The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP017436	Escherichia coli O157:H7 strain 2149 chromosome, complete genome	5408208	1226689	1233740	5408208	tail,transposase	Enterobacteria_phage(50.0%)	8	NA	NA
WP_162829202.1|1226689_1227903_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001023396.1|1228120_1228390_+|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
WP_000442132.1|1228550_1228973_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	97.0	5.7e-72
WP_001301665.1|1229102_1230161_-	T3SS effector EspW	NA	NA	NA	NA	NA
WP_001144077.1|1230239_1230890_-	T3SS effector NleG family protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
WP_001132157.1|1231072_1231663_+	T3SS effector guanine nucleotide exchange factor EspM2	NA	NA	NA	NA	NA
WP_001217542.1|1232164_1232413_-	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_000162574.1|1233257_1233740_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
>prophage 2
NZ_CP017436	Escherichia coli O157:H7 strain 2149 chromosome, complete genome	5408208	1512636	1519375	5408208	integrase,transposase	Enterobacteria_phage(50.0%)	6	1500310:1500326	1521571:1521587
1500310:1500326	attL	GGTTGTCGATACCAATA	NA	NA	NA	NA
WP_000950857.1|1512636_1513206_+	hypothetical protein	NA	Q716G6	Shigella_phage	99.3	4.6e-69
WP_162829202.1|1513345_1514558_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000960724.1|1514972_1515653_+	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	71.0	1.8e-59
WP_000257010.1|1515662_1516799_+	phage DNA ejection protein	NA	Q716G3	Shigella_phage	72.8	1.4e-80
WP_000958700.1|1516973_1518131_-|integrase	prophage integrase IntS	integrase	E7DYQ6	Enterobacteria_phage	100.0	2.2e-222
WP_000368131.1|1518442_1519375_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
1521571:1521587	attR	GGTTGTCGATACCAATA	NA	NA	NA	NA
>prophage 3
NZ_CP017436	Escherichia coli O157:H7 strain 2149 chromosome, complete genome	5408208	1744669	1835503	5408208	portal,holin,tail,transposase,tRNA,lysis,protease,terminase	Enterobacteria_phage(54.0%)	83	NA	NA
WP_000968210.1|1744669_1745365_-|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
WP_001299855.1|1745361_1745760_-	CidA/LrgA family protein	NA	NA	NA	NA	NA
WP_000024633.1|1745890_1746799_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000194233.1|1746925_1748284_+	aromatic acid/H+ symport family MFS transporter	NA	NA	NA	NA	NA
WP_000131688.1|1748295_1749324_+	gentisate 1,2-dioxygenase	NA	NA	NA	NA	NA
WP_000196038.1|1749338_1750040_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_000781198.1|1750048_1750693_+	maleylacetoacetate isomerase	NA	NA	NA	NA	NA
WP_000170147.1|1750707_1751901_+	3-hydroxybenzoate 6-monooxygenase	NA	NA	NA	NA	NA
WP_001264864.1|1752060_1753011_+|tRNA	tRNA dihydrouridine(16) synthase DusC	tRNA	NA	NA	NA	NA
WP_000691708.1|1753398_1753482_-	protein YohP	NA	NA	NA	NA	NA
WP_001078131.1|1753705_1755142_+	multidrug resistance outer membrane protein MdtQ	NA	NA	NA	NA	NA
WP_000079550.1|1755194_1755956_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001301775.1|1756085_1756664_-	DedA family protein	NA	NA	NA	NA	NA
WP_003575553.1|1756833_1757421_+	YIP1 family protein	NA	NA	NA	NA	NA
WP_001295432.1|1757594_1758527_+	D-alanyl-D-alanine endopeptidase	NA	NA	NA	NA	NA
WP_000097342.1|1758564_1760280_-	D-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_000871478.1|1760475_1762773_+	beta-glucosidase BglX	NA	NA	NA	NA	NA
WP_001131252.1|1763024_1763942_+	glycine betaine ABC transporter substrate-binding protein OsmF	NA	NA	NA	NA	NA
WP_000221794.1|1763948_1765106_+	glycine betaine ABC transporter permease YehY	NA	NA	NA	NA	NA
WP_000569336.1|1765098_1766025_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
WP_000783120.1|1766029_1766761_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1766741_1766849_-	protein YohO	NA	NA	NA	NA	NA
WP_027868261.1|1766908_1767610_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	100.0	4.6e-103
WP_171878939.1|1768748_1769961_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	98.3	2.7e-167
WP_001301135.1|1770281_1770431_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070080197.1|1770488_1772015_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.9	7.9e-31
WP_001053042.1|1772516_1772972_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	7.0e-60
WP_000224907.1|1772971_1773142_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_000774495.1|1773134_1773425_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	93.8	1.3e-46
WP_001099699.1|1773421_1773784_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	97.4	2.5e-60
WP_000971055.1|1773780_1773921_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001204769.1|1774006_1774441_+	antitermination protein	NA	G9L695	Escherichia_phage	97.2	1.3e-79
WP_001356551.1|1774692_1774845_+	DNA methylase	NA	A0A2R2Z327	Escherichia_phage	100.0	4.0e-20
WP_000142932.1|1775648_1777595_+	DUF1737 domain-containing protein	NA	A0A075M342	Escherichia_Stx1-converting_recombinant_phage	98.1	0.0e+00
WP_000143458.1|1777732_1777912_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290230.1|1777952_1778198_+	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000284506.1|1778275_1778491_+|holin	class II holin family protein	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_000087728.1|1778495_1779029_+	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	100.0	1.8e-102
WP_001056806.1|1779299_1779869_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|1779868_1780015_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|1780242_1780428_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000348565.1|1780945_1781422_+	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	100.0	2.1e-83
WP_001077630.1|1781418_1783542_+|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	99.9	0.0e+00
WP_000102415.1|1783538_1783751_+	hypothetical protein	NA	S5MBY8	Escherichia_phage	98.6	3.0e-29
WP_000974564.1|1783750_1785253_+|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	100.0	4.8e-291
WP_001114424.1|1785197_1787222_+|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.8	0.0e+00
WP_001097065.1|1787309_1787636_+	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001281347.1|1787628_1787910_+	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	98.9	1.3e-45
WP_000974959.1|1787912_1788536_+|tail	phage tail protein	tail	Q8VNN3	Enterobacteria_phage	99.0	9.8e-105
WP_000682716.1|1788548_1788947_+|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000235098.1|1788954_1789707_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	99.2	4.9e-135
WP_000479039.1|1789720_1790149_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	98.6	1.7e-71
WP_000532075.1|1790175_1790484_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	99.0	3.0e-54
WP_064032219.1|1790527_1793173_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	99.8	0.0e+00
WP_000847314.1|1793169_1793499_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	99.1	2.1e-58
WP_001151105.1|1793498_1794197_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_070080198.1|1794202_1794946_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.2	4.1e-150
WP_140395871.1|1794891_1795521_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.0	1.9e-103
WP_070080200.1|1795761_1799241_+	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	98.4	0.0e+00
WP_001230468.1|1799307_1799907_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	99.5	6.7e-111
WP_070080201.1|1799971_1801285_+|tail	phage tail protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.3	2.8e-77
WP_001023407.1|1801286_1801556_+|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_075702011.1|1801716_1802133_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	99.3	1.4e-75
WP_001143784.1|1802214_1802856_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	100.0	6.8e-109
WP_001261939.1|1803017_1803266_-	DinI-like family protein	NA	B6DZC1	Enterobacteria_phage	100.0	1.4e-38
WP_001301761.1|1803780_1805466_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	100.0	1.7e-305
WP_000598641.1|1805462_1806182_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1806228_1806699_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|1806740_1807202_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001459147.1|1807326_1809330_-	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	99.9	0.0e+00
WP_001302810.1|1809326_1810463_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	100.0	1.9e-167
WP_000528951.1|1810455_1811187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001294377.1|1811205_1812735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001302026.1|1812745_1813834_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_000636932.1|1815074_1815392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000356841.1|1815453_1819083_-	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_001301615.1|1826040_1828074_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.4e-54
WP_001005448.1|1828205_1829315_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_010904812.1|1829576_1829858_+	DUF2574 family protein	NA	NA	NA	NA	NA
WP_000682830.1|1830149_1830692_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000677409.1|1830779_1831454_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000945390.1|1831469_1833950_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_162829202.1|1834290_1835503_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
>prophage 4
NZ_CP017436	Escherichia coli O157:H7 strain 2149 chromosome, complete genome	5408208	1944314	2023755	5408208	head,holin,tail,transposase,integrase,lysis,protease,terminase	Stx2-converting_phage(50.59%)	99	1935265:1935279	1950692:1950706
1935265:1935279	attL	GGCCGTACTGGTTGG	NA	NA	NA	NA
WP_001007947.1|1944314_1945493_+|integrase	site-specific integrase	integrase	A0A0P0ZDN8	Stx2-converting_phage	100.0	1.8e-232
WP_000132739.1|1945473_1945665_-	AlpA family phage regulatory protein	NA	A0A0P0ZBL0	Stx2-converting_phage	100.0	1.7e-31
WP_001281188.1|1945746_1946091_-	hypothetical protein	NA	A0A0P0ZB93	Stx2-converting_phage	100.0	9.0e-60
WP_000610373.1|1946278_1946629_-	DUF551 domain-containing protein	NA	A0A0N7KZ94	Stx2-converting_phage	100.0	7.8e-67
WP_000207903.1|1946625_1946982_-	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	100.0	3.1e-63
WP_001289954.1|1947495_1948443_-	ead/Ea22-like family protein	NA	A0A0P0ZE96	Stx2-converting_phage	100.0	3.6e-183
WP_000763383.1|1948439_1948661_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_000188870.1|1948759_1948975_-	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	100.0	1.0e-32
WP_000548528.1|1949051_1949243_-	DUF1382 family protein	NA	A0A0P0ZC60	Stx2-converting_phage	100.0	5.6e-27
WP_000682306.1|1949215_1949398_-	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	100.0	4.3e-29
WP_000186812.1|1949394_1950075_-	YqaJ viral recombinase family protein	NA	A0A0N6WET1	Escherichia_phage	100.0	1.6e-132
WP_001302855.1|1950071_1950857_-	phage recombination protein Bet	NA	A0A0N7BTT9	Escherichia_phage	100.0	6.3e-149
1950692:1950706	attR	GGCCGTACTGGTTGG	NA	NA	NA	NA
WP_162829202.1|1951132_1952345_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000372937.1|1952546_1952690_-	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
WP_001198861.1|1952658_1952823_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000065362.1|1952895_1953264_-	DUF2528 family protein	NA	A0A0N7C1W2	Escherichia_phage	100.0	2.0e-65
WP_000394299.1|1953446_1953698_-	hypothetical protein	NA	A4KWV4	Enterobacteria_phage	100.0	5.6e-43
WP_000088203.1|1953756_1954029_-	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	100.0	5.7e-41
WP_000438343.1|1954006_1954189_-	hypothetical protein	NA	A0A0N7C057	Escherichia_phage	100.0	2.8e-28
WP_001130059.1|1954757_1955279_-	hypothetical protein	NA	A0A0N7BTU4	Escherichia_phage	100.0	1.8e-88
WP_171878941.1|1955460_1956673_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	6.5e-169
WP_001302016.1|1957093_1957789_-	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	100.0	8.6e-134
WP_000067727.1|1957863_1958079_+	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_000442612.1|1958220_1958517_+	hypothetical protein	NA	A4KWW1	Enterobacteria_phage	100.0	4.0e-48
WP_000166961.1|1958549_1958711_+	hypothetical protein	NA	Q76H53	Enterobacteria_phage	100.0	1.3e-21
WP_000539352.1|1958697_1959519_+	replication protein	NA	A0A0N7KZ97	Stx2-converting_phage	99.6	4.4e-153
WP_001248388.1|1959515_1960892_+	AAA family ATPase	NA	A0A0P0ZC27	Stx2-converting_phage	100.0	5.7e-254
WP_001000130.1|1960962_1961241_+	hypothetical protein	NA	Q9EYB9	Enterobacteria_phage	100.0	4.4e-49
WP_000103678.1|1961373_1961589_+	hypothetical protein	NA	A0A0N7KZ98	Stx2-converting_phage	100.0	7.7e-33
WP_001449504.1|1961599_1961836_+	restriction alleviation protein, Lar family	NA	Q687G3	Enterobacteria_phage	100.0	9.3e-40
WP_001303571.1|1961792_1962239_+	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	100.0	2.4e-81
WP_000153268.1|1962235_1962763_+	phage N-6-adenine-methyltransferase	NA	Q9EYC2	Enterobacteria_phage	100.0	1.6e-100
WP_001254256.1|1962759_1962942_+	NinE family protein	NA	A0A0N7C1X3	Escherichia_phage	100.0	5.7e-29
WP_000211413.1|1963216_1963921_+	phage antirepressor Ant	NA	Q8VNP5	Enterobacteria_phage	100.0	9.6e-133
WP_001108016.1|1964718_1965324_+	recombination protein NinG	NA	H6WZJ3	Escherichia_phage	99.5	4.3e-97
WP_001028855.1|1965320_1965992_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.6	9.2e-133
WP_000512807.1|1965982_1966471_+	late gene antiterminator protein	NA	Q5TJL7	Enterobacteria_phage	100.0	7.0e-90
WP_000649751.1|1967109_1968069_+	Shiga toxin Stx2c subunit A	NA	Q5TJL6	Enterobacteria_phage	100.0	4.3e-176
WP_000738080.1|1968080_1968350_+	Shiga toxin Stx2c subunit B	NA	Q5TJL5	Enterobacteria_phage	100.0	2.1e-43
WP_001303568.1|1968646_1968970_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	100.0	6.9e-62
WP_021503541.1|1969213_1971151_+	SASA family carbohydrate esterase	NA	A0A0P0ZDW4	Stx2-converting_phage	99.8	0.0e+00
WP_000143458.1|1971288_1971468_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290231.1|1971508_1971781_+	DUF826 domain-containing protein	NA	A0A0P0ZBB8	Stx2-converting_phage	100.0	2.2e-21
WP_000284515.1|1971857_1972073_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.0e-33
WP_000075132.1|1972072_1972570_+	lysozyme RrrD	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_000092318.1|1972566_1973004_+|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	100.0	2.0e-72
WP_000839224.1|1973206_1973704_+	KilA-N domain-containing protein	NA	A0A0P0ZBU2	Stx2-converting_phage	100.0	3.6e-94
WP_001283921.1|1973700_1973958_+	hypothetical protein	NA	A0A0P0ZBT1	Stx2-converting_phage	100.0	5.0e-39
WP_000095736.1|1974420_1974648_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_000279788.1|1974689_1975055_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	99.2	2.0e-65
WP_000958398.1|1975347_1975911_+|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	94.1	7.3e-83
WP_070080204.1|1975907_1977569_+|terminase	terminase large subunit	terminase	H6WZK9	Escherichia_phage	99.6	0.0e+00
WP_001063023.1|1979613_1979835_+	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	98.6	3.8e-35
WP_000126019.1|1982361_1982688_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_001007901.1|1982697_1983048_+|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000573374.1|1983044_1983491_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|1983487_1983832_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275510.1|1983890_1984607_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	99.6	1.1e-128
WP_001030063.1|1984612_1984987_+|tail	phage tail assembly chaperone	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001453698.1|1985082_1985292_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_070080206.1|1985343_1988586_+|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	99.8	0.0e+00
WP_000807954.1|1988578_1988920_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_070080207.1|1988919_1989618_+|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	99.6	4.3e-133
WP_001302649.1|1989634_1989955_-	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	100.0	3.0e-49
WP_001154345.1|1990062_1990236_+	Arc family DNA-binding protein	NA	A0A0P0ZC65	Stx2-converting_phage	100.0	3.4e-23
WP_001428824.1|1990306_1991230_+	phage antirepressor Ant	NA	A0A0N7KZK0	Stx2-converting_phage	100.0	1.3e-177
WP_021498910.1|1991284_1992022_+|tail	phage tail protein	tail	A0A0P0ZDT1	Stx2-converting_phage	100.0	3.1e-150
WP_134791867.1|1991967_1992600_+|tail	tail assembly protein	tail	A0A0P0ZDX8	Stx2-converting_phage	98.6	2.0e-105
WP_001171540.1|1992933_1993314_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000612591.1|1993310_1993658_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|1993707_1995246_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_070080208.1|1995288_1998768_+	host specificity protein J	NA	A0A0P0ZDT4	Stx2-converting_phage	98.6	0.0e+00
WP_001230468.1|1998834_1999434_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	99.5	6.7e-111
WP_070080209.1|1999498_2000812_+|tail	phage tail protein	tail	A0A0P0ZCC1	Stx2-converting_phage	97.5	3.3e-78
WP_001509711.1|2000813_2001083_+|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	98.9	1.1e-44
WP_000491542.1|2001223_2002099_+	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	100.0	1.5e-162
WP_001121226.1|2002323_2002974_-	type III secretion system effector NleG7	NA	B6ETE1	Enterobacteria_phage	99.5	4.1e-122
WP_001303036.1|2004297_2005464_+	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.7	4.5e-228
WP_001105392.1|2005582_2006056_+	DNA gyrase inhibitor SbmC	NA	NA	NA	NA	NA
WP_001202488.1|2006254_2007313_+	FUSC family protein	NA	NA	NA	NA	NA
WP_000450409.1|2007484_2007814_+	DUF496 family protein	NA	NA	NA	NA	NA
WP_001016346.1|2007914_2008097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001304123.1|2008585_2008699_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_000988600.1|2008711_2008906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001285587.1|2009364_2009733_-	type IV toxin-antitoxin system toxin CbtA	NA	NA	NA	NA	NA
WP_000692323.1|2009806_2010028_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
WP_001186192.1|2010090_2010567_-	RadC family protein	NA	NA	NA	NA	NA
WP_000860079.1|2010581_2011061_-	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.8	6.8e-13
WP_024177368.1|2011142_2011964_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.1	1.4e-45
WP_000846711.1|2012184_2012595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000775497.1|2012610_2013294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000102660.1|2013429_2014500_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_000203545.1|2014496_2015402_-	chemotaxis protein	NA	NA	NA	NA	NA
WP_000638172.1|2015398_2016280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171878943.1|2016263_2017477_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	98.0	1.3e-164
WP_000966626.1|2017848_2019996_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_000998048.1|2021443_2022982_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|2023031_2023379_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_187576832.1|2023458_2023755_-|transposase	transposase	transposase	A0A0P0ZBP6	Stx2-converting_phage	100.0	3.7e-46
>prophage 5
NZ_CP017436	Escherichia coli O157:H7 strain 2149 chromosome, complete genome	5408208	2042149	2089969	5408208	portal,head,holin,tail,transposase,integrase,capsid,terminase	Escherichia_phage(40.48%)	54	2027637:2027651	2052804:2052818
2027637:2027651	attL	CGCATATTAATGGCA	NA	NA	NA	NA
WP_162829202.1|2042149_2043362_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001302302.1|2047646_2048444_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000533600.1|2048679_2049702_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.4	2.0e-99
WP_000094838.1|2049701_2049905_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_070080211.1|2049963_2052435_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_000199485.1|2052530_2052719_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449168.1|2052715_2052904_-	cell division inhibitor	NA	NA	NA	NA	NA
2052804:2052818	attR	CGCATATTAATGGCA	NA	NA	NA	NA
WP_000367376.1|2053384_2053537_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	8.7e-07
WP_000444607.1|2053811_2054456_-	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	24.9	2.8e-06
WP_001261752.1|2054553_2054781_+	cell division protein	NA	NA	NA	NA	NA
WP_000693816.1|2054777_2055203_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262409.1|2055271_2056309_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	68.3	1.1e-87
WP_072143023.1|2056220_2056763_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	96.7	6.4e-84
WP_000450610.1|2056797_2057496_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	59.5	1.6e-71
WP_000702797.1|2057517_2057742_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	42.3	3.6e-09
WP_001290006.1|2057738_2058095_+	hypothetical protein	NA	A0A222YY85	Escherichia_phage	65.8	3.1e-15
WP_001414276.1|2058127_2058280_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000111243.1|2058276_2058588_+	hypothetical protein	NA	A0A222YY67	Escherichia_phage	83.5	2.4e-51
WP_000137954.1|2058714_2059278_+	hypothetical protein	NA	H6WZG0	Escherichia_phage	94.9	4.5e-48
WP_001278460.1|2059387_2059492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000902687.1|2059678_2059891_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	7.6e-25
WP_001302544.1|2059932_2060118_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001310296.1|2060058_2060337_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	1.3e-11
WP_070080212.1|2060338_2061388_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.0	1.4e-108
WP_001217457.1|2061400_2061760_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	68.4	4.1e-39
WP_001059381.1|2061756_2062446_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
WP_001303558.1|2063079_2063508_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.4	4.9e-63
WP_162829202.1|2065917_2067131_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_024165672.1|2067441_2067657_+|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	98.6	7.7e-33
WP_000731204.1|2067661_2068006_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	99.1	1.7e-58
WP_000992126.1|2068056_2068590_+	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	97.7	1.4e-99
WP_001303555.1|2068745_2068928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001280929.1|2068940_2069072_+	hypothetical protein	NA	A0A0N7BYT9	Escherichia_phage	88.4	9.4e-10
WP_001208680.1|2069299_2069485_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001302690.1|2070011_2070326_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001299328.1|2070407_2070632_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.7	4.1e-21
WP_000235436.1|2071026_2071536_+|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_000259002.1|2073420_2073627_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000831796.1|2073623_2075216_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
WP_001254002.1|2075205_2076711_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000256723.1|2076747_2077095_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001301534.1|2077152_2077419_+|capsid	major capsid protein	capsid	NA	NA	NA	NA
WP_029208397.1|2077400_2078141_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_000479117.1|2078154_2078586_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_000533402.1|2078612_2079026_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_001303170.1|2079006_2081586_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	80.0	0.0e+00
WP_000847314.1|2081582_2081912_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	99.1	2.1e-58
WP_001151105.1|2081911_2082610_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_070080198.1|2082615_2083359_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.2	4.1e-150
WP_140395871.1|2083304_2083934_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.0	1.9e-103
WP_070080213.1|2084174_2087654_+	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	98.4	0.0e+00
WP_001230459.1|2087720_2088320_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	100.0	8.0e-112
WP_070080214.1|2088384_2089698_+|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.2	5.9e-75
WP_001023407.1|2089699_2089969_+|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
>prophage 6
NZ_CP017436	Escherichia coli O157:H7 strain 2149 chromosome, complete genome	5408208	2147345	2167363	5408208	integrase,tail,transposase	Enterobacteria_phage(70.83%)	28	2160499:2160512	2170505:2170518
WP_162829348.1|2147345_2148559_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.7	4.9e-169
WP_000005444.1|2148688_2149873_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	96.7	1.7e-219
WP_000290456.1|2149872_2150385_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	99.4	2.1e-92
WP_000665314.1|2150439_2150805_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	98.3	1.7e-56
WP_000333495.1|2150813_2150969_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	100.0	8.8e-23
WP_000979955.1|2153771_2154260_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	100.0	1.0e-85
WP_000954203.1|2154416_2154989_+	serine acetyltransferase	NA	A0A1L2JYI5	Streptococcus_phage	34.4	1.0e-07
WP_032169999.1|2155032_2155578_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	88.5	8.1e-87
WP_162829202.1|2155615_2156828_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000211280.1|2156911_2157226_-	plasmid partitioning/stability family protein	NA	A0A0A7NPT5	Enterobacteria_phage	52.9	1.1e-19
WP_000686523.1|2157230_2158190_-	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	99.1	1.2e-178
WP_070080215.1|2158266_2161089_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	97.6	0.0e+00
2160499:2160512	attL	TTCGAAGGTGCTGC	NA	NA	NA	NA
WP_000599379.1|2161095_2161461_-	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	96.7	6.6e-61
WP_001310314.1|2161457_2162075_-	ash family protein	NA	S5MQL6	Escherichia_phage	46.2	2.1e-06
WP_000104305.1|2162086_2162386_-	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	89.9	1.6e-41
WP_000153707.1|2162382_2162649_-	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	77.3	3.1e-31
WP_000985157.1|2162645_2162849_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000991913.1|2162872_2163289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000021655.1|2163381_2163495_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	100.0	6.2e-10
WP_000514287.1|2163491_2163734_-	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	98.8	1.2e-37
WP_000159449.1|2163745_2164024_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	80.4	4.8e-35
WP_000739029.1|2164034_2164385_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	81.9	8.6e-50
WP_000014504.1|2164406_2164610_-	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_001673482.1|2164681_2164819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000786773.1|2164908_2165313_+	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	2.7e-23
WP_000290345.1|2165328_2165979_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000865208.1|2166008_2166356_+	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_001300279.1|2166361_2167363_+|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	58.5	4.2e-105
2170505:2170518	attR	GCAGCACCTTCGAA	NA	NA	NA	NA
>prophage 7
NZ_CP017436	Escherichia coli O157:H7 strain 2149 chromosome, complete genome	5408208	2487907	2605744	5408208	portal,head,holin,tail,transposase,protease,capsid,terminase	Escherichia_phage(30.56%)	136	NA	NA
WP_001260835.1|2487907_2488729_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|2488828_2488912_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743952.1|2489004_2489340_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091831.1|2489736_2490990_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019530.1|2491096_2491990_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225276.1|2492124_2493345_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919231.1|2493469_2494165_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_071527647.1|2494117_2495410_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148710.1|2495567_2496182_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526515.1|2496224_2497079_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|2497080_2497698_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_001509682.1|2497708_2500132_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	2.2e-208
WP_000041704.1|2500192_2502619_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	1.1e-212
WP_000778147.1|2502817_2503123_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001303515.1|2503230_2503941_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|2503943_2504504_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705189.1|2504538_2504880_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001302046.1|2505014_2505341_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000005552.1|2506329_2506581_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_070080217.1|2506653_2509125_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.1	3.2e-58
WP_001090200.1|2509217_2509409_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|2509405_2509594_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001171930.1|2510162_2510381_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240334.1|2510452_2510752_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303511.1|2511104_2511383_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001302048.1|2511384_2511576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001169686.1|2511596_2511968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000172738.1|2512065_2512368_+	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	8.6e-06
WP_000693943.1|2512364_2512790_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000095669.1|2512812_2513775_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	57.3	4.8e-82
WP_000788938.1|2513781_2514522_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	90.2	4.6e-125
WP_001118159.1|2515332_2515728_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	7.8e-31
WP_000206793.1|2515784_2516369_+	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	84.8	1.9e-33
WP_001278450.1|2516484_2516589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000887477.1|2516777_2516990_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_012779366.1|2517157_2517436_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265161.1|2517437_2518487_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.7	1.4e-108
WP_001217457.1|2518499_2518859_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	68.4	4.1e-39
WP_001059381.1|2518855_2519545_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
WP_001455449.1|2520181_2520610_+	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	97.1	2.2e-63
WP_000023202.1|2521088_2522939_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.4	0.0e+00
WP_024180155.1|2523378_2523594_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.3e-32
WP_000731241.1|2523598_2523943_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000992148.1|2523993_2524527_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
WP_162829202.1|2524633_2525847_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001056806.1|2526110_2526680_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|2526679_2526826_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|2527053_2527239_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000095736.1|2527663_2527891_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_000279803.1|2527932_2528298_+	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	96.7	2.9e-64
WP_070080218.1|2528587_2529151_+|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	83.4	9.3e-70
WP_070080219.1|2529147_2530809_+|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	98.9	0.0e+00
WP_001063023.1|2532853_2533075_+	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	98.6	3.8e-35
WP_070080220.1|2533020_2535600_+|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	98.4	0.0e+00
WP_000125988.1|2535602_2535929_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001007905.1|2535938_2536289_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573391.1|2536285_2536732_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133388.1|2536728_2537073_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001030063.1|2537861_2538236_+|tail	phage tail assembly chaperone	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001453698.1|2538331_2538541_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_070080221.1|2538592_2541673_+|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	94.4	0.0e+00
WP_000807954.1|2541665_2542007_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_070080222.1|2542006_2542705_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.4	2.9e-129
WP_070080223.1|2542715_2543459_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.6	2.5e-147
WP_050439450.1|2543404_2544037_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.1	3.9e-101
WP_001230508.1|2547925_2548525_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_075702005.1|2548589_2549804_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	B6DZB7	Enterobacteria_phage	94.6	1.6e-79
WP_001121225.1|2550598_2551249_+	type III secretion system effector NleG7	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_000998048.1|2551831_2553370_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|2553419_2553767_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|2553763_2554144_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_001120551.1|2555106_2555349_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_000199475.1|2557414_2557603_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449175.1|2557599_2557788_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_001133037.1|2558352_2558562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394548.1|2558562_2559201_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_000380316.1|2559212_2559365_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
WP_001416688.1|2559657_2559996_-	peptidase S24	NA	H9C160	Pectobacterium_phage	30.1	1.9e-06
WP_000747948.1|2560387_2560630_+	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_000693878.1|2560613_2561039_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262402.1|2561107_2562151_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	65.1	1.4e-82
WP_000139447.1|2562143_2562605_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.2	4.0e-79
WP_000450627.1|2562638_2563355_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.8	3.3e-72
WP_000603384.1|2563387_2563669_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
WP_000699809.1|2563665_2563893_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_001289673.1|2563885_2564197_+	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	92.2	7.2e-56
WP_000683609.1|2564324_2564543_+	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
WP_000104474.1|2564544_2565102_+	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_000935259.1|2565335_2565548_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000756596.1|2565667_2566012_+	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000191872.1|2566133_2566406_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
WP_001265229.1|2566407_2567457_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
WP_001217444.1|2567469_2567775_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	66.3	7.1e-32
WP_000640035.1|2567837_2568392_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	67.4	1.0e-65
WP_000917763.1|2568616_2568814_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	8.9e-28
WP_000301797.1|2568949_2569663_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001303509.1|2570117_2570546_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	97.8	4.4e-64
WP_000023184.1|2571023_2572874_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.9	0.0e+00
WP_024180155.1|2573312_2573528_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.3e-32
WP_000731241.1|2573532_2573877_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000992148.1|2573927_2574461_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
WP_001056806.1|2574731_2575301_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539795.1|2575300_2575447_+	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	87.0	1.1e-11
WP_001208680.1|2575669_2575855_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001302717.1|2576380_2576695_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001303940.1|2576776_2577001_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
WP_000867498.1|2577387_2577933_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	83.3	9.6e-80
WP_001027230.1|2577907_2579833_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.1	0.0e+00
WP_000198153.1|2579829_2580036_+	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_070080227.1|2580032_2581367_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.4	5.9e-256
WP_162829202.1|2581418_2582631_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000123254.1|2582927_2584247_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001295978.1|2584256_2584589_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000063265.1|2584644_2585670_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_000158906.1|2585711_2586110_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000753016.1|2586121_2586475_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	92.3	1.9e-57
WP_000975020.1|2586489_2587023_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	5.9e-58
WP_000683063.1|2587019_2587415_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	81.7	3.3e-58
WP_000235098.1|2587422_2588175_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	99.2	4.9e-135
WP_000479039.1|2588188_2588617_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	98.6	1.7e-71
WP_000532075.1|2588643_2588952_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	99.0	3.0e-54
WP_064032219.1|2588995_2591641_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	99.8	0.0e+00
WP_000847314.1|2591637_2591967_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	99.1	2.1e-58
WP_001151105.1|2591966_2592665_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_070080198.1|2592670_2593414_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.2	4.1e-150
WP_140395871.1|2593359_2593989_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.0	1.9e-103
WP_070080228.1|2594229_2597709_+	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	98.4	0.0e+00
WP_001230466.1|2597775_2598375_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	99.0	2.0e-110
WP_070080214.1|2598439_2599753_+|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.2	5.9e-75
WP_001023407.1|2599754_2600024_+|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_001131658.1|2600136_2600712_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.9	4.1e-89
WP_001356599.1|2600784_2601414_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	91.5	6.1e-78
WP_001143804.1|2601495_2602137_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	96.7	3.8e-104
WP_001120551.1|2602298_2602541_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_000527769.1|2604044_2605505_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.9e-42
WP_000214712.1|2605540_2605744_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
>prophage 8
NZ_CP017436	Escherichia coli O157:H7 strain 2149 chromosome, complete genome	5408208	2851497	2951016	5408208	head,holin,tail,transposase,integrase,protease,terminase	Stx2-converting_phage(35.09%)	101	2892442:2892469	2951153:2951180
WP_162829202.1|2851497_2852710_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000202114.1|2853927_2854494_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000506490.1|2854971_2855760_+	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_001302118.1|2855903_2857031_+	CMD domain-containing protein	NA	NA	NA	NA	NA
WP_000485019.1|2857098_2859033_+	exoribonuclease II	NA	Q0GXV6	Lactococcus_phage	27.9	2.4e-32
WP_000859972.1|2859267_2861253_+	cyclic di-GMP phosphodiesterase	NA	NA	NA	NA	NA
WP_001288364.1|2861400_2861574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001088621.1|2861663_2862413_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000498253.1|2862681_2862900_+	osmotically-inducible lipoprotein OsmB	NA	NA	NA	NA	NA
WP_001303294.1|2863025_2863352_-	stress response translation initiation inhibitor YciH	NA	NA	NA	NA	NA
WP_000176265.1|2863351_2864089_-	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_000891353.1|2864281_2865451_-	lipopolysaccharide assembly protein LapB	NA	NA	NA	NA	NA
WP_000876292.1|2865457_2865766_-	lipopolysaccharide assembly protein LapA	NA	NA	NA	NA	NA
WP_001256542.1|2865914_2866679_-	phosphatidylglycerophosphatase B	NA	NA	NA	NA	NA
WP_001176295.1|2866848_2867439_+	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.9	7.7e-43
WP_000099451.1|2867502_2870178_-	aconitate hydratase AcnA	NA	NA	NA	NA	NA
WP_001310756.1|2870341_2870437_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000233043.1|2870550_2870718_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000908596.1|2870720_2870885_-	YmiA family putative membrane protein	NA	NA	NA	NA	NA
WP_000776253.1|2871179_2872154_-	HTH-type transcriptional regulator CysB	NA	NA	NA	NA	NA
WP_001295576.1|2872363_2874961_-	type I DNA topoisomerase	NA	A0A2K9L1Q2	Tupanvirus	34.5	7.0e-88
WP_001031530.1|2875340_2875592_+	YciN family protein	NA	NA	NA	NA	NA
WP_000422055.1|2875627_2876677_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559268.1|2876896_2877655_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	6.7e-07
WP_001278878.1|2877651_2878242_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_001291216.1|2878281_2879154_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_162829202.1|2880264_2881478_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001295575.1|2882290_2882911_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001285675.1|2882907_2883789_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001700591.1|2883926_2883971_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001194607.1|2884062_2885625_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_000763520.1|2885624_2887220_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.2	5.0e-52
WP_000983857.1|2887220_2888582_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.2	4.3e-36
WP_000209521.1|2888593_2889787_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000443092.1|2889786_2890593_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000807651.1|2890973_2891153_+	general stress protein	NA	NA	NA	NA	NA
WP_001056491.1|2891238_2891739_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079499.1|2891784_2892291_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
2892442:2892469	attL	GTGGTATCGATATCCATGTACCACACTG	NA	NA	NA	NA
WP_001345079.1|2893604_2894255_-	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	32.4	6.6e-27
WP_001144877.1|2895761_2896352_-	T3SS effector guanine nucleotide exchange factor EspM1	NA	NA	NA	NA	NA
WP_001303944.1|2896535_2897183_+	T3SS effector E3 ubiquitin-protein ligase NleG	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
WP_001414184.1|2897319_2897466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303943.1|2897893_2898172_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171540.1|2898511_2898892_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000612591.1|2898888_2899236_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|2899285_2900824_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000938103.1|2901789_2902359_-	T3SS effector caspase inhibitor NleF	NA	NA	NA	NA	NA
WP_001509602.1|2902424_2903336_-	type III secretion system effector kinase NleH1-2	NA	A5LH48	Enterobacteria_phage	81.8	1.5e-133
WP_106409364.1|2903442_2903565_-|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	91.3	3.8e-05
WP_001025672.1|2905162_2906488_+	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	81.2	1.9e-214
WP_001023407.1|2907514_2907784_-|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_000216532.1|2907785_2909099_-|tail	phage tail protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.9	2.1e-80
WP_001228304.1|2909250_2909850_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	96.5	1.6e-107
WP_070080232.1|2909917_2913391_-	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	90.5	0.0e+00
WP_001152180.1|2913579_2914017_-|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	100.0	5.0e-63
WP_000807954.1|2914016_2914358_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_021503509.1|2914350_2917593_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	99.8	0.0e+00
WP_001453698.1|2917644_2917854_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030063.1|2917949_2918324_-|tail	phage tail assembly chaperone	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001275510.1|2918329_2919046_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	99.6	1.1e-128
WP_000133388.1|2919104_2919449_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573391.1|2919445_2919892_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007905.1|2919888_2920239_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125988.1|2920248_2920575_-|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001063023.1|2923101_2923323_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	98.6	3.8e-35
WP_070080219.1|2925367_2927029_-|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	98.9	0.0e+00
WP_047082927.1|2927025_2927589_-|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	83.4	7.1e-70
WP_000279796.1|2927879_2928245_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	100.0	3.1e-66
WP_000095736.1|2928286_2928514_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_012816791.1|2928938_2929124_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|2929351_2929498_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|2929497_2930067_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992148.1|2930337_2930871_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
WP_000731241.1|2930921_2931266_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_024180155.1|2931270_2931486_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.3e-32
WP_070080234.1|2931925_2933776_-	DUF1737 domain-containing protein	NA	B6DZ89	Enterobacteria_phage	98.9	0.0e+00
WP_000935549.1|2934572_2935637_-	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	93.5	2.9e-197
WP_000917750.1|2935787_2935985_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.0e-28
WP_000640048.1|2936226_2936757_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
WP_000904166.1|2936765_2937125_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.9	3.6e-35
WP_001302148.1|2937137_2938184_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.2	4.2e-108
WP_010917803.1|2938185_2938464_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_001217394.1|2938533_2938791_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000961820.1|2939011_2939224_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	70.0	1.4e-15
WP_001449026.1|2939502_2940261_-	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_001505071.1|2940959_2941124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000774808.1|2941120_2941702_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	80.2	8.6e-79
WP_157825328.1|2941888_2942431_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.7	1.5e-85
WP_000020556.1|2942342_2943383_-	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	7.9e-91
WP_000705621.1|2943354_2943906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000912298.1|2943889_2944117_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000787428.1|2944193_2944601_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_001240336.1|2944864_2945164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171903.1|2945236_2945455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394552.1|2945477_2945885_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
WP_000920491.1|2945862_2946096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449192.1|2946654_2946843_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001090200.1|2946839_2947031_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000048551.1|2947123_2949595_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.2	1.1e-58
WP_000113189.1|2949659_2949908_+	excisionase	NA	NA	NA	NA	NA
WP_000113674.1|2949885_2951016_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	51.4	3.4e-103
2951153:2951180	attR	GTGGTATCGATATCCATGTACCACACTG	NA	NA	NA	NA
>prophage 9
NZ_CP017436	Escherichia coli O157:H7 strain 2149 chromosome, complete genome	5408208	3045805	3119463	5408208	portal,head,holin,tail,transposase,tRNA,integrase,lysis,protease,capsid,terminase	Enterobacteria_phage(53.85%)	88	3090030:3090045	3118284:3118299
WP_162829202.1|3045805_3047019_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001131446.1|3049487_3049607_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001328621.1|3049567_3049753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000122462.1|3049853_3050027_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001304448.1|3050088_3050373_+	glycine zipper family protein	NA	NA	NA	NA	NA
WP_000979977.1|3050376_3050712_+	YmgD family protein	NA	NA	NA	NA	NA
WP_001299921.1|3053809_3054028_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001358812.1|3054159_3055683_-	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
WP_001065752.1|3056066_3056315_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000888778.1|3056427_3056694_-	biofilm/acid-resistance regulator AriR	NA	NA	NA	NA	NA
WP_000858015.1|3056722_3056995_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000554146.1|3057037_3057274_-	two-component-system connector protein YcgZ	NA	NA	NA	NA	NA
WP_001359088.1|3057587_3058799_+	blue light-responsive regulator BluF	NA	NA	NA	NA	NA
WP_000332300.1|3059003_3059735_+	DNA-binding transcriptional repressor BluR	NA	Q9EYF2	Enterobacteria_phage	50.5	3.5e-53
WP_000373094.1|3059955_3060360_+	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_032169657.1|3060412_3060523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_120795380.1|3060758_3060803_+	protein YmgK	NA	NA	NA	NA	NA
WP_000872355.1|3061055_3061379_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	64.5	7.5e-40
WP_000539892.1|3061481_3061634_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	1.6e-21
WP_001358785.1|3062113_3062551_+	acetyltransferase	NA	NA	NA	NA	NA
WP_000361110.1|3062575_3063160_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001201843.1|3063658_3064612_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001226373.1|3064798_3066283_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000998048.1|3066585_3068124_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|3068173_3068521_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171540.1|3068517_3068898_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000937476.1|3068973_3069222_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	1.7e-12
WP_000239881.1|3069278_3069947_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000134810.1|3070444_3070627_+	general stress protein	NA	NA	NA	NA	NA
WP_001166090.1|3070705_3071206_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079482.1|3071242_3071749_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000488340.1|3071767_3072658_+	manganese catalase family protein	NA	NA	NA	NA	NA
WP_000885630.1|3072777_3073359_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.7	6.1e-101
WP_000279120.1|3073358_3076274_-|tail	phage tail protein	tail	Q6H9S9	Enterobacteria_phage	98.3	1.1e-57
WP_001230336.1|3076338_3076938_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	99.5	3.0e-111
WP_070080236.1|3077004_3080403_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.6	0.0e+00
WP_000090919.1|3080463_3081096_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	98.6	1.9e-95
WP_000194779.1|3081032_3081776_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_001152612.1|3081781_3082480_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
WP_000847331.1|3082479_3082809_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	100.0	2.5e-59
WP_000840323.1|3082805_3085355_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	87.3	0.0e+00
WP_000459457.1|3085347_3085782_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479161.1|3085763_3086186_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	2.4e-70
WP_001143002.1|3086201_3086942_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.9	8.3e-127
WP_000683105.1|3086949_3087345_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_000975102.1|3087341_3087920_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	98.4	2.9e-79
WP_000752995.1|3087931_3088285_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	99.1	9.9e-62
WP_000158906.1|3088296_3088695_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000063265.1|3088736_3089762_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_001295978.1|3089817_3090150_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
3090030:3090045	attL	CCAGCATCAGCGGGGT	NA	NA	NA	NA
WP_000123254.1|3090159_3091479_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001301524.1|3091459_3093061_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000198153.1|3093057_3093264_-	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001027374.1|3093260_3095186_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.1	0.0e+00
WP_000453564.1|3095160_3095706_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	97.8	2.6e-93
WP_001300120.1|3096094_3096289_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	98.4	1.5e-27
WP_001031427.1|3096453_3096660_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_001459037.1|3096945_3097356_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	97.8	8.0e-71
WP_000738495.1|3097647_3097941_+	serum resistance lipoprotein Bor	NA	K7PL54	Enterobacteria_phage	99.0	1.5e-47
WP_010917798.1|3098031_3098214_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	93.3	4.7e-15
WP_001180487.1|3098430_3098907_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	95.6	4.3e-84
WP_000544528.1|3098893_3099199_-|holin	phage holin family protein	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_001097228.1|3099520_3100210_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.9	1.7e-57
WP_000971093.1|3100206_3100347_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	71.1	7.7e-10
WP_001099695.1|3100343_3100706_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	7.3e-60
WP_000774484.1|3100702_3100993_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	93.8	4.3e-47
WP_000224907.1|3100985_3101156_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_001053040.1|3101155_3101611_-	recombination protein NinB	NA	I6PD71	Cronobacter_phage	64.9	8.6e-58
WP_001693106.1|3102112_3103639_-	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	31.1	9.3e-32
WP_001459030.1|3103696_3103819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001070446.1|3103883_3104216_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_000145915.1|3104283_3104586_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_000788869.1|3104582_3105284_-	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	99.6	1.3e-129
WP_000088655.1|3106208_3106445_+	excisionase	NA	NA	NA	NA	NA
WP_000741454.1|3106434_3107577_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	100.0	8.1e-206
WP_000444477.1|3107690_3108941_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_001248690.1|3109112_3109766_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000476093.1|3109775_3110237_+	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001301861.1|3110290_3111397_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001301618.1|3111432_3112074_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000423729.1|3112077_3113448_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
WP_001265474.1|3113616_3114288_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000735407.1|3114287_3115748_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_000133424.1|3116348_3116630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000835281.1|3116885_3117428_-|terminase	terminase small subunit	terminase	O64316	Escherichia_phage	44.2	1.8e-33
WP_000224603.1|3117633_3118047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000380883.1|3118059_3118395_-|head	head decoration protein	head	NA	NA	NA	NA
3118284:3118299	attR	CCAGCATCAGCGGGGT	NA	NA	NA	NA
WP_000907465.1|3118407_3119463_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	43.3	1.5e-68
>prophage 10
NZ_CP017436	Escherichia coli O157:H7 strain 2149 chromosome, complete genome	5408208	3125555	3177365	5408208	head,holin,tail,integrase,terminase	Stx2-converting_phage(26.53%)	60	3125419:3125433	3181466:3181480
3125419:3125433	attL	ACATTAAAAATCAGC	NA	NA	NA	NA
WP_000085256.1|3125555_3126785_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	56.1	3.8e-132
WP_001301987.1|3127033_3128155_+	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_000359446.1|3128203_3129430_-	peptidase T	NA	NA	NA	NA	NA
WP_000531594.1|3129679_3130816_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000799385.1|3130799_3131663_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000938118.1|3132026_3133388_+	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	29.2	1.4e-50
WP_001303921.1|3133448_3133724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301984.1|3136032_3139434_-	type III secretion system effector EspN	NA	A0A0N7KZG3	Stx2-converting_phage	39.2	1.7e-219
WP_001301673.1|3140024_3142373_-	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_115801847.1|3142392_3142482_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071527644.1|3142494_3142731_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	82.0	5.7e-21
WP_000967271.1|3142676_3143414_-|tail	phage tail protein	tail	B6ETG2	Enterobacteria_phage	100.0	8.2e-151
WP_000835336.1|3143467_3144346_-	phage repressor protein/antirepressor Ant	NA	I6R977	Salmonella_phage	77.2	2.5e-93
WP_032169778.1|3144609_3144759_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_000170104.1|3144868_3145123_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_001152182.1|3145139_3145838_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.3	8.1e-132
WP_000807954.1|3145837_3146179_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_070080237.1|3146171_3149414_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	99.9	0.0e+00
WP_001453698.1|3149465_3149675_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_000710952.1|3149770_3150145_-|tail	phage tail assembly chaperone	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_000133388.1|3150942_3151287_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573391.1|3151283_3151730_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007905.1|3151726_3152077_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125988.1|3152086_3152413_-|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001063023.1|3154939_3155161_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	98.6	3.8e-35
WP_070080238.1|3157205_3158867_-|terminase	terminase large subunit	terminase	H6WZK9	Escherichia_phage	99.1	0.0e+00
WP_070080218.1|3158863_3159427_-|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	83.4	9.3e-70
WP_000279786.1|3159715_3160081_-	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
WP_001302977.1|3160122_3160308_+	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	90.4	3.7e-20
WP_000347013.1|3160437_3160578_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000735655.1|3160934_3161159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001208682.1|3161223_3161430_-	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_000539792.1|3161657_3161804_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|3161803_3162373_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992088.1|3162643_3163177_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	98.3	5.6e-101
WP_000731241.1|3163227_3163572_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000284518.1|3163576_3163792_-|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
WP_001289717.1|3163867_3164137_-	DUF826 domain-containing protein	NA	A0A2R2Z348	Escherichia_phage	75.3	8.2e-08
WP_001213059.1|3164174_3164357_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	67.8	1.0e-14
WP_000023170.1|3164504_3166442_-	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	76.8	2.5e-292
WP_000762928.1|3167520_3168342_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.2	4.1e-82
WP_001217410.1|3168338_3168713_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	2.1e-33
WP_001265159.1|3168725_3169775_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.2	1.4e-106
WP_001341388.1|3169776_3170055_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000887477.1|3170222_3170435_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_001278450.1|3170623_3170728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000207955.1|3170843_3171431_-	DUF551 domain-containing protein	NA	K7PH57	Enterobacteria_phage	45.8	7.5e-38
WP_001014296.1|3171433_3171625_-	hypothetical protein	NA	G9L660	Escherichia_phage	98.4	1.6e-26
WP_000515959.1|3171626_3172064_-	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	94.0	1.9e-38
WP_000156547.1|3172050_3172368_-	hypothetical protein	NA	A0A088CQ13	Enterobacteria_phage	90.0	4.4e-45
WP_001017965.1|3172321_3172639_-	DUF4752 family protein	NA	A0A1I9LJV1	Stx_converting_phage	92.4	2.1e-42
WP_001310212.1|3172628_3172931_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	87.9	1.9e-45
WP_072140318.1|3172927_3173209_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.1	1.4e-29
WP_000451012.1|3173241_3173958_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.4	2.1e-71
WP_072143019.1|3173991_3174534_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	92.2	2.3e-81
WP_070080239.1|3174445_3175495_-	phage replisome organizer	NA	A0A0U2RT81	Escherichia_phage	77.1	7.7e-86
WP_000693915.1|3175563_3175989_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000711018.1|3175972_3176296_-	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	6.2e-10
WP_000948454.1|3176420_3176897_+	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
WP_001414141.1|3177212_3177365_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
3181466:3181480	attR	GCTGATTTTTAATGT	NA	NA	NA	NA
>prophage 11
NZ_CP017436	Escherichia coli O157:H7 strain 2149 chromosome, complete genome	5408208	3278470	3329372	5408208	protease,transposase	Stx2-converting_phage(27.78%)	47	NA	NA
WP_162829202.1|3278470_3279684_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001069768.1|3282055_3282928_-	GTPase family protein	NA	NA	NA	NA	NA
WP_000282125.1|3283255_3283438_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000422760.1|3283737_3284163_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	89.7	1.5e-43
WP_162829202.1|3284363_3285576_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001304205.1|3286248_3288417_-	DNA2/NAM7 family helicase	NA	NA	NA	NA	NA
WP_001304206.1|3288413_3288929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001345400.1|3289169_3290216_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_001287881.1|3292203_3292395_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000124179.1|3292447_3292681_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001260384.1|3292776_3293400_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001167434.1|3293488_3293998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001301456.1|3294455_3294914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001231525.1|3296267_3297392_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_000958487.1|3298121_3298319_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_001340489.1|3298384_3298600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000180465.1|3298959_3299148_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001299815.1|3299244_3299424_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001004881.1|3299475_3299670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001310149.1|3300450_3300786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000477623.1|3301418_3301637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001223350.1|3303089_3305180_+	bifunctional siderophore receptor/adhesin Iha	NA	A0A0P0I887	Acinetobacter_phage	31.5	2.6e-08
WP_001053349.1|3305693_3306080_-	TerD family protein	NA	NA	NA	NA	NA
WP_000301248.1|3306502_3307078_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	41.1	2.5e-30
WP_000116680.1|3307146_3307725_-	tellurium resistance membrane protein TerD	NA	A0A2P1N0L4	Streptomyces_phage	40.0	2.5e-06
WP_000255079.1|3307773_3308814_-	tellurium resistance membrane protein TerC	NA	K7QKE8	Escherichia_phage	48.0	2.2e-77
WP_000007449.1|3308836_3309292_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_001054789.1|3309314_3310472_-	TerD family protein	NA	NA	NA	NA	NA
WP_000254140.1|3310471_3311053_-	tellurium resistance TerZ family protein	NA	K4JRX3	Caulobacter_phage	30.5	1.7e-13
WP_001035166.1|3311375_3312434_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_001280118.1|3312443_3313586_+	phosphoribosyltransferase	NA	A0A172Q0Y1	Acinetobacter_phage	35.4	7.7e-31
WP_001040060.1|3313578_3314352_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001182418.1|3314353_3315433_+|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.4	6.2e-38
WP_000797375.1|3315432_3316389_+	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_000506896.1|3316399_3317608_+	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_001176766.1|3317625_3318093_+	tellurium resistance protein TerW	NA	NA	NA	NA	NA
WP_000042916.1|3318353_3318683_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_000957248.1|3318669_3319011_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_000088522.1|3319953_3321567_-|transposase	IS66-like element IS682 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	65.7	3.1e-166
WP_000624701.1|3321597_3321948_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	64.7	1.1e-39
WP_000435663.1|3321944_3322370_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	73.2	1.4e-33
WP_162829202.1|3322712_3323926_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_032169707.1|3323963_3326303_+	DEAD/DEAH box helicase family protein	NA	Q84473	Paramecium_bursaria_Chlorella_virus	32.5	1.8e-34
WP_000136079.1|3326464_3326641_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000998048.1|3327059_3328598_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|3328647_3328995_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|3328991_3329372_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
>prophage 12
NZ_CP017436	Escherichia coli O157:H7 strain 2149 chromosome, complete genome	5408208	3449292	3506373	5408208	portal,head,holin,tail,transposase,integrase,protease,capsid,terminase	Escherichia_phage(27.27%)	63	3451227:3451242	3508138:3508153
WP_000003653.1|3449292_3449880_-|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_001186424.1|3449876_3450584_-	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000107391.1|3450602_3452396_-	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
3451227:3451242	attL	ATTCAGCTGCTGAATG	NA	NA	NA	NA
WP_001301613.1|3452392_3453511_-	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_001023352.1|3455925_3456195_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A0P0ZEF0	Stx2-converting_phage	100.0	3.4e-46
WP_070080241.1|3456196_3457510_-|tail	phage tail protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.3	9.7e-78
WP_001230466.1|3457574_3458174_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	99.0	2.0e-110
WP_070080242.1|3458241_3461715_-	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	96.4	0.0e+00
WP_000649829.1|3461848_3462376_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_050546863.1|3462566_3463199_-|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.5	5.8e-105
WP_000194760.1|3463144_3463888_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.6	2.4e-150
WP_070080243.1|3463898_3464597_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	98.3	1.5e-130
WP_000847298.1|3464596_3464926_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_070080244.1|3464922_3467502_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	79.6	0.0e+00
WP_000533402.1|3467482_3467896_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479117.1|3467922_3468354_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_029208397.1|3468367_3469108_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_001301534.1|3469089_3469356_-|capsid	major capsid protein	capsid	NA	NA	NA	NA
WP_000256723.1|3469413_3469761_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001254002.1|3469797_3471303_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000831796.1|3471292_3472885_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
WP_000259002.1|3472881_3473088_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_001302857.1|3473071_3475000_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.9	3.3e-260
WP_000998048.1|3475263_3476802_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|3476851_3477199_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171540.1|3477195_3477576_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000235421.1|3477651_3477927_-	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	51.5	2.4e-10
WP_162829348.1|3478793_3480006_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.7	4.9e-169
WP_050547091.1|3480003_3480198_+|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	97.9	9.7e-19
WP_000138558.1|3480453_3480726_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001003126.1|3480885_3481419_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	93.8	1.5e-98
WP_000675931.1|3481639_3481753_+	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_012816791.1|3481974_3482160_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001303878.1|3482687_3483002_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_162829202.1|3483206_3484420_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_070080245.1|3484595_3486446_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.4	0.0e+00
WP_000261909.1|3487213_3487927_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000265269.1|3488547_3489366_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000090264.1|3489517_3489889_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	83.2	4.0e-53
WP_001217436.1|3489878_3490250_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_001265172.1|3490262_3491312_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.2e-110
WP_001341388.1|3491313_3491592_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000813263.1|3491759_3491915_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	94.1	1.9e-17
WP_000160654.1|3492519_3493293_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001151233.1|3493644_3494058_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.1	9.8e-61
WP_000450992.1|3494073_3494844_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	6.1e-80
WP_000788751.1|3494865_3495612_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	84.2	6.2e-114
WP_001205823.1|3495618_3496710_-	hypothetical protein	NA	V5URT9	Shigella_phage	70.0	5.1e-133
WP_000273724.1|3496788_3497244_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000693855.1|3497450_3497876_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000887453.1|3497859_3498132_-	helix-turn-helix domain-containing protein	NA	A0A0U2S629	Escherichia_phage	45.8	1.1e-12
WP_000986592.1|3498240_3498642_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	54.5	7.4e-13
WP_000536233.1|3498669_3498861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303876.1|3498860_3499148_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000379575.1|3499425_3499581_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_001458970.1|3499722_3500046_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001133046.1|3500298_3500484_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000413705.1|3501057_3501246_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001098307.1|3501242_3501434_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000034474.1|3501527_3503999_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_000273151.1|3504066_3504309_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_001299351.1|3504286_3505306_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.3e-85
WP_000375128.1|3505713_3506373_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	1.8e-48
3508138:3508153	attR	ATTCAGCTGCTGAATG	NA	NA	NA	NA
>prophage 13
NZ_CP017436	Escherichia coli O157:H7 strain 2149 chromosome, complete genome	5408208	3737306	3762381	5408208	holin,tail,transposase,integrase,lysis,protease,terminase	Escherichia_phage(35.71%)	35	3736891:3736905	3762455:3762469
3736891:3736905	attL	TTAGTATAAAAAAGC	NA	NA	NA	NA
WP_001247925.1|3737306_3738005_-|protease	T3SS effector zinc metalloprotease NleD	protease	NA	NA	NA	NA
WP_000951026.1|3738235_3739117_-	type III secretion system effector kinase NleH1-1	NA	A5LH48	Enterobacteria_phage	90.1	8.6e-147
WP_072127173.1|3739285_3739447_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	72.5	3.9e-13
WP_115801843.1|3739943_3740963_-|protease	type III secretion system effector zinc metalloprotease NleC	protease	NA	NA	NA	NA
WP_000950813.1|3740996_3741977_-	type III secretion system effector arginine glycosyltransferase NleB2	NA	Q8HAB2	Salmonella_phage	49.5	2.9e-87
WP_001024022.1|3742153_3742423_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1I9LJT0	Stx_converting_phage	98.9	4.9e-45
WP_000741877.1|3742424_3743678_-|tail	phage tail protein	tail	A0A0P0ZDE7	Stx2-converting_phage	93.7	2.4e-70
WP_072140989.1|3743737_3744316_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	92.2	6.8e-100
WP_162829202.1|3744382_3745595_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001072975.1|3745660_3745873_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000934140.1|3745869_3747972_-|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	96.6	0.0e+00
WP_000349509.1|3747971_3748463_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	87.2	1.3e-72
WP_001139679.1|3749137_3749290_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	8.9e-20
WP_000092302.1|3749277_3749745_-|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	97.4	9.4e-76
WP_000075107.1|3749741_3750239_-	lysozyme RrrD	NA	A0A1B5FP97	Escherichia_phage	98.2	7.1e-90
WP_000284524.1|3750238_3750454_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_012578864.1|3750596_3750995_+	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000499454.1|3751075_3751234_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001302581.1|3751319_3752063_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097238.1|3752246_3752936_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_032160865.1|3752950_3753073_-	YlcG family protein	NA	NA	NA	NA	NA
WP_000750155.1|3753410_3754370_+	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_001028854.1|3754581_3755247_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001108055.1|3755243_3755864_-	recombination protein NinG	NA	Q716C3	Shigella_phage	96.1	1.6e-94
WP_000567001.1|3755856_3756027_-	protein ninF	NA	Q716C4	Shigella_phage	96.4	7.9e-25
WP_001254218.1|3756023_3756206_-	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	96.7	4.8e-28
WP_162829202.1|3757126_3758340_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000682316.1|3758893_3759076_+	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	95.0	4.1e-27
WP_000548536.1|3759048_3759240_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	96.8	1.1e-25
WP_000188862.1|3759316_3759532_+	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	98.6	2.9e-32
WP_000763363.1|3759630_3759852_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	98.6	6.4e-35
WP_000120056.1|3760062_3760665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000545728.1|3760907_3761075_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	1.3e-27
WP_001303849.1|3761114_3761333_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000533643.1|3761310_3762381_+|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	100.0	3.9e-202
3762455:3762469	attR	TTAGTATAAAAAAGC	NA	NA	NA	NA
>prophage 14
NZ_CP017436	Escherichia coli O157:H7 strain 2149 chromosome, complete genome	5408208	4274147	4340188	5408208	holin,transposase	Stx2-converting_phage(25.0%)	58	NA	NA
WP_000131044.1|4274147_4276181_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
WP_001301903.1|4276309_4276897_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000089099.1|4276910_4278383_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001159112.1|4278396_4280085_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.4	1.3e-61
WP_001356433.1|4280765_4280900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072140985.1|4282983_4283745_+	protein HyxA	NA	NA	NA	NA	NA
WP_000798051.1|4283786_4284881_+	adhesin	NA	NA	NA	NA	NA
WP_001356435.1|4284834_4285047_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_001301982.1|4286139_4286835_-	lactate utilization protein C	NA	NA	NA	NA	NA
WP_000023931.1|4286827_4288255_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_001102115.1|4288265_4288985_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_000339591.1|4289511_4290366_-	DNA-binding transcriptional regulator RclR	NA	NA	NA	NA	NA
WP_001046339.1|4290591_4291917_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.4	1.6e-112
WP_000474077.1|4292025_4292262_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000417405.1|4292273_4292867_+	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_001458949.1|4293026_4293896_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	41.7	1.0e-51
WP_000621002.1|4294144_4295002_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000092592.1|4295122_4299376_-	intimin-like adhesin FdeC	NA	NA	NA	NA	NA
WP_162829202.1|4300091_4301305_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000998051.1|4302587_4304126_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.8	1.0e-299
WP_000612591.1|4304175_4304523_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171540.1|4304519_4304900_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000803998.1|4305163_4305427_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000866436.1|4305426_4305567_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_001147284.1|4305636_4305828_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000389022.1|4306652_4307195_+	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_000730972.1|4307269_4307857_+	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_000716386.1|4307914_4308583_+	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_001131063.1|4308608_4311134_+	fimbrial usher EcpC	NA	NA	NA	NA	NA
WP_001265657.1|4311123_4312767_+	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_001301550.1|4312735_4313446_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_001303809.1|4313758_4314088_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001019920.1|4314335_4314950_-	YagU family protein	NA	NA	NA	NA	NA
WP_000070685.1|4315367_4316057_+	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_000643340.1|4316053_4317010_+	aldehyde oxidoreductase FAD-binding subunit PaoB	NA	NA	NA	NA	NA
WP_000667043.1|4317006_4319205_+	aldehyde oxidoreductase molybdenum-binding subunit PaoC	NA	A0A0P0I429	Acinetobacter_phage	25.7	1.5e-38
WP_000121344.1|4319214_4320171_+	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_000171067.1|4320349_4321477_-	MFS transporter	NA	NA	NA	NA	NA
WP_001303808.1|4321618_4322677_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_010917758.1|4322922_4323825_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001301751.1|4324527_4324806_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000361969.1|4324972_4325695_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000687183.1|4325793_4326693_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000205213.1|4327368_4328325_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000562750.1|4330803_4331127_-	DUF5375 family protein	NA	NA	NA	NA	NA
WP_001071227.1|4331126_4331348_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000973390.1|4331344_4331902_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	64.0	1.0e-28
WP_001244581.1|4331898_4332159_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	65.1	1.3e-23
WP_000154958.1|4333092_4333845_+	septation initiation protein	NA	NA	NA	NA	NA
WP_000968317.1|4333841_4334393_+	Polarity suppression protein	NA	NA	NA	NA	NA
WP_001185340.1|4334398_4334671_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000350115.1|4335080_4335647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000647284.1|4335646_4336237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000999326.1|4336267_4336900_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000251694.1|4336892_4337351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303996.1|4337350_4337968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162829348.1|4338033_4339246_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.7	4.9e-169
WP_087498070.1|4339345_4340188_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 15
NZ_CP017436	Escherichia coli O157:H7 strain 2149 chromosome, complete genome	5408208	4347699	4402482	5408208	plate,transposase	Streptococcus_phage(16.67%)	45	NA	NA
WP_001234373.1|4347699_4348518_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.0	6.1e-46
WP_000214420.1|4348609_4349095_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.0	2.0e-12
WP_001186786.1|4349110_4349587_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692308.1|4349655_4349877_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.1e-10
WP_162829348.1|4350614_4351827_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.7	4.9e-169
WP_000942525.1|4352473_4353544_+	DNA cytosine methyltransferase	NA	A0A1B1IRZ3	uncultured_Mediterranean_phage	29.6	2.6e-20
WP_001444700.1|4353522_4354182_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_000893282.1|4354701_4355955_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	3.4e-96
WP_001285288.1|4355966_4357070_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749881.1|4357357_4358413_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
WP_000174701.1|4358451_4358853_-	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000189536.1|4358910_4360155_-	esterase FrsA	NA	NA	NA	NA	NA
WP_001291990.1|4360246_4360705_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001293009.1|4360965_4362423_+	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_001059871.1|4363521_4363974_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001263495.1|4363983_4364382_-	type II toxin-antitoxin system mRNA interferase toxin YafO	NA	NA	NA	NA	NA
WP_000554757.1|4364384_4364678_-	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001226186.1|4364729_4365785_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000207556.1|4365855_4366641_-	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001301901.1|4366585_4368325_+	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_000543891.1|4369142_4369916_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.2e-19
WP_000729705.1|4370101_4370362_+	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_001303998.1|4370380_4370641_+	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
WP_001225679.1|4370796_4371537_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001301698.1|4371507_4372275_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_000284050.1|4372379_4372958_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_000973071.1|4373197_4375642_+	acyl-CoA dehydrogenase FadE	NA	NA	NA	NA	NA
WP_000532698.1|4375684_4376158_-	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_001118031.1|4376311_4377082_+	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_000027427.1|4377199_4378372_-|transposase	ISAs1-like element ISEc26 family transposase	transposase	NA	NA	NA	NA
WP_120795385.1|4378452_4378638_+	protein YncO	NA	NA	NA	NA	NA
WP_000247943.1|4378552_4378816_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070080248.1|4380780_4381917_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_000509109.1|4385842_4390075_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	46.1	2.1e-25
WP_000103342.1|4390150_4392292_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	1.1e-25
WP_001142958.1|4392501_4393020_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000037399.1|4393716_4394217_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000123970.1|4394251_4394476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001509383.1|4394526_4395918_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000599596.1|4396008_4396422_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000393844.1|4396425_4398276_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000348794.1|4398239_4399322_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_001113707.1|4399346_4400627_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_001080153.1|4400623_4401148_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000246434.1|4401150_4402482_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 16
NZ_CP017436	Escherichia coli O157:H7 strain 2149 chromosome, complete genome	5408208	5036662	5051327	5408208	tRNA,integrase,tail	Enterobacteria_phage(43.75%)	19	5032503:5032518	5050032:5050047
5032503:5032518	attL	TGCTGGTGGCAGGAAT	NA	NA	NA	NA
WP_000918366.1|5036662_5038078_-	replicative DNA helicase	NA	O80281	Escherichia_phage	78.1	8.3e-200
WP_000235522.1|5038160_5039144_+	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000891404.1|5039309_5039552_-	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_000543819.1|5039685_5040723_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_000332269.1|5040811_5041909_+|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	99.5	2.1e-211
WP_001217541.1|5041970_5042219_+	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_001143816.1|5042379_5043021_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	99.1	1.1e-106
WP_072140863.1|5043102_5043732_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	93.5	1.4e-79
WP_001118000.1|5043804_5044377_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	53.2	2.5e-46
WP_001023355.1|5044488_5044758_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A0P0ZEF0	Stx2-converting_phage	96.6	2.7e-43
WP_000268945.1|5044759_5046073_-|tail	phage tail protein	tail	A0A0P0ZE15	Stx2-converting_phage	98.2	2.5e-81
WP_001230514.1|5046137_5046737_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.0	5.7e-110
WP_000008211.1|5048058_5048595_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.3	3.1e-99
WP_001242740.1|5048585_5048936_+	hypothetical protein	NA	A0A0P0ZBF8	Stx2-converting_phage	94.8	1.6e-56
WP_000145668.1|5048932_5049217_+	hypothetical protein	NA	I6S1S6	Salmonella_phage	83.9	1.3e-40
WP_000829415.1|5049552_5049750_+	hypothetical protein	NA	K7PH57	Enterobacteria_phage	68.6	7.5e-11
WP_001093918.1|5050094_5050376_+	pyocin activator PrtN family protein	NA	K7PGU0	Enterobacteria_phage	98.9	8.7e-45
5050032:5050047	attR	ATTCCTGCCACCAGCA	NA	NA	NA	NA
WP_000654815.1|5050423_5050597_-	hypothetical protein	NA	K7PJQ2	Enterobacteria_phage	100.0	4.4e-23
WP_000956557.1|5050793_5051327_-	hypothetical protein	NA	K7PKJ4	Enterobacteria_phage	100.0	1.1e-99
>prophage 1
NZ_CP017437	Escherichia coli O157:H7 strain 2149 plasmid pO157, complete sequence	92565	3473	54866	92565	protease,integrase,transposase	Stx2-converting_phage(30.0%)	39	39657:39671	60056:60070
WP_162829348.1|3473_4686_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.7	4.9e-169
WP_000592771.1|4859_7070_+	catalase/peroxidase KatP	NA	NA	NA	NA	NA
WP_001172748.1|7113_7503_+	cytochrome b562 family protein	NA	NA	NA	NA	NA
WP_001034100.1|8728_12631_+|protease	serine protease autotransporter EspP	protease	Q9LA58	Enterobacterial_phage	40.4	9.5e-238
WP_001171540.1|12999_13380_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000612591.1|13376_13724_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|13773_15312_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_001302199.1|17258_18080_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_000975743.1|18079_19186_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_000550559.1|19275_20997_+	phosphoethanolamine transferase CptA	NA	NA	NA	NA	NA
WP_001302181.1|21070_22069_+	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_001358886.1|22937_25634_+|protease	metalloprotease StcE	protease	NA	NA	NA	NA
WP_001302175.1|25720_26596_+	type II secretion system protein GspC	NA	NA	NA	NA	NA
WP_001302177.1|26596_28564_+	variant type II secretion system secretin EtpD	NA	NA	NA	NA	NA
WP_000092338.1|28563_30069_+	type II secretion system ATPase GspE	NA	NA	NA	NA	NA
WP_001173152.1|30070_31294_+	type II secretion system inner membrane protein GspF	NA	NA	NA	NA	NA
WP_001231211.1|31324_31759_+	type II secretion system major pseudopilin GspG	NA	NA	NA	NA	NA
WP_000082929.1|31755_32310_+	type II secretion system minor pseudopilin GspH	NA	NA	NA	NA	NA
WP_000173396.1|32324_32672_+	type II secretion system minor pseudopilin GspI	NA	NA	NA	NA	NA
WP_000082782.1|32668_33268_+	type II secretion system minor pseudopilin GspJ	NA	NA	NA	NA	NA
WP_000776550.1|33264_34242_+	type II secretion system minor pseudopilin GspK	NA	NA	NA	NA	NA
WP_071525076.1|34280_35453_+	type II secretion system protein GspL	NA	NA	NA	NA	NA
WP_001004187.1|35439_35952_+	type II secretion system protein M	NA	NA	NA	NA	NA
WP_000096786.1|36009_36843_+	prepilin peptidase	NA	NA	NA	NA	NA
WP_000971918.1|36934_37336_+	GspS family T2SS pilot lipoprotein variant EptO	NA	NA	NA	NA	NA
WP_000839950.1|39226_39742_+	enterohemolysin-activating lysine-acyltransferase EhxC	NA	NA	NA	NA	NA
39657:39671	attL	AAATATTCAGGCAAT	NA	NA	NA	NA
WP_000217739.1|39743_42740_+	enterohemolysin EhxA	NA	NA	NA	NA	NA
WP_000987091.1|42789_44910_+	enterohemolysin T1SS ABC transporter permease/ATPase EhxB	NA	W8CYL7	Bacillus_phage	30.2	7.1e-46
WP_001213545.1|44913_46353_+	enterohemolysin T1SS ABC transporter subunit EhxD	NA	NA	NA	NA	NA
WP_010891288.1|47095_47326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001066920.1|47446_48187_+|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	2.0e-24
WP_000361615.1|48471_49449_-	replication initiation protein	NA	J9Q7H0	Salmonella_phage	58.9	5.1e-100
WP_000708307.1|49856_50057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001248529.1|50053_50674_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010891291.1|50670_51354_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_000813634.1|51812_52031_+	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_001159868.1|52032_52338_+	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_000016988.1|52338_53121_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.2	1.9e-49
WP_162829202.1|53652_54866_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
60056:60070	attR	AAATATTCAGGCAAT	NA	NA	NA	NA
