The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP015954	Legionella pneumophila strain E7_O chromosome, complete genome	3425999	929763	936603	3425999		Acinetobacter_phage(42.86%)	9	NA	NA
WP_010946569.1|929763_930540_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	48.2	3.3e-57
WP_010946570.1|930532_931567_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	47.6	3.5e-75
WP_010946571.1|931544_932123_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	53.2	1.0e-55
WP_010946572.1|932156_932882_-	LPS export ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.3	3.1e-17
WP_010946573.1|932878_933388_-	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
WP_010946574.1|933368_933938_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_011213328.1|933934_934462_-	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	47.7	1.4e-27
WP_010946576.1|934475_935438_-	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	34.1	4.2e-38
WP_010946577.1|935805_936603_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	33.8	1.3e-21
>prophage 2
NZ_CP015954	Legionella pneumophila strain E7_O chromosome, complete genome	3425999	1319235	1325172	3425999		Staphylococcus_phage(50.0%)	6	NA	NA
WP_010946911.1|1319235_1320309_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	27.8	2.8e-30
WP_010946912.1|1320293_1320908_+	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	38.4	3.5e-22
WP_010946913.1|1320904_1322113_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.7	5.4e-99
WP_010946914.1|1322120_1322588_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	49.1	9.2e-23
WP_010946915.1|1322713_1324351_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	52.3	3.6e-154
WP_010946916.1|1324347_1325172_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	43.9	1.8e-53
>prophage 3
NZ_CP015954	Legionella pneumophila strain E7_O chromosome, complete genome	3425999	2230312	2240436	3425999		Bacillus_phage(16.67%)	7	NA	NA
WP_010947735.1|2230312_2232001_-	S8 family serine peptidase	NA	A0A1B0T6A2	Bacillus_phage	30.4	8.0e-16
WP_015444337.1|2232132_2233140_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_010947737.1|2233263_2234589_-	adenosylhomocysteinase	NA	S4VPF6	Pandoravirus	31.2	1.4e-47
WP_010947738.1|2234607_2235756_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	58.5	1.3e-126
WP_015444336.1|2235964_2237077_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	35.2	2.9e-51
WP_010947740.1|2237172_2238312_-	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	26.9	1.6e-23
WP_015444335.1|2238501_2240436_-	molecular chaperone DnaK	NA	G8DDB7	Micromonas_pusilla_virus	49.6	1.3e-147
>prophage 4
NZ_CP015954	Legionella pneumophila strain E7_O chromosome, complete genome	3425999	2282264	2337289	3425999	transposase	Wolbachia_phage(25.0%)	53	NA	NA
WP_010947782.1|2282264_2283716_+|transposase	IS4-like element ISLpn5 family transposase	transposase	Q9JMP3	Wolbachia_phage	56.8	6.1e-158
WP_010947783.1|2283786_2285307_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	48.2	7.9e-124
WP_010947785.1|2286154_2286529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010947786.1|2286726_2288334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015444248.1|2288336_2288828_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010947788.1|2288838_2289675_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	48.9	4.9e-67
WP_010947789.1|2290267_2291359_-	DUF4917 family protein	NA	NA	NA	NA	NA
WP_010947790.1|2291590_2297536_-	conjugative transfer relaxase/helicase TraI	NA	NA	NA	NA	NA
WP_010947791.1|2297556_2299449_-	type IV conjugative transfer system coupling protein TraD	NA	NA	NA	NA	NA
WP_021437030.1|2299513_2299978_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015444244.1|2299981_2302702_-	conjugal transfer protein TraG N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_010947793.1|2302707_2304093_-	conjugal transfer protein TraH	NA	NA	NA	NA	NA
WP_010947794.1|2304089_2304512_-	type-F conjugative transfer system pilin assembly thiol-disulfide isomerase TrbB	NA	NA	NA	NA	NA
WP_010947795.1|2304501_2305284_-	type-F conjugative transfer system pilin assembly protein TraF	NA	NA	NA	NA	NA
WP_010947796.1|2305276_2307088_-	type-F conjugative transfer system mating-pair stabilization protein TraN	NA	NA	NA	NA	NA
WP_015444243.1|2307087_2307756_-	type-F conjugative transfer system pilin assembly protein TrbC	NA	NA	NA	NA	NA
WP_010947798.1|2307771_2308767_-	TraU family protein	NA	NA	NA	NA	NA
WP_010947799.1|2308763_2309372_-	type-F conjugative transfer system protein TraW	NA	NA	NA	NA	NA
WP_015444242.1|2309368_2309704_-	TrbI F-type domain-containing protein	NA	NA	NA	NA	NA
WP_015444241.1|2309696_2312249_-	type IV secretion system protein TraC	NA	NA	NA	NA	NA
WP_010947801.1|2312260_2312611_-	type IV conjugative transfer system lipoprotein TraV	NA	NA	NA	NA	NA
WP_015444240.1|2312624_2313911_-	TraB/VirB10 family protein	NA	NA	NA	NA	NA
WP_010947803.1|2313912_2314626_-	type-F conjugative transfer system secretin TraK	NA	NA	NA	NA	NA
WP_010947804.1|2314628_2315192_-	type IV conjugative transfer system protein TraE	NA	NA	NA	NA	NA
WP_010947805.1|2315195_2315489_-	type IV conjugative transfer system protein TraL	NA	NA	NA	NA	NA
WP_010947806.1|2315490_2315793_-	fimbrial protein	NA	NA	NA	NA	NA
WP_010947807.1|2315807_2316044_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	52.9	2.5e-08
WP_025520140.1|2316057_2316435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010947808.1|2316382_2317267_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015444237.1|2317439_2318120_+	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	28.1	1.6e-07
WP_016356978.1|2318268_2318943_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_010947811.1|2319391_2319964_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_015444236.1|2319947_2320445_+	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_010947813.1|2320437_2321025_-	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_010947814.1|2321029_2323165_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_010947815.1|2323183_2324065_-	sterol desaturase family protein	NA	NA	NA	NA	NA
WP_010947816.1|2324171_2324318_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010947817.1|2324509_2324686_+	MAPEG family protein	NA	NA	NA	NA	NA
WP_010947818.1|2324855_2325353_-	DoxX family protein	NA	NA	NA	NA	NA
WP_010947819.1|2325342_2326122_-	DUF2063 domain-containing protein	NA	NA	NA	NA	NA
WP_010947820.1|2326114_2326969_-	DUF692 domain-containing protein	NA	NA	NA	NA	NA
WP_010947821.1|2326983_2327277_-	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_010947822.1|2327466_2327988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015444234.1|2328292_2328751_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015444232.1|2329324_2329552_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010947824.1|2329709_2330231_-	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_010947825.1|2330402_2330957_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_010947826.1|2331390_2331591_+	ATP-dependent DNA helicase	NA	NA	NA	NA	NA
WP_010947827.1|2331684_2332068_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_010947828.1|2332121_2333075_-	Abi family protein	NA	A3QSC6	Clostridium_virus	31.8	4.8e-34
WP_015444229.1|2333584_2335003_+|transposase	IS4-like element ISLpn3 family transposase	transposase	Q9JMP3	Wolbachia_phage	32.9	2.3e-56
WP_010947829.1|2335035_2336211_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	21.2	5.2e-14
WP_010947830.1|2336263_2337289_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP015954	Legionella pneumophila strain E7_O chromosome, complete genome	3425999	2634437	2697706	3425999	transposase,integrase,protease,tRNA	Erysipelothrix_phage(18.75%)	57	2640345:2640391	2696377:2696423
WP_010948063.1|2634437_2635439_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	50.7	5.8e-91
WP_010948064.1|2635643_2635883_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_010948065.1|2636085_2636529_+	lpg2359 family Dot/Icm T4SS effector	NA	A0A292GL36	Xanthomonas_phage	43.8	6.3e-21
WP_014842314.1|2636537_2638271_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	35.5	4.6e-59
WP_011216252.1|2638357_2640223_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	32.8	1.3e-35
2640345:2640391	attL	CTCATAATCCGTTGGTCCTAGGTTCAAGTCCTAGTGGGCCCACCAAT	NA	NA	NA	NA
WP_187297743.1|2640481_2641609_-|integrase	site-specific integrase	integrase	A0A059VF45	Pseudomonas_phage	47.3	2.2e-86
WP_061466610.1|2641989_2642175_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061466612.1|2642167_2642944_+	methylase	NA	NA	NA	NA	NA
WP_061634671.1|2643077_2643893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061466974.1|2643934_2645245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061466975.1|2645374_2646856_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	24.8	9.4e-29
WP_061466976.1|2647009_2647252_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061466977.1|2647486_2647681_+	helix-turn-helix domain-containing protein	NA	A0A1B1IUF9	uncultured_Mediterranean_phage	60.3	4.8e-18
WP_061634672.1|2647708_2650984_+	DEAD/DEAH box helicase family protein	NA	A0A2K5B2B9	Erysipelothrix_phage	42.8	4.8e-235
WP_061466985.1|2650976_2651639_+	DUF4391 domain-containing protein	NA	NA	NA	NA	NA
WP_061634673.1|2651658_2653614_+	site-specific DNA-methyltransferase	NA	A0A2K5B2C1	Erysipelothrix_phage	36.1	2.0e-103
WP_061466981.1|2653631_2656664_+	DEAD/DEAH box helicase family protein	NA	A0A2K5B2C2	Erysipelothrix_phage	33.4	1.7e-130
WP_061634674.1|2656739_2658539_+	DUF4209 domain-containing protein	NA	NA	NA	NA	NA
WP_061466952.1|2658535_2659219_-	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	33.3	6.5e-17
WP_061466938.1|2659420_2660305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042234550.1|2660324_2660636_+	Vir protein	NA	NA	NA	NA	NA
WP_042234461.1|2660652_2660925_+	carbon storage regulator	NA	A0A0U1UNS3	Pseudomonas_phage	41.8	5.0e-05
WP_042234463.1|2660952_2661918_+	P-type conjugative transfer ATPase TrbB	NA	NA	NA	NA	NA
WP_070065774.1|2661929_2662307_+	TrbC/VirB2 family protein	NA	NA	NA	NA	NA
WP_061466939.1|2662303_2662603_+	VirB3 family type IV secretion system protein	NA	NA	NA	NA	NA
WP_061466940.1|2662599_2665134_+	conjugal transfer protein TrbE	NA	NA	NA	NA	NA
WP_061466941.1|2665130_2665829_+	conjugal transfer protein TrbF	NA	NA	NA	NA	NA
WP_061466942.1|2665825_2666701_+	P-type conjugative transfer protein TrbG	NA	NA	NA	NA	NA
WP_061466943.1|2666703_2667111_+	conjugal transfer protein TrbH	NA	NA	NA	NA	NA
WP_070065775.1|2667116_2668364_+	TrbI/VirB10 family protein	NA	NA	NA	NA	NA
WP_061466945.1|2668375_2669116_+	P-type conjugative transfer protein TrbJ	NA	NA	NA	NA	NA
WP_061466946.1|2669138_2669351_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061466947.1|2669355_2670738_+	P-type conjugative transfer protein TrbL	NA	NA	NA	NA	NA
WP_061466948.1|2670734_2672624_+	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_061466949.1|2672620_2673166_+	conjugative transfer signal peptidase TraF	NA	NA	NA	NA	NA
WP_187297749.1|2673162_2673327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061466950.1|2673319_2675506_+	DUF1738 domain-containing protein	NA	A0A1B1IRD0	uncultured_Mediterranean_phage	33.9	1.1e-36
WP_061634675.1|2675635_2677231_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061466916.1|2677540_2679403_-	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_058450394.1|2679399_2679753_-	conjugal transfer transcriptional regulator TraJ	NA	NA	NA	NA	NA
WP_058450393.1|2680146_2680491_+	TraK family protein	NA	NA	NA	NA	NA
WP_058450392.1|2680490_2681216_+	conjugal transfer protein TraL	NA	NA	NA	NA	NA
WP_061466918.1|2681215_2681653_+	conjugal transfer protein TraM	NA	NA	NA	NA	NA
WP_061466920.1|2681900_2682962_-	DUF4116 domain-containing protein	NA	NA	NA	NA	NA
WP_080444600.1|2683384_2685019_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_040146985.1|2684973_2685366_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_058450390.1|2685847_2686090_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061466923.1|2686332_2688273_+	DUF2779 domain-containing protein	NA	NA	NA	NA	NA
WP_044496813.1|2688352_2689204_-	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_044496821.1|2689200_2689809_-	AbiEi antitoxin N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_058450388.1|2690616_2691021_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	33.1	1.1e-08
WP_080444601.1|2690978_2691104_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_044496812.1|2691228_2692281_+	LD-carboxypeptidase	NA	NA	NA	NA	NA
WP_061466925.1|2692287_2693505_-	MFS transporter	NA	NA	NA	NA	NA
WP_145923833.1|2693534_2694494_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A223W0B1	Agrobacterium_phage	32.4	1.4e-25
WP_061466927.1|2694582_2695647_-	ThiF family adenylyltransferase	NA	NA	NA	NA	NA
WP_015444121.1|2696530_2697706_-|transposase	ISL3 family transposase	transposase	A9YX10	Burkholderia_phage	23.2	3.8e-17
2696377:2696423	attR	CTCATAATCCGTTGGTCCTAGGTTCAAGTCCTAGTGGGCCCACCAAT	NA	NA	NA	NA
