TraJ	NA	NA	NA	NA	NA
WP_058450393.1|2673971_2674316_+	TraK family protein	NA	NA	NA	NA	NA
WP_058450392.1|2674315_2675041_+	conjugal transfer protein TraL	NA	NA	NA	NA	NA
WP_061466918.1|2675040_2675478_+	conjugal transfer protein TraM	NA	NA	NA	NA	NA
WP_061466920.1|2675725_2676787_-	DUF4116 domain-containing protein	NA	NA	NA	NA	NA
WP_080444600.1|2677209_2678844_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_040146985.1|2678798_2679191_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_058450390.1|2679672_2679915_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061466923.1|2680157_2682098_+	DUF2779 domain-containing protein	NA	NA	NA	NA	NA
WP_044496813.1|2682177_2683029_-	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_044496821.1|2683025_2683634_-	AbiEi antitoxin N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_058450388.1|2684441_2684846_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	33.1	1.1e-08
WP_080444601.1|2684803_2684929_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_044496812.1|2685053_2686106_+	LD-carboxypeptidase	NA	NA	NA	NA	NA
WP_061466925.1|2686112_2687330_-	MFS transporter	NA	NA	NA	NA	NA
WP_052585449.1|2687359_2688406_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A223W0B1	Agrobacterium_phage	32.4	1.5e-25
WP_061466927.1|2688407_2689472_-	ThiF family adenylyltransferase	NA	NA	NA	NA	NA
WP_015444121.1|2690355_2691531_-|transposase	ISL3 family transposase	transposase	A9YX10	Burkholderia_phage	23.2	3.8e-17
2690202:2690248	attR	CTCATAATCCGTTGGTCCTAGGTTCAAGTCCTAGTGGGCCCACCAAT	NA	NA	NA	NA
