The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP015955	Legionella pneumophila strain E8_O chromosome, complete genome	3455562	959354	966194	3455562		Acinetobacter_phage(42.86%)	9	NA	NA
WP_010946569.1|959354_960131_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	48.2	3.3e-57
WP_010946570.1|960123_961158_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	47.6	3.5e-75
WP_010946571.1|961135_961714_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	53.2	1.0e-55
WP_010946572.1|961747_962473_-	LPS export ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.3	3.1e-17
WP_010946573.1|962469_962979_-	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
WP_010946574.1|962959_963529_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_011213328.1|963525_964053_-	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	47.7	1.4e-27
WP_010946576.1|964066_965029_-	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	34.1	4.2e-38
WP_010946577.1|965396_966194_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	33.8	1.3e-21
>prophage 2
NZ_CP015955	Legionella pneumophila strain E8_O chromosome, complete genome	3455562	1348826	1354763	3455562		Staphylococcus_phage(50.0%)	6	NA	NA
WP_010946911.1|1348826_1349900_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	27.8	2.8e-30
WP_010946912.1|1349884_1350499_+	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	38.4	3.5e-22
WP_010946913.1|1350495_1351704_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.7	5.4e-99
WP_010946914.1|1351711_1352179_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	49.1	9.2e-23
WP_010946915.1|1352304_1353942_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	52.3	3.6e-154
WP_010946916.1|1353938_1354763_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	43.9	1.8e-53
>prophage 3
NZ_CP015955	Legionella pneumophila strain E8_O chromosome, complete genome	3455562	2258302	2268426	3455562		Bacillus_phage(16.67%)	7	NA	NA
WP_010947735.1|2258302_2259991_-	S8 family serine peptidase	NA	A0A1B0T6A2	Bacillus_phage	30.4	8.0e-16
WP_015444337.1|2260122_2261130_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_010947737.1|2261253_2262579_-	adenosylhomocysteinase	NA	S4VPF6	Pandoravirus	31.2	1.4e-47
WP_010947738.1|2262597_2263746_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	58.5	1.3e-126
WP_015444336.1|2263954_2265067_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	35.2	2.9e-51
WP_010947740.1|2265162_2266302_-	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	26.9	1.6e-23
WP_015444335.1|2266491_2268426_-	molecular chaperone DnaK	NA	G8DDB7	Micromonas_pusilla_virus	49.6	1.3e-147
>prophage 4
NZ_CP015955	Legionella pneumophila strain E8_O chromosome, complete genome	3455562	2310254	2365279	3455562	transposase	Wolbachia_phage(25.0%)	53	NA	NA
WP_010947782.1|2310254_2311706_+|transposase	IS4-like element ISLpn5 family transposase	transposase	Q9JMP3	Wolbachia_phage	56.8	6.1e-158
WP_070065721.1|2311776_2313297_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	48.2	7.9e-124
WP_010947785.1|2314144_2314519_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010947786.1|2314716_2316324_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015444248.1|2316326_2316818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010947788.1|2316828_2317665_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	48.9	4.9e-67
WP_010947789.1|2318257_2319349_-	DUF4917 family protein	NA	NA	NA	NA	NA
WP_010947790.1|2319580_2325526_-	conjugative transfer relaxase/helicase TraI	NA	NA	NA	NA	NA
WP_010947791.1|2325546_2327439_-	type IV conjugative transfer system coupling protein TraD	NA	NA	NA	NA	NA
WP_021437030.1|2327503_2327968_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015444244.1|2327971_2330692_-	conjugal transfer protein TraG N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_010947793.1|2330697_2332083_-	conjugal transfer protein TraH	NA	NA	NA	NA	NA
WP_010947794.1|2332079_2332502_-	type-F conjugative transfer system pilin assembly thiol-disulfide isomerase TrbB	NA	NA	NA	NA	NA
WP_010947795.1|2332491_2333274_-	type-F conjugative transfer system pilin assembly protein TraF	NA	NA	NA	NA	NA
WP_010947796.1|2333266_2335078_-	type-F conjugative transfer system mating-pair stabilization protein TraN	NA	NA	NA	NA	NA
WP_015444243.1|2335077_2335746_-	type-F conjugative transfer system pilin assembly protein TrbC	NA	NA	NA	NA	NA
WP_010947798.1|2335761_2336757_-	TraU family protein	NA	NA	NA	NA	NA
WP_010947799.1|2336753_2337362_-	type-F conjugative transfer system protein TraW	NA	NA	NA	NA	NA
WP_015444242.1|2337358_2337694_-	TrbI F-type domain-containing protein	NA	NA	NA	NA	NA
WP_015444241.1|2337686_2340239_-	type IV secretion system protein TraC	NA	NA	NA	NA	NA
WP_010947801.1|2340250_2340601_-	type IV conjugative transfer system lipoprotein TraV	NA	NA	NA	NA	NA
WP_015444240.1|2340614_2341901_-	TraB/VirB10 family protein	NA	NA	NA	NA	NA
WP_010947803.1|2341902_2342616_-	type-F conjugative transfer system secretin TraK	NA	NA	NA	NA	NA
WP_010947804.1|2342618_2343182_-	type IV conjugative transfer system protein TraE	NA	NA	NA	NA	NA
WP_010947805.1|2343185_2343479_-	type IV conjugative transfer system protein TraL	NA	NA	NA	NA	NA
WP_010947806.1|2343480_2343783_-	fimbrial protein	NA	NA	NA	NA	NA
WP_010947807.1|2343797_2344034_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	52.9	2.5e-08
WP_025520140.1|2344047_2344425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010947808.1|2344372_2345257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015444237.1|2345429_2346110_+	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	28.1	1.6e-07
WP_016356978.1|2346258_2346933_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_010947811.1|2347381_2347954_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_015444236.1|2347937_2348435_+	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_010947813.1|2348427_2349015_-	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_010947814.1|2349019_2351155_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_010947815.1|2351173_2352055_-	sterol desaturase family protein	NA	NA	NA	NA	NA
WP_010947816.1|2352161_2352308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010947817.1|2352499_2352676_+	MAPEG family protein	NA	NA	NA	NA	NA
WP_010947818.1|2352845_2353343_-	DoxX family protein	NA	NA	NA	NA	NA
WP_010947819.1|2353332_2354112_-	DUF2063 domain-containing protein	NA	NA	NA	NA	NA
WP_010947820.1|2354104_2354959_-	DUF692 domain-containing protein	NA	NA	NA	NA	NA
WP_010947821.1|2354973_2355267_-	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_010947822.1|2355456_2355978_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015444234.1|2356282_2356741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015444232.1|2357314_2357542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010947824.1|2357699_2358221_-	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_010947825.1|2358392_2358947_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_010947826.1|2359380_2359581_+	ATP-dependent DNA helicase	NA	NA	NA	NA	NA
WP_010947827.1|2359674_2360058_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_010947828.1|2360111_2361065_-	Abi family protein	NA	A3QSC6	Clostridium_virus	31.8	4.8e-34
WP_015444229.1|2361574_2362993_+|transposase	IS4-like element ISLpn3 family transposase	transposase	Q9JMP3	Wolbachia_phage	32.9	2.3e-56
WP_010947829.1|2363025_2364201_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	21.2	5.2e-14
WP_010947830.1|2364253_2365279_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP015955	Legionella pneumophila strain E8_O chromosome, complete genome	3455562	2662427	2725696	3455562	tRNA,transposase,integrase,protease	Erysipelothrix_phage(18.75%)	57	2668335:2668381	2724367:2724413
WP_010948063.1|2662427_2663429_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	50.7	5.8e-91
WP_010948064.1|2663633_2663873_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_010948065.1|2664075_2664519_+	lpg2359 family Dot/Icm T4SS effector	NA	A0A292GL36	Xanthomonas_phage	43.8	6.3e-21
WP_014842314.1|2664527_2666261_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	35.5	4.6e-59
WP_011216252.1|2666347_2668213_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	32.8	1.3e-35
2668335:2668381	attL	CTCATAATCCGTTGGTCCTAGGTTCAAGTCCTAGTGGGCCCACCAAT	NA	NA	NA	NA
WP_187297743.1|2668471_2669599_-|integrase	site-specific integrase	integrase	A0A059VF45	Pseudomonas_phage	47.3	2.2e-86
WP_061466610.1|2669979_2670165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061466612.1|2670157_2670934_+	methylase	NA	NA	NA	NA	NA
WP_061634671.1|2671067_2671883_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061466974.1|2671924_2673235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061466975.1|2673364_2674846_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	24.8	9.4e-29
WP_061466976.1|2674999_2675242_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061466977.1|2675476_2675671_+	helix-turn-helix domain-containing protein	NA	A0A1B1IUF9	uncultured_Mediterranean_phage	60.3	4.8e-18
WP_061634672.1|2675698_2678974_+	DEAD/DEAH box helicase family protein	NA	A0A2K5B2B9	Erysipelothrix_phage	42.8	4.8e-235
WP_061466985.1|2678966_2679629_+	DUF4391 domain-containing protein	NA	NA	NA	NA	NA
WP_061634673.1|2679648_2681604_+	site-specific DNA-methyltransferase	NA	A0A2K5B2C1	Erysipelothrix_phage	36.1	2.0e-103
WP_061466981.1|2681621_2684654_+	DEAD/DEAH box helicase family protein	NA	A0A2K5B2C2	Erysipelothrix_phage	33.4	1.7e-130
WP_061634674.1|2684729_2686529_+	DUF4209 domain-containing protein	NA	NA	NA	NA	NA
WP_061466952.1|2686525_2687209_-	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	33.3	6.5e-17
WP_061466938.1|2687410_2688295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042234550.1|2688314_2688626_+	Vir protein	NA	NA	NA	NA	NA
WP_042234461.1|2688642_2688915_+	carbon storage regulator	NA	A0A0U1UNS3	Pseudomonas_phage	41.8	5.0e-05
WP_042234463.1|2688942_2689908_+	P-type conjugative transfer ATPase TrbB	NA	NA	NA	NA	NA
WP_042234466.1|2689919_2690297_+	TrbC/VirB2 family protein	NA	NA	NA	NA	NA
WP_061466939.1|2690293_2690593_+	VirB3 family type IV secretion system protein	NA	NA	NA	NA	NA
WP_061466940.1|2690589_2693124_+	conjugal transfer protein TrbE	NA	NA	NA	NA	NA
WP_061466941.1|2693120_2693819_+	conjugal transfer protein TrbF	NA	NA	NA	NA	NA
WP_061466942.1|2693815_2694691_+	P-type conjugative transfer protein TrbG	NA	NA	NA	NA	NA
WP_061466943.1|2694693_2695101_+	conjugal transfer protein TrbH	NA	NA	NA	NA	NA
WP_061466944.1|2695106_2696354_+	TrbI/VirB10 family protein	NA	NA	NA	NA	NA
WP_061466945.1|2696365_2697106_+	P-type conjugative transfer protein TrbJ	NA	NA	NA	NA	NA
WP_061466946.1|2697128_2697341_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061466947.1|2697345_2698728_+	P-type conjugative transfer protein TrbL	NA	NA	NA	NA	NA
WP_061466948.1|2698724_2700614_+	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_061466949.1|2700610_2701156_+	conjugative transfer signal peptidase TraF	NA	NA	NA	NA	NA
WP_187297749.1|2701152_2701317_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061466950.1|2701309_2703496_+	DUF1738 domain-containing protein	NA	A0A1B1IRD0	uncultured_Mediterranean_phage	33.9	1.1e-36
WP_061634675.1|2703625_2705221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070065722.1|2705530_2707393_-	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_058450394.1|2707389_2707743_-	conjugal transfer transcriptional regulator TraJ	NA	NA	NA	NA	NA
WP_058450393.1|2708136_2708481_+	TraK family protein	NA	NA	NA	NA	NA
WP_058450392.1|2708480_2709206_+	conjugal transfer protein TraL	NA	NA	NA	NA	NA
WP_061466918.1|2709205_2709643_+	conjugal transfer protein TraM	NA	NA	NA	NA	NA
WP_061466920.1|2709890_2710952_-	DUF4116 domain-containing protein	NA	NA	NA	NA	NA
WP_080444600.1|2711374_2713009_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_040146985.1|2712963_2713356_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_058450390.1|2713837_2714080_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061466923.1|2714322_2716263_+	DUF2779 domain-containing protein	NA	NA	NA	NA	NA
WP_044496813.1|2716342_2717194_-	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_044496821.1|2717190_2717799_-	AbiEi antitoxin N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_058450388.1|2718606_2719011_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	33.1	1.1e-08
WP_080444601.1|2718968_2719094_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_044496812.1|2719218_2720271_+	LD-carboxypeptidase	NA	NA	NA	NA	NA
WP_061466925.1|2720277_2721495_-	MFS transporter	NA	NA	NA	NA	NA
WP_052585449.1|2721524_2722571_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A223W0B1	Agrobacterium_phage	32.4	1.5e-25
WP_061466927.1|2722572_2723637_-	ThiF family adenylyltransferase	NA	NA	NA	NA	NA
WP_015444121.1|2724520_2725696_-|transposase	ISL3 family transposase	transposase	A9YX10	Burkholderia_phage	23.2	3.8e-17
2724367:2724413	attR	CTCATAATCCGTTGGTCCTAGGTTCAAGTCCTAGTGGGCCCACCAAT	NA	NA	NA	NA
