The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP017438	Escherichia coli O157:H7 strain 2159 chromosome, complete genome	5416633	1226907	1233958	5416633	transposase,tail	Enterobacteria_phage(50.0%)	8	NA	NA
WP_162829202.1|1226907_1228121_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001023396.1|1228338_1228608_+|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
WP_000442132.1|1228768_1229191_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	97.0	5.7e-72
WP_001301665.1|1229320_1230379_-	T3SS effector EspW	NA	NA	NA	NA	NA
WP_001144077.1|1230457_1231108_-	T3SS effector NleG family protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
WP_001132157.1|1231290_1231881_+	T3SS effector guanine nucleotide exchange factor EspM2	NA	NA	NA	NA	NA
WP_001217542.1|1232382_1232631_-	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_000162574.1|1233475_1233958_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
>prophage 2
NZ_CP017438	Escherichia coli O157:H7 strain 2159 chromosome, complete genome	5416633	1512854	1519593	5416633	integrase,transposase	Enterobacteria_phage(50.0%)	6	1500528:1500544	1521789:1521805
1500528:1500544	attL	GGTTGTCGATACCAATA	NA	NA	NA	NA
WP_000950857.1|1512854_1513424_+	hypothetical protein	NA	Q716G6	Shigella_phage	99.3	4.6e-69
WP_162829202.1|1513563_1514776_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000960724.1|1515190_1515871_+	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	71.0	1.8e-59
WP_000257010.1|1515880_1517017_+	phage DNA ejection protein	NA	Q716G3	Shigella_phage	72.8	1.4e-80
WP_000958700.1|1517191_1518349_-|integrase	prophage integrase IntS	integrase	E7DYQ6	Enterobacteria_phage	100.0	2.2e-222
WP_000368131.1|1518660_1519593_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
1521789:1521805	attR	GGTTGTCGATACCAATA	NA	NA	NA	NA
>prophage 3
NZ_CP017438	Escherichia coli O157:H7 strain 2159 chromosome, complete genome	5416633	1744887	1835721	5416633	lysis,protease,portal,transposase,tRNA,tail,terminase,holin	Enterobacteria_phage(54.0%)	83	NA	NA
WP_000968210.1|1744887_1745583_-|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
WP_001299855.1|1745579_1745978_-	CidA/LrgA family protein	NA	NA	NA	NA	NA
WP_000024633.1|1746108_1747017_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000194233.1|1747143_1748502_+	aromatic acid/H+ symport family MFS transporter	NA	NA	NA	NA	NA
WP_000131688.1|1748513_1749542_+	gentisate 1,2-dioxygenase	NA	NA	NA	NA	NA
WP_000196038.1|1749556_1750258_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_000781198.1|1750266_1750911_+	maleylacetoacetate isomerase	NA	NA	NA	NA	NA
WP_000170147.1|1750925_1752119_+	3-hydroxybenzoate 6-monooxygenase	NA	NA	NA	NA	NA
WP_001264864.1|1752278_1753229_+|tRNA	tRNA dihydrouridine(16) synthase DusC	tRNA	NA	NA	NA	NA
WP_000691708.1|1753616_1753700_-	protein YohP	NA	NA	NA	NA	NA
WP_001078131.1|1753923_1755360_+	multidrug resistance outer membrane protein MdtQ	NA	NA	NA	NA	NA
WP_000079550.1|1755412_1756174_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001301775.1|1756303_1756882_-	DedA family protein	NA	NA	NA	NA	NA
WP_003575553.1|1757051_1757639_+	YIP1 family protein	NA	NA	NA	NA	NA
WP_001295432.1|1757812_1758745_+	D-alanyl-D-alanine endopeptidase	NA	NA	NA	NA	NA
WP_000097342.1|1758782_1760498_-	D-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_000871478.1|1760693_1762991_+	beta-glucosidase BglX	NA	NA	NA	NA	NA
WP_001131252.1|1763242_1764160_+	glycine betaine ABC transporter substrate-binding protein OsmF	NA	NA	NA	NA	NA
WP_000221794.1|1764166_1765324_+	glycine betaine ABC transporter permease YehY	NA	NA	NA	NA	NA
WP_000569336.1|1765316_1766243_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G9BWD6	Planktothrix_phage	35.1	4.3e-24
WP_000783120.1|1766247_1766979_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1766959_1767067_-	protein YohO	NA	NA	NA	NA	NA
WP_027868261.1|1767126_1767828_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	100.0	4.6e-103
WP_171878939.1|1768966_1770179_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	98.3	2.7e-167
WP_001301135.1|1770499_1770649_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070080197.1|1770706_1772233_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.9	7.9e-31
WP_001053042.1|1772734_1773190_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	7.0e-60
WP_000224907.1|1773189_1773360_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_000774495.1|1773352_1773643_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	93.8	1.3e-46
WP_001099699.1|1773639_1774002_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	97.4	2.5e-60
WP_000971055.1|1773998_1774139_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001204769.1|1774224_1774659_+	antitermination protein	NA	G9L695	Escherichia_phage	97.2	1.3e-79
WP_001356551.1|1774910_1775063_+	DNA methylase	NA	A0A2R2Z327	Escherichia_phage	100.0	4.0e-20
WP_000142932.1|1775866_1777813_+	DUF1737 domain-containing protein	NA	A0A075M342	Escherichia_Stx1-converting_recombinant_phage	98.1	0.0e+00
WP_000143458.1|1777950_1778130_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290230.1|1778170_1778416_+	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000284506.1|1778493_1778709_+|holin	class II holin family protein	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_000087728.1|1778713_1779247_+	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	100.0	1.8e-102
WP_001056806.1|1779517_1780087_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|1780086_1780233_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|1780460_1780646_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000348565.1|1781163_1781640_+	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	100.0	2.1e-83
WP_001077630.1|1781636_1783760_+|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	99.9	0.0e+00
WP_000102415.1|1783756_1783969_+	hypothetical protein	NA	S5MBY8	Escherichia_phage	98.6	3.0e-29
WP_000974564.1|1783968_1785471_+|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	100.0	4.8e-291
WP_001114424.1|1785415_1787440_+|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.8	0.0e+00
WP_001097065.1|1787527_1787854_+	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001281347.1|1787846_1788128_+	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	98.9	1.3e-45
WP_000974959.1|1788130_1788754_+|tail	phage tail protein	tail	Q8VNN3	Enterobacteria_phage	99.0	9.8e-105
WP_000682716.1|1788766_1789165_+|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000235098.1|1789172_1789925_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	99.2	4.9e-135
WP_000479039.1|1789938_1790367_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	98.6	1.7e-71
WP_000532075.1|1790393_1790702_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	99.0	3.0e-54
WP_064032219.1|1790745_1793391_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	99.8	0.0e+00
WP_000847314.1|1793387_1793717_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	99.1	2.1e-58
WP_001151105.1|1793716_1794415_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_070080198.1|1794420_1795164_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.2	4.1e-150
WP_140395871.1|1795109_1795739_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.0	1.9e-103
WP_070080200.1|1795979_1799459_+	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	98.4	0.0e+00
WP_001230468.1|1799525_1800125_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	99.5	6.7e-111
WP_070080201.1|1800189_1801503_+|tail	phage tail protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.3	2.8e-77
WP_001023407.1|1801504_1801774_+|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_075702011.1|1801934_1802351_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	99.3	1.4e-75
WP_001143784.1|1802432_1803074_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	100.0	6.8e-109
WP_001261939.1|1803235_1803484_-	DinI-like family protein	NA	B6DZC1	Enterobacteria_phage	100.0	1.4e-38
WP_001301761.1|1803998_1805684_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	100.0	1.7e-305
WP_000598641.1|1805680_1806400_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1806446_1806917_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|1806958_1807420_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001459147.1|1807544_1809548_-	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	99.9	0.0e+00
WP_001302810.1|1809544_1810681_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	100.0	1.9e-167
WP_000528951.1|1810673_1811405_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001294377.1|1811423_1812953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001302026.1|1812963_1814052_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_000636932.1|1815292_1815610_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000356841.1|1815671_1819301_-	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_001301615.1|1826258_1828292_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.4e-54
WP_001005448.1|1828423_1829533_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_010904812.1|1829794_1830076_+	DUF2574 family protein	NA	NA	NA	NA	NA
WP_000682830.1|1830367_1830910_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000677409.1|1830997_1831672_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000945390.1|1831687_1834168_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_162829202.1|1834508_1835721_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
>prophage 4
NZ_CP017438	Escherichia coli O157:H7 strain 2159 chromosome, complete genome	5416633	1944538	2023206	5416633	lysis,protease,transposase,head,tail,terminase,integrase,holin	Stx2-converting_phage(49.4%)	97	1935489:1935503	1950916:1950930
1935489:1935503	attL	GGCCGTACTGGTTGG	NA	NA	NA	NA
WP_001007947.1|1944538_1945717_+|integrase	site-specific integrase	integrase	A0A0P0ZDN8	Stx2-converting_phage	100.0	1.8e-232
WP_000132739.1|1945697_1945889_-	AlpA family phage regulatory protein	NA	A0A0P0ZBL0	Stx2-converting_phage	100.0	1.7e-31
WP_001281188.1|1945970_1946315_-	hypothetical protein	NA	A0A0P0ZB93	Stx2-converting_phage	100.0	9.0e-60
WP_000610373.1|1946502_1946853_-	DUF551 domain-containing protein	NA	A0A0N7KZ94	Stx2-converting_phage	100.0	7.8e-67
WP_000207903.1|1946849_1947206_-	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	100.0	3.1e-63
WP_001289954.1|1947719_1948667_-	ead/Ea22-like family protein	NA	A0A0P0ZE96	Stx2-converting_phage	100.0	3.6e-183
WP_000763383.1|1948663_1948885_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_000188870.1|1948983_1949199_-	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	100.0	1.0e-32
WP_000548528.1|1949275_1949467_-	DUF1382 family protein	NA	A0A0P0ZC60	Stx2-converting_phage	100.0	5.6e-27
WP_000682306.1|1949439_1949622_-	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	100.0	4.3e-29
WP_000186812.1|1949618_1950299_-	YqaJ viral recombinase family protein	NA	A0A0N6WET1	Escherichia_phage	100.0	1.6e-132
WP_001302855.1|1950295_1951081_-	phage recombination protein Bet	NA	A0A0N7BTT9	Escherichia_phage	100.0	6.3e-149
1950916:1950930	attR	GGCCGTACTGGTTGG	NA	NA	NA	NA
WP_162829202.1|1951356_1952569_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000372937.1|1952770_1952914_-	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
WP_001198861.1|1952882_1953047_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000065362.1|1953119_1953488_-	DUF2528 family protein	NA	A0A0N7C1W2	Escherichia_phage	100.0	2.0e-65
WP_000394299.1|1953670_1953922_-	hypothetical protein	NA	A4KWV4	Enterobacteria_phage	100.0	5.6e-43
WP_000088203.1|1953980_1954253_-	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	100.0	5.7e-41
WP_000438343.1|1954230_1954413_-	hypothetical protein	NA	A0A0N7C057	Escherichia_phage	100.0	2.8e-28
WP_001130059.1|1954981_1955503_-	hypothetical protein	NA	A0A0N7BTU4	Escherichia_phage	100.0	1.8e-88
WP_171878941.1|1955684_1956897_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	6.5e-169
WP_001302016.1|1957317_1958013_-	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	100.0	8.6e-134
WP_000067727.1|1958087_1958303_+	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_000442612.1|1958444_1958741_+	hypothetical protein	NA	A4KWW1	Enterobacteria_phage	100.0	4.0e-48
WP_000166961.1|1958773_1958935_+	hypothetical protein	NA	Q76H53	Enterobacteria_phage	100.0	1.3e-21
WP_000539352.1|1958921_1959743_+	replication protein	NA	A0A0N7KZ97	Stx2-converting_phage	99.6	4.4e-153
WP_001248388.1|1959739_1961116_+	AAA family ATPase	NA	A0A0P0ZC27	Stx2-converting_phage	100.0	5.7e-254
WP_001000130.1|1961186_1961465_+	hypothetical protein	NA	Q9EYB9	Enterobacteria_phage	100.0	4.4e-49
WP_000103678.1|1961597_1961813_+	hypothetical protein	NA	A0A0N7KZ98	Stx2-converting_phage	100.0	7.7e-33
WP_001449504.1|1961823_1962060_+	restriction alleviation protein, Lar family	NA	Q687G3	Enterobacteria_phage	100.0	9.3e-40
WP_001303571.1|1962016_1962463_+	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	100.0	2.4e-81
WP_000153268.1|1962459_1962987_+	phage N-6-adenine-methyltransferase	NA	Q9EYC2	Enterobacteria_phage	100.0	1.6e-100
WP_001254256.1|1962983_1963166_+	NinE family protein	NA	A0A0N7C1X3	Escherichia_phage	100.0	5.7e-29
WP_000211413.1|1963440_1964145_+	phage antirepressor Ant	NA	Q8VNP5	Enterobacteria_phage	100.0	9.6e-133
WP_001108016.1|1964942_1965548_+	recombination protein NinG	NA	H6WZJ3	Escherichia_phage	99.5	4.3e-97
WP_001028855.1|1965544_1966216_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.6	9.2e-133
WP_000512807.1|1966206_1966695_+	late gene antiterminator protein	NA	Q5TJL7	Enterobacteria_phage	100.0	7.0e-90
WP_000649751.1|1967333_1968293_+	Shiga toxin Stx2c subunit A	NA	Q5TJL6	Enterobacteria_phage	100.0	4.3e-176
WP_000738080.1|1968304_1968574_+	Shiga toxin Stx2c subunit B	NA	Q5TJL5	Enterobacteria_phage	100.0	2.1e-43
WP_001303568.1|1968870_1969194_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	100.0	6.9e-62
WP_021503541.1|1969437_1971375_+	SASA family carbohydrate esterase	NA	A0A0P0ZDW4	Stx2-converting_phage	99.8	0.0e+00
WP_000143458.1|1971512_1971692_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290231.1|1971732_1972005_+	DUF826 domain-containing protein	NA	A0A0P0ZBB8	Stx2-converting_phage	100.0	2.2e-21
WP_000284515.1|1972081_1972297_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.0e-33
WP_000075132.1|1972296_1972794_+	lysozyme RrrD	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_000092318.1|1972790_1973228_+|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	100.0	2.0e-72
WP_000839224.1|1973430_1973928_+	KilA-N domain-containing protein	NA	A0A0P0ZBU2	Stx2-converting_phage	100.0	3.6e-94
WP_001283921.1|1973924_1974182_+	hypothetical protein	NA	A0A0P0ZBT1	Stx2-converting_phage	100.0	5.0e-39
WP_000095736.1|1974644_1974872_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_000279788.1|1974913_1975279_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	99.2	2.0e-65
WP_000958398.1|1975571_1976135_+|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	94.1	7.3e-83
WP_070080204.1|1976131_1977793_+|terminase	terminase large subunit	terminase	H6WZK9	Escherichia_phage	99.6	0.0e+00
WP_001063023.1|1979837_1980059_+	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	98.6	3.8e-35
WP_000126019.1|1982585_1982912_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_001007901.1|1982921_1983272_+|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000573374.1|1983268_1983715_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|1983711_1984056_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275510.1|1984114_1984831_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	99.6	1.1e-128
WP_001030063.1|1984836_1985211_+|tail	phage tail assembly chaperone	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001453698.1|1985306_1985516_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_070080206.1|1985567_1988810_+|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	99.8	0.0e+00
WP_000807954.1|1988802_1989144_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_070080207.1|1989143_1989842_+|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	99.6	4.3e-133
WP_001302649.1|1989858_1990179_-	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	100.0	3.0e-49
WP_001154345.1|1990286_1990460_+	Arc family DNA-binding protein	NA	A0A0P0ZC65	Stx2-converting_phage	100.0	3.4e-23
WP_001428824.1|1990530_1991454_+	phage antirepressor Ant	NA	A0A0N7KZK0	Stx2-converting_phage	100.0	1.3e-177
WP_021498910.1|1991508_1992246_+|tail	phage tail protein	tail	A0A0P0ZDT1	Stx2-converting_phage	100.0	3.1e-150
WP_134791867.1|1992191_1992824_+|tail	tail assembly protein	tail	A0A0P0ZDX8	Stx2-converting_phage	98.6	2.0e-105
WP_001171540.1|1993157_1993538_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000612591.1|1993534_1993882_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|1993931_1995470_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_070080208.1|1995512_1998992_+	host specificity protein J	NA	A0A0P0ZDT4	Stx2-converting_phage	98.6	0.0e+00
WP_001230468.1|1999058_1999658_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	99.5	6.7e-111
WP_070080209.1|1999722_2001036_+|tail	phage tail protein	tail	A0A0P0ZCC1	Stx2-converting_phage	97.5	3.3e-78
WP_001509711.1|2001037_2001307_+|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	98.9	1.1e-44
WP_000491542.1|2001447_2002323_+	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	100.0	1.5e-162
WP_001121226.1|2002547_2003198_-	type III secretion system effector NleG7	NA	B6ETE1	Enterobacteria_phage	99.5	4.1e-122
WP_001303036.1|2004521_2005688_+	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.7	4.5e-228
WP_001105392.1|2005806_2006280_+	DNA gyrase inhibitor SbmC	NA	NA	NA	NA	NA
WP_001202488.1|2006478_2007537_+	FUSC family protein	NA	NA	NA	NA	NA
WP_000450409.1|2007708_2008038_+	DUF496 family protein	NA	NA	NA	NA	NA
WP_001016346.1|2008138_2008321_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001304123.1|2008809_2008923_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_000988600.1|2008935_2009130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001285587.1|2009588_2009957_-	type IV toxin-antitoxin system toxin CbtA	NA	NA	NA	NA	NA
WP_000692323.1|2010030_2010252_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
WP_001186192.1|2010314_2010791_-	RadC family protein	NA	NA	NA	NA	NA
WP_000860079.1|2010805_2011285_-	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.8	6.8e-13
WP_024177368.1|2011366_2012188_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.1	1.4e-45
WP_000846711.1|2012408_2012819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000775497.1|2012834_2013518_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000102660.1|2013653_2014724_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_000203545.1|2014720_2015626_-	chemotaxis protein	NA	NA	NA	NA	NA
WP_000638172.1|2015622_2016504_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171878943.1|2016487_2017701_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	98.0	1.3e-164
WP_000966626.1|2018072_2020220_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_000998048.1|2021667_2023206_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
>prophage 5
NZ_CP017438	Escherichia coli O157:H7 strain 2159 chromosome, complete genome	5416633	2042374	2090194	5416633	portal,transposase,head,tail,capsid,terminase,integrase,holin	Escherichia_phage(40.48%)	54	2027862:2027876	2053029:2053043
2027862:2027876	attL	CGCATATTAATGGCA	NA	NA	NA	NA
WP_162829202.1|2042374_2043587_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001302302.1|2047871_2048669_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000533600.1|2048904_2049927_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.4	2.0e-99
WP_000094838.1|2049926_2050130_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_070080211.1|2050188_2052660_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_000199485.1|2052755_2052944_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449168.1|2052940_2053129_-	cell division inhibitor	NA	NA	NA	NA	NA
2053029:2053043	attR	CGCATATTAATGGCA	NA	NA	NA	NA
WP_000367376.1|2053609_2053762_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	8.7e-07
WP_000444607.1|2054036_2054681_-	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	24.9	2.8e-06
WP_001261752.1|2054778_2055006_+	cell division protein	NA	NA	NA	NA	NA
WP_000693816.1|2055002_2055428_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262409.1|2055496_2056534_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	68.3	1.1e-87
WP_072143023.1|2056445_2056988_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	96.7	6.4e-84
WP_000450610.1|2057022_2057721_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	59.5	1.6e-71
WP_000702797.1|2057742_2057967_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	42.3	3.6e-09
WP_001290006.1|2057963_2058320_+	hypothetical protein	NA	A0A222YY85	Escherichia_phage	65.8	3.1e-15
WP_001414276.1|2058352_2058505_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000111243.1|2058501_2058813_+	hypothetical protein	NA	A0A222YY67	Escherichia_phage	83.5	2.4e-51
WP_000137954.1|2058939_2059503_+	hypothetical protein	NA	H6WZG0	Escherichia_phage	94.9	4.5e-48
WP_001278460.1|2059612_2059717_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000902687.1|2059903_2060116_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	7.6e-25
WP_001302544.1|2060157_2060343_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001310296.1|2060283_2060562_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	1.3e-11
WP_070080212.1|2060563_2061613_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.0	1.4e-108
WP_001217457.1|2061625_2061985_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	68.4	4.1e-39
WP_001059381.1|2061981_2062671_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
WP_001303558.1|2063304_2063733_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.4	4.9e-63
WP_162829202.1|2066142_2067356_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_024165672.1|2067666_2067882_+|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	98.6	7.7e-33
WP_000731204.1|2067886_2068231_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	99.1	1.7e-58
WP_000992126.1|2068281_2068815_+	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	97.7	1.4e-99
WP_001303555.1|2068970_2069153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001280929.1|2069165_2069297_+	hypothetical protein	NA	A0A0N7BYT9	Escherichia_phage	88.4	9.4e-10
WP_001208680.1|2069524_2069710_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001302690.1|2070236_2070551_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001299328.1|2070632_2070857_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.7	4.1e-21
WP_000235436.1|2071251_2071761_+|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_000259002.1|2073645_2073852_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000831796.1|2073848_2075441_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
WP_001254002.1|2075430_2076936_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000256723.1|2076972_2077320_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001301534.1|2077377_2077644_+|capsid	major capsid protein	capsid	NA	NA	NA	NA
WP_029208397.1|2077625_2078366_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_000479117.1|2078379_2078811_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_000533402.1|2078837_2079251_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_001303170.1|2079231_2081811_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	80.0	0.0e+00
WP_000847314.1|2081807_2082137_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	99.1	2.1e-58
WP_001151105.1|2082136_2082835_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_070080198.1|2082840_2083584_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.2	4.1e-150
WP_140395871.1|2083529_2084159_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.0	1.9e-103
WP_070080213.1|2084399_2087879_+	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	98.4	0.0e+00
WP_001230459.1|2087945_2088545_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	100.0	8.0e-112
WP_070080214.1|2088609_2089923_+|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.2	5.9e-75
WP_001023407.1|2089924_2090194_+|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
>prophage 6
NZ_CP017438	Escherichia coli O157:H7 strain 2159 chromosome, complete genome	5416633	2147570	2167588	5416633	integrase,transposase,tail	Enterobacteria_phage(70.83%)	28	2160724:2160737	2170730:2170743
WP_162829348.1|2147570_2148784_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.7	4.9e-169
WP_000005444.1|2148913_2150098_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	96.7	1.7e-219
WP_000290456.1|2150097_2150610_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	99.4	2.1e-92
WP_000665314.1|2150664_2151030_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	98.3	1.7e-56
WP_000333495.1|2151038_2151194_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	100.0	8.8e-23
WP_000979955.1|2153996_2154485_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	100.0	1.0e-85
WP_000954203.1|2154641_2155214_+	serine acetyltransferase	NA	A0A1L2JYI5	Streptococcus_phage	34.4	1.0e-07
WP_032169999.1|2155257_2155803_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	88.5	8.1e-87
WP_162829202.1|2155840_2157053_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000211280.1|2157136_2157451_-	plasmid partitioning/stability family protein	NA	A0A0A7NPT5	Enterobacteria_phage	52.9	1.1e-19
WP_000686523.1|2157455_2158415_-	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	99.1	1.2e-178
WP_070080215.1|2158491_2161314_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	97.6	0.0e+00
2160724:2160737	attL	TTCGAAGGTGCTGC	NA	NA	NA	NA
WP_000599379.1|2161320_2161686_-	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	96.7	6.6e-61
WP_001310314.1|2161682_2162300_-	ash family protein	NA	S5MQL6	Escherichia_phage	46.2	2.1e-06
WP_000104305.1|2162311_2162611_-	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	89.9	1.6e-41
WP_000153707.1|2162607_2162874_-	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	77.3	3.1e-31
WP_000985157.1|2162870_2163074_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000991913.1|2163097_2163514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000021655.1|2163606_2163720_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	100.0	6.2e-10
WP_000514287.1|2163716_2163959_-	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	98.8	1.2e-37
WP_000159449.1|2163970_2164249_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	80.4	4.8e-35
WP_000739029.1|2164259_2164610_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	81.9	8.6e-50
WP_000014504.1|2164631_2164835_-	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_001673482.1|2164906_2165044_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000786773.1|2165133_2165538_+	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	2.7e-23
WP_000290345.1|2165553_2166204_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000865208.1|2166233_2166581_+	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_001300279.1|2166586_2167588_+|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	58.5	4.2e-105
2170730:2170743	attR	GCAGCACCTTCGAA	NA	NA	NA	NA
>prophage 7
NZ_CP017438	Escherichia coli O157:H7 strain 2159 chromosome, complete genome	5416633	2488132	2607264	5416633	protease,portal,transposase,head,tail,capsid,terminase,holin	Escherichia_phage(30.91%)	138	NA	NA
WP_001260835.1|2488132_2488954_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|2489053_2489137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743952.1|2489229_2489565_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091831.1|2489961_2491215_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019530.1|2491321_2492215_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225276.1|2492349_2493570_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919231.1|2493694_2494390_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_071527647.1|2494342_2495635_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148710.1|2495792_2496407_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526515.1|2496449_2497304_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|2497305_2497923_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_001509682.1|2497933_2500357_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	2.2e-208
WP_000041704.1|2500417_2502844_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	1.1e-212
WP_000778147.1|2503042_2503348_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001303515.1|2503455_2504166_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|2504168_2504729_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705189.1|2504763_2505105_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001302046.1|2505239_2505566_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000005552.1|2506554_2506806_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_070080217.1|2506878_2509350_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.1	3.2e-58
WP_001090200.1|2509442_2509634_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|2509630_2509819_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001171930.1|2510387_2510606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240334.1|2510677_2510977_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303511.1|2511329_2511608_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001302048.1|2511609_2511801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001169686.1|2511821_2512193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000172738.1|2512290_2512593_+	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	8.6e-06
WP_000693943.1|2512589_2513015_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000095669.1|2513037_2514000_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	57.3	4.8e-82
WP_000788938.1|2514006_2514747_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	90.2	4.6e-125
WP_001118159.1|2515557_2515953_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	7.8e-31
WP_000206793.1|2516009_2516594_+	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	84.8	1.9e-33
WP_001278450.1|2516709_2516814_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000887477.1|2517002_2517215_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_012779366.1|2517382_2517661_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265161.1|2517662_2518712_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.7	1.4e-108
WP_001217457.1|2518724_2519084_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	68.4	4.1e-39
WP_001059381.1|2519080_2519770_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
WP_001455449.1|2520406_2520835_+	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	97.1	2.2e-63
WP_000023202.1|2521313_2523164_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.4	0.0e+00
WP_024180155.1|2523603_2523819_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.3e-32
WP_000731241.1|2523823_2524168_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000992148.1|2524218_2524752_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
WP_162829202.1|2524858_2526072_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001056806.1|2526335_2526905_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|2526904_2527051_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|2527278_2527464_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000095736.1|2527888_2528116_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_000279803.1|2528157_2528523_+	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	96.7	2.9e-64
WP_070080218.1|2528812_2529376_+|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	83.4	9.3e-70
WP_070080219.1|2529372_2531034_+|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	98.9	0.0e+00
WP_001063023.1|2533078_2533300_+	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	98.6	3.8e-35
WP_070080220.1|2533245_2535825_+|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	98.4	0.0e+00
WP_000125988.1|2535827_2536154_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001007905.1|2536163_2536514_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573391.1|2536510_2536957_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133388.1|2536953_2537298_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001030063.1|2538086_2538461_+|tail	phage tail assembly chaperone	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001453698.1|2538556_2538766_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_070080221.1|2538817_2541898_+|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	94.4	0.0e+00
WP_000807954.1|2541890_2542232_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_070080222.1|2542231_2542930_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.4	2.9e-129
WP_070080223.1|2542940_2543684_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.6	2.5e-147
WP_050439450.1|2543629_2544262_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.1	3.9e-101
WP_001230508.1|2548150_2548750_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_075702005.1|2548814_2550029_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	B6DZB7	Enterobacteria_phage	94.6	1.6e-79
WP_001121225.1|2550823_2551474_+	type III secretion system effector NleG7	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_000998048.1|2552056_2553595_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|2553644_2553992_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|2553988_2554369_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_001120551.1|2555331_2555574_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_162829202.1|2556428_2557642_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_070082749.1|2557693_2558842_-	exonuclease	NA	H6WRX1	Salmonella_phage	51.7	5.5e-85
WP_000199475.1|2558934_2559123_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449175.1|2559119_2559308_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_001133037.1|2559872_2560082_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394548.1|2560082_2560721_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_000380316.1|2560732_2560885_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
WP_001416688.1|2561177_2561516_-	peptidase S24	NA	H9C160	Pectobacterium_phage	30.1	1.9e-06
WP_000747948.1|2561907_2562150_+	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_000693878.1|2562133_2562559_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262402.1|2562627_2563671_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	65.1	1.4e-82
WP_000139447.1|2563663_2564125_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.2	4.0e-79
WP_000450627.1|2564158_2564875_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.8	3.3e-72
WP_000603384.1|2564907_2565189_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
WP_000699809.1|2565185_2565413_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_001289673.1|2565405_2565717_+	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	92.2	7.2e-56
WP_000683609.1|2565844_2566063_+	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
WP_000104474.1|2566064_2566622_+	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_000935259.1|2566855_2567068_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000756596.1|2567187_2567532_+	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000191872.1|2567653_2567926_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
WP_001265229.1|2567927_2568977_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
WP_001217444.1|2568989_2569295_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	66.3	7.1e-32
WP_000640035.1|2569357_2569912_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	67.4	1.0e-65
WP_000917763.1|2570136_2570334_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	8.9e-28
WP_000301797.1|2570469_2571183_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001303509.1|2571637_2572066_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	97.8	4.4e-64
WP_000023184.1|2572543_2574394_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.9	0.0e+00
WP_024180155.1|2574832_2575048_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.3e-32
WP_000731241.1|2575052_2575397_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000992148.1|2575447_2575981_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
WP_001056806.1|2576251_2576821_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539795.1|2576820_2576967_+	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	87.0	1.1e-11
WP_001208680.1|2577189_2577375_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001302717.1|2577900_2578215_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001303940.1|2578296_2578521_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
WP_000867498.1|2578907_2579453_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	83.3	9.6e-80
WP_001027230.1|2579427_2581353_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.1	0.0e+00
WP_000198153.1|2581349_2581556_+	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_070080227.1|2581552_2582887_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.4	5.9e-256
WP_162829202.1|2582938_2584151_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000123254.1|2584447_2585767_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001295978.1|2585776_2586109_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000063265.1|2586164_2587190_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_000158906.1|2587231_2587630_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000753016.1|2587641_2587995_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	92.3	1.9e-57
WP_000975020.1|2588009_2588543_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	5.9e-58
WP_000683063.1|2588539_2588935_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	81.7	3.3e-58
WP_000235098.1|2588942_2589695_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	99.2	4.9e-135
WP_000479039.1|2589708_2590137_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	98.6	1.7e-71
WP_000532075.1|2590163_2590472_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	99.0	3.0e-54
WP_064032219.1|2590515_2593161_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	99.8	0.0e+00
WP_000847314.1|2593157_2593487_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	99.1	2.1e-58
WP_001151105.1|2593486_2594185_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_070080198.1|2594190_2594934_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.2	4.1e-150
WP_140395871.1|2594879_2595509_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.0	1.9e-103
WP_070080228.1|2595749_2599229_+	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	98.4	0.0e+00
WP_001230466.1|2599295_2599895_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	99.0	2.0e-110
WP_070080214.1|2599959_2601273_+|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.2	5.9e-75
WP_001023407.1|2601274_2601544_+|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_001131658.1|2601656_2602232_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.9	4.1e-89
WP_001356599.1|2602304_2602934_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	91.5	6.1e-78
WP_001143804.1|2603015_2603657_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	96.7	3.8e-104
WP_001120551.1|2603818_2604061_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_000527769.1|2605564_2607025_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.9e-42
WP_000214712.1|2607060_2607264_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
>prophage 8
NZ_CP017438	Escherichia coli O157:H7 strain 2159 chromosome, complete genome	5416633	2853017	2952536	5416633	protease,transposase,head,tail,terminase,integrase,holin	Stx2-converting_phage(35.09%)	101	2893962:2893989	2952673:2952700
WP_162829202.1|2853017_2854230_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000202114.1|2855447_2856014_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000506490.1|2856491_2857280_+	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_001302118.1|2857423_2858551_+	CMD domain-containing protein	NA	NA	NA	NA	NA
WP_000485019.1|2858618_2860553_+	exoribonuclease II	NA	Q0GXV6	Lactococcus_phage	27.9	2.4e-32
WP_000859972.1|2860787_2862773_+	cyclic di-GMP phosphodiesterase	NA	NA	NA	NA	NA
WP_001288364.1|2862920_2863094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001088621.1|2863183_2863933_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000498253.1|2864201_2864420_+	osmotically-inducible lipoprotein OsmB	NA	NA	NA	NA	NA
WP_001303294.1|2864545_2864872_-	stress response translation initiation inhibitor YciH	NA	NA	NA	NA	NA
WP_000176265.1|2864871_2865609_-	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_000891353.1|2865801_2866971_-	lipopolysaccharide assembly protein LapB	NA	NA	NA	NA	NA
WP_000876292.1|2866977_2867286_-	lipopolysaccharide assembly protein LapA	NA	NA	NA	NA	NA
WP_001256542.1|2867434_2868199_-	phosphatidylglycerophosphatase B	NA	NA	NA	NA	NA
WP_001176295.1|2868368_2868959_+	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.9	7.7e-43
WP_000099451.1|2869022_2871698_-	aconitate hydratase AcnA	NA	NA	NA	NA	NA
WP_001310756.1|2871861_2871957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000233043.1|2872070_2872238_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000908596.1|2872240_2872405_-	YmiA family putative membrane protein	NA	NA	NA	NA	NA
WP_000776253.1|2872699_2873674_-	HTH-type transcriptional regulator CysB	NA	NA	NA	NA	NA
WP_001295576.1|2873883_2876481_-	type I DNA topoisomerase	NA	A0A2K9L1Q2	Tupanvirus	34.5	7.0e-88
WP_001031530.1|2876860_2877112_+	YciN family protein	NA	NA	NA	NA	NA
WP_000422055.1|2877147_2878197_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559268.1|2878416_2879175_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	6.7e-07
WP_001278878.1|2879171_2879762_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_001291216.1|2879801_2880674_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_162829202.1|2881784_2882998_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001295575.1|2883810_2884431_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001285675.1|2884427_2885309_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001700591.1|2885446_2885491_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001194607.1|2885582_2887145_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_000763520.1|2887144_2888740_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.2	5.0e-52
WP_000983857.1|2888740_2890102_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.2	4.3e-36
WP_000209521.1|2890113_2891307_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000443092.1|2891306_2892113_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000807651.1|2892493_2892673_+	general stress protein	NA	NA	NA	NA	NA
WP_001056491.1|2892758_2893259_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079499.1|2893304_2893811_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
2893962:2893989	attL	GTGGTATCGATATCCATGTACCACACTG	NA	NA	NA	NA
WP_001345079.1|2895124_2895775_-	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	32.4	6.6e-27
WP_001144877.1|2897281_2897872_-	T3SS effector guanine nucleotide exchange factor EspM1	NA	NA	NA	NA	NA
WP_001303944.1|2898055_2898703_+	T3SS effector E3 ubiquitin-protein ligase NleG	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
WP_001414184.1|2898839_2898986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303943.1|2899413_2899692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171540.1|2900031_2900412_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000612591.1|2900408_2900756_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|2900805_2902344_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000938103.1|2903309_2903879_-	T3SS effector caspase inhibitor NleF	NA	NA	NA	NA	NA
WP_001509602.1|2903944_2904856_-	type III secretion system effector kinase NleH1-2	NA	A5LH48	Enterobacteria_phage	81.8	1.5e-133
WP_106409364.1|2904962_2905085_-|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	91.3	3.8e-05
WP_001025672.1|2906682_2908008_+	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	81.2	1.9e-214
WP_001023407.1|2909034_2909304_-|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_000216532.1|2909305_2910619_-|tail	phage tail protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.9	2.1e-80
WP_001228304.1|2910770_2911370_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	96.5	1.6e-107
WP_070080232.1|2911437_2914911_-	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	90.5	0.0e+00
WP_001152180.1|2915099_2915537_-|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	100.0	5.0e-63
WP_000807954.1|2915536_2915878_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_021503509.1|2915870_2919113_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	99.8	0.0e+00
WP_001453698.1|2919164_2919374_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030063.1|2919469_2919844_-|tail	phage tail assembly chaperone	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001275510.1|2919849_2920566_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	99.6	1.1e-128
WP_000133388.1|2920624_2920969_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573391.1|2920965_2921412_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007905.1|2921408_2921759_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125988.1|2921768_2922095_-|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001063023.1|2924621_2924843_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	98.6	3.8e-35
WP_070080219.1|2926887_2928549_-|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	98.9	0.0e+00
WP_047082927.1|2928545_2929109_-|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	83.4	7.1e-70
WP_000279796.1|2929399_2929765_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	100.0	3.1e-66
WP_000095736.1|2929806_2930034_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_012816791.1|2930458_2930644_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|2930871_2931018_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|2931017_2931587_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992148.1|2931857_2932391_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
WP_000731241.1|2932441_2932786_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_024180155.1|2932790_2933006_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.3e-32
WP_070080234.1|2933445_2935296_-	DUF1737 domain-containing protein	NA	B6DZ89	Enterobacteria_phage	98.9	0.0e+00
WP_000935549.1|2936092_2937157_-	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	93.5	2.9e-197
WP_000917750.1|2937307_2937505_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.0e-28
WP_000640048.1|2937746_2938277_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
WP_000904166.1|2938285_2938645_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.9	3.6e-35
WP_001302148.1|2938657_2939704_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.2	4.2e-108
WP_010917803.1|2939705_2939984_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_001217394.1|2940053_2940311_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000961820.1|2940531_2940744_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	70.0	1.4e-15
WP_001449026.1|2941022_2941781_-	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_001505071.1|2942479_2942644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000774808.1|2942640_2943222_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	80.2	8.6e-79
WP_157825328.1|2943408_2943951_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.7	1.5e-85
WP_000020556.1|2943862_2944903_-	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	7.9e-91
WP_000705621.1|2944874_2945426_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000912298.1|2945409_2945637_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000787428.1|2945713_2946121_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_001240336.1|2946384_2946684_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171903.1|2946756_2946975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394552.1|2946997_2947405_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
WP_000920491.1|2947382_2947616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449192.1|2948174_2948363_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001090200.1|2948359_2948551_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000048551.1|2948643_2951115_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.2	1.1e-58
WP_000113189.1|2951179_2951428_+	excisionase	NA	NA	NA	NA	NA
WP_000113674.1|2951405_2952536_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	51.4	3.4e-103
2952673:2952700	attR	GTGGTATCGATATCCATGTACCACACTG	NA	NA	NA	NA
>prophage 9
NZ_CP017438	Escherichia coli O157:H7 strain 2159 chromosome, complete genome	5416633	3047325	3120983	5416633	lysis,protease,portal,transposase,tRNA,head,tail,capsid,terminase,integrase,holin	Enterobacteria_phage(53.85%)	88	3091550:3091565	3119804:3119819
WP_162829202.1|3047325_3048539_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001131446.1|3051007_3051127_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001328621.1|3051087_3051273_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000122462.1|3051373_3051547_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001304448.1|3051608_3051893_+	glycine zipper family protein	NA	NA	NA	NA	NA
WP_000979977.1|3051896_3052232_+	YmgD family protein	NA	NA	NA	NA	NA
WP_001299921.1|3055329_3055548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001358812.1|3055679_3057203_-	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
WP_001065752.1|3057586_3057835_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000888778.1|3057947_3058214_-	biofilm/acid-resistance regulator AriR	NA	NA	NA	NA	NA
WP_000858015.1|3058242_3058515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000554146.1|3058557_3058794_-	two-component-system connector protein YcgZ	NA	NA	NA	NA	NA
WP_001359088.1|3059107_3060319_+	blue light-responsive regulator BluF	NA	NA	NA	NA	NA
WP_000332300.1|3060523_3061255_+	DNA-binding transcriptional repressor BluR	NA	Q9EYF2	Enterobacteria_phage	50.5	3.5e-53
WP_000373094.1|3061475_3061880_+	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_032169657.1|3061932_3062043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_120795380.1|3062278_3062323_+	protein YmgK	NA	NA	NA	NA	NA
WP_000872355.1|3062575_3062899_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	64.5	7.5e-40
WP_000539892.1|3063001_3063154_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	1.6e-21
WP_001358785.1|3063633_3064071_+	acetyltransferase	NA	NA	NA	NA	NA
WP_000361110.1|3064095_3064680_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001201843.1|3065178_3066132_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001226373.1|3066318_3067803_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000998048.1|3068105_3069644_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|3069693_3070041_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171540.1|3070037_3070418_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000937476.1|3070493_3070742_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	1.7e-12
WP_000239881.1|3070798_3071467_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000134810.1|3071964_3072147_+	general stress protein	NA	NA	NA	NA	NA
WP_001166090.1|3072225_3072726_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079482.1|3072762_3073269_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000488340.1|3073287_3074178_+	manganese catalase family protein	NA	NA	NA	NA	NA
WP_000885630.1|3074297_3074879_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.7	6.1e-101
WP_000279120.1|3074878_3077794_-|tail	phage tail protein	tail	Q6H9S9	Enterobacteria_phage	98.3	1.1e-57
WP_001230336.1|3077858_3078458_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	99.5	3.0e-111
WP_070080236.1|3078524_3081923_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.6	0.0e+00
WP_000090919.1|3081983_3082616_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	98.6	1.9e-95
WP_000194779.1|3082552_3083296_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_001152612.1|3083301_3084000_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
WP_000847331.1|3083999_3084329_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	100.0	2.5e-59
WP_000840323.1|3084325_3086875_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	87.3	0.0e+00
WP_000459457.1|3086867_3087302_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479161.1|3087283_3087706_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	2.4e-70
WP_001143002.1|3087721_3088462_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.9	8.3e-127
WP_000683105.1|3088469_3088865_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_000975102.1|3088861_3089440_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	98.4	2.9e-79
WP_000752995.1|3089451_3089805_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	99.1	9.9e-62
WP_000158906.1|3089816_3090215_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000063265.1|3090256_3091282_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_001295978.1|3091337_3091670_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
3091550:3091565	attL	CCAGCATCAGCGGGGT	NA	NA	NA	NA
WP_000123254.1|3091679_3092999_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001301524.1|3092979_3094581_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000198153.1|3094577_3094784_-	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001027374.1|3094780_3096706_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.1	0.0e+00
WP_000453564.1|3096680_3097226_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	97.8	2.6e-93
WP_001300120.1|3097614_3097809_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	98.4	1.5e-27
WP_001031427.1|3097973_3098180_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_001459037.1|3098465_3098876_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	97.8	8.0e-71
WP_000738495.1|3099167_3099461_+	serum resistance lipoprotein Bor	NA	K7PL54	Enterobacteria_phage	99.0	1.5e-47
WP_010917798.1|3099551_3099734_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	93.3	4.7e-15
WP_001180487.1|3099950_3100427_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	95.6	4.3e-84
WP_000544528.1|3100413_3100719_-|holin	phage holin family protein	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_001097228.1|3101040_3101730_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.9	1.7e-57
WP_000971093.1|3101726_3101867_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	71.1	7.7e-10
WP_001099695.1|3101863_3102226_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	7.3e-60
WP_000774484.1|3102222_3102513_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	93.8	4.3e-47
WP_000224907.1|3102505_3102676_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_001053040.1|3102675_3103131_-	recombination protein NinB	NA	I6PD71	Cronobacter_phage	64.9	8.6e-58
WP_001693106.1|3103632_3105159_-	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	31.1	9.3e-32
WP_001459030.1|3105216_3105339_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001070446.1|3105403_3105736_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_000145915.1|3105803_3106106_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_000788869.1|3106102_3106804_-	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	99.6	1.3e-129
WP_000088655.1|3107728_3107965_+	excisionase	NA	NA	NA	NA	NA
WP_000741454.1|3107954_3109097_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	100.0	8.1e-206
WP_000444477.1|3109210_3110461_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_001248690.1|3110632_3111286_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000476093.1|3111295_3111757_+	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001301861.1|3111810_3112917_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001301618.1|3112952_3113594_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000423729.1|3113597_3114968_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
WP_001265474.1|3115136_3115808_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000735407.1|3115807_3117268_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_000133424.1|3117868_3118150_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000835281.1|3118405_3118948_-|terminase	terminase small subunit	terminase	O64316	Escherichia_phage	44.2	1.8e-33
WP_000224603.1|3119153_3119567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000380883.1|3119579_3119915_-|head	head decoration protein	head	NA	NA	NA	NA
3119804:3119819	attR	CCAGCATCAGCGGGGT	NA	NA	NA	NA
WP_000907465.1|3119927_3120983_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	43.3	1.5e-68
>prophage 10
NZ_CP017438	Escherichia coli O157:H7 strain 2159 chromosome, complete genome	5416633	3127075	3178885	5416633	head,tail,terminase,integrase,holin	Stx2-converting_phage(26.53%)	60	3126939:3126953	3182986:3183000
3126939:3126953	attL	ACATTAAAAATCAGC	NA	NA	NA	NA
WP_000085256.1|3127075_3128305_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	56.1	3.8e-132
WP_001301987.1|3128553_3129675_+	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_000359446.1|3129723_3130950_-	peptidase T	NA	NA	NA	NA	NA
WP_000531594.1|3131199_3132336_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000799385.1|3132319_3133183_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000938118.1|3133546_3134908_+	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	29.2	1.4e-50
WP_001303921.1|3134968_3135244_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301984.1|3137552_3140954_-	type III secretion system effector EspN	NA	A0A0N7KZG3	Stx2-converting_phage	39.2	1.7e-219
WP_001301673.1|3141544_3143893_-	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_115801847.1|3143912_3144002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071527644.1|3144014_3144251_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	82.0	5.7e-21
WP_000967271.1|3144196_3144934_-|tail	phage tail protein	tail	B6ETG2	Enterobacteria_phage	100.0	8.2e-151
WP_000835336.1|3144987_3145866_-	phage repressor protein/antirepressor Ant	NA	I6R977	Salmonella_phage	77.2	2.5e-93
WP_032169778.1|3146129_3146279_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_000170104.1|3146388_3146643_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_001152182.1|3146659_3147358_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.3	8.1e-132
WP_000807954.1|3147357_3147699_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_070080237.1|3147691_3150934_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	99.9	0.0e+00
WP_001453698.1|3150985_3151195_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_000710952.1|3151290_3151665_-|tail	phage tail assembly chaperone	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_000133388.1|3152462_3152807_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573391.1|3152803_3153250_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007905.1|3153246_3153597_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125988.1|3153606_3153933_-|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001063023.1|3156459_3156681_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	98.6	3.8e-35
WP_070080238.1|3158725_3160387_-|terminase	terminase large subunit	terminase	H6WZK9	Escherichia_phage	99.1	0.0e+00
WP_070080218.1|3160383_3160947_-|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	83.4	9.3e-70
WP_000279786.1|3161235_3161601_-	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
WP_001302977.1|3161642_3161828_+	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	90.4	3.7e-20
WP_000347013.1|3161957_3162098_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000735655.1|3162454_3162679_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001208682.1|3162743_3162950_-	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_000539792.1|3163177_3163324_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|3163323_3163893_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992088.1|3164163_3164697_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	98.3	5.6e-101
WP_000731241.1|3164747_3165092_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000284518.1|3165096_3165312_-|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
WP_001289717.1|3165387_3165657_-	DUF826 domain-containing protein	NA	A0A2R2Z348	Escherichia_phage	75.3	8.2e-08
WP_001213059.1|3165694_3165877_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	67.8	1.0e-14
WP_000023170.1|3166024_3167962_-	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	76.8	2.5e-292
WP_000762928.1|3169040_3169862_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.2	4.1e-82
WP_001217410.1|3169858_3170233_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	2.1e-33
WP_001265159.1|3170245_3171295_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.2	1.4e-106
WP_001341388.1|3171296_3171575_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000887477.1|3171742_3171955_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_001278450.1|3172143_3172248_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000207955.1|3172363_3172951_-	DUF551 domain-containing protein	NA	K7PH57	Enterobacteria_phage	45.8	7.5e-38
WP_001014296.1|3172953_3173145_-	hypothetical protein	NA	G9L660	Escherichia_phage	98.4	1.6e-26
WP_000515959.1|3173146_3173584_-	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	94.0	1.9e-38
WP_000156547.1|3173570_3173888_-	hypothetical protein	NA	A0A088CQ13	Enterobacteria_phage	90.0	4.4e-45
WP_001017965.1|3173841_3174159_-	DUF4752 family protein	NA	A0A1I9LJV1	Stx_converting_phage	92.4	2.1e-42
WP_001310212.1|3174148_3174451_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	87.9	1.9e-45
WP_072140318.1|3174447_3174729_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.1	1.4e-29
WP_000451012.1|3174761_3175478_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.4	2.1e-71
WP_072143019.1|3175511_3176054_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	92.2	2.3e-81
WP_070080239.1|3175965_3177015_-	phage replisome organizer	NA	A0A0U2RT81	Escherichia_phage	77.1	7.7e-86
WP_000693915.1|3177083_3177509_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000711018.1|3177492_3177816_-	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	6.2e-10
WP_000948454.1|3177940_3178417_+	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
WP_001414141.1|3178732_3178885_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
3182986:3183000	attR	GCTGATTTTTAATGT	NA	NA	NA	NA
>prophage 11
NZ_CP017438	Escherichia coli O157:H7 strain 2159 chromosome, complete genome	5416633	3279990	3330892	5416633	protease,transposase	Stx2-converting_phage(27.78%)	47	NA	NA
WP_162829202.1|3279990_3281204_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001069768.1|3283575_3284448_-	GTPase family protein	NA	NA	NA	NA	NA
WP_000282125.1|3284775_3284958_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000422760.1|3285257_3285683_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	89.7	1.5e-43
WP_162829202.1|3285883_3287096_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001304205.1|3287768_3289937_-	DNA2/NAM7 family helicase	NA	NA	NA	NA	NA
WP_001304206.1|3289933_3290449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001345400.1|3290689_3291736_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_001287881.1|3293723_3293915_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000124179.1|3293967_3294201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001260384.1|3294296_3294920_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001167434.1|3295008_3295518_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001301456.1|3295975_3296434_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001231525.1|3297787_3298912_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_000958487.1|3299641_3299839_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_001340489.1|3299904_3300120_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000180465.1|3300479_3300668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001299815.1|3300764_3300944_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001004881.1|3300995_3301190_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001310149.1|3301970_3302306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000477623.1|3302938_3303157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001223350.1|3304609_3306700_+	bifunctional siderophore receptor/adhesin Iha	NA	A0A0P0I887	Acinetobacter_phage	31.5	2.6e-08
WP_001053349.1|3307213_3307600_-	TerD family protein	NA	NA	NA	NA	NA
WP_000301248.1|3308022_3308598_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	41.1	2.5e-30
WP_000116680.1|3308666_3309245_-	tellurium resistance membrane protein TerD	NA	A0A2P1N0L4	Streptomyces_phage	40.0	2.5e-06
WP_000255079.1|3309293_3310334_-	tellurium resistance membrane protein TerC	NA	K7QKE8	Escherichia_phage	48.0	2.2e-77
WP_000007449.1|3310356_3310812_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_001054789.1|3310834_3311992_-	TerD family protein	NA	NA	NA	NA	NA
WP_000254140.1|3311991_3312573_-	tellurium resistance TerZ family protein	NA	K4JRX3	Caulobacter_phage	30.5	1.7e-13
WP_001035166.1|3312895_3313954_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_001280118.1|3313963_3315106_+	phosphoribosyltransferase	NA	A0A172Q0Y1	Acinetobacter_phage	35.4	7.7e-31
WP_001040060.1|3315098_3315872_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001182418.1|3315873_3316953_+|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.4	6.2e-38
WP_000797375.1|3316952_3317909_+	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_000506896.1|3317919_3319128_+	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_001176766.1|3319145_3319613_+	tellurium resistance protein TerW	NA	NA	NA	NA	NA
WP_000042916.1|3319873_3320203_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_000957248.1|3320189_3320531_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_000088522.1|3321473_3323087_-|transposase	IS66-like element IS682 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	65.7	3.1e-166
WP_000624701.1|3323117_3323468_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	64.7	1.1e-39
WP_000435663.1|3323464_3323890_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	73.2	1.4e-33
WP_162829202.1|3324232_3325446_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_032169707.1|3325483_3327823_+	DEAD/DEAH box helicase family protein	NA	Q84473	Paramecium_bursaria_Chlorella_virus	32.5	1.8e-34
WP_000136079.1|3327984_3328161_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000998048.1|3328579_3330118_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|3330167_3330515_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|3330511_3330892_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
>prophage 12
NZ_CP017438	Escherichia coli O157:H7 strain 2159 chromosome, complete genome	5416633	3450812	3507894	5416633	protease,portal,transposase,head,tail,capsid,integrase,holin	Escherichia_phage(27.91%)	62	3452747:3452762	3509659:3509674
WP_000003653.1|3450812_3451400_-|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_001186424.1|3451396_3452104_-	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000107391.1|3452122_3453916_-	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
3452747:3452762	attL	ATTCAGCTGCTGAATG	NA	NA	NA	NA
WP_001301613.1|3453912_3455031_-	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_001023352.1|3457445_3457715_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A0P0ZEF0	Stx2-converting_phage	100.0	3.4e-46
WP_070080241.1|3457716_3459030_-|tail	phage tail protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.3	9.7e-78
WP_001230466.1|3459094_3459694_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	99.0	2.0e-110
WP_070080242.1|3459761_3463235_-	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	96.4	0.0e+00
WP_000649829.1|3463368_3463896_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_050546863.1|3464086_3464719_-|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.5	5.8e-105
WP_000194760.1|3464664_3465408_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.6	2.4e-150
WP_070080243.1|3465418_3466117_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	98.3	1.5e-130
WP_000847298.1|3466116_3466446_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001303170.1|3466442_3469022_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	80.0	0.0e+00
WP_000533402.1|3469002_3469416_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479117.1|3469442_3469874_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_029208397.1|3469887_3470628_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_001301534.1|3470609_3470876_-|capsid	major capsid protein	capsid	NA	NA	NA	NA
WP_000256723.1|3470933_3471281_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001254002.1|3471317_3472823_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000831796.1|3472812_3474405_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
WP_000259002.1|3474401_3474608_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000998048.1|3476784_3478323_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|3478372_3478720_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171540.1|3478716_3479097_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000235421.1|3479172_3479448_-	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	51.5	2.4e-10
WP_162829348.1|3480314_3481527_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.7	4.9e-169
WP_050547091.1|3481524_3481719_+|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	97.9	9.7e-19
WP_000138558.1|3481974_3482247_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001003126.1|3482406_3482940_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	93.8	1.5e-98
WP_000675931.1|3483160_3483274_+	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_012816791.1|3483495_3483681_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001303878.1|3484208_3484523_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_162829202.1|3484727_3485941_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_070080245.1|3486116_3487967_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.4	0.0e+00
WP_000261909.1|3488734_3489448_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000265269.1|3490068_3490887_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000090264.1|3491038_3491410_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	83.2	4.0e-53
WP_001217436.1|3491399_3491771_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_001265172.1|3491783_3492833_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.2e-110
WP_001341388.1|3492834_3493113_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000813263.1|3493280_3493436_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	94.1	1.9e-17
WP_000160654.1|3494040_3494814_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001151233.1|3495165_3495579_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.1	9.8e-61
WP_000450992.1|3495594_3496365_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	6.1e-80
WP_000788751.1|3496386_3497133_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	84.2	6.2e-114
WP_001205823.1|3497139_3498231_-	hypothetical protein	NA	V5URT9	Shigella_phage	70.0	5.1e-133
WP_000273724.1|3498309_3498765_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000693855.1|3498971_3499397_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000887453.1|3499380_3499653_-	helix-turn-helix domain-containing protein	NA	A0A0U2S629	Escherichia_phage	45.8	1.1e-12
WP_000986592.1|3499761_3500163_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	54.5	7.4e-13
WP_000536233.1|3500190_3500382_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303876.1|3500381_3500669_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000379575.1|3500946_3501102_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_001458970.1|3501243_3501567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001133046.1|3501819_3502005_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000413705.1|3502578_3502767_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001098307.1|3502763_3502955_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000034474.1|3503048_3505520_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_000273151.1|3505587_3505830_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_001299351.1|3505807_3506827_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.3e-85
WP_000375128.1|3507234_3507894_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	1.8e-48
3509659:3509674	attR	ATTCAGCTGCTGAATG	NA	NA	NA	NA
>prophage 13
NZ_CP017438	Escherichia coli O157:H7 strain 2159 chromosome, complete genome	5416633	3738827	3763902	5416633	lysis,protease,transposase,tail,terminase,integrase,holin	Escherichia_phage(35.71%)	35	3738412:3738426	3763976:3763990
3738412:3738426	attL	TTAGTATAAAAAAGC	NA	NA	NA	NA
WP_001247925.1|3738827_3739526_-|protease	T3SS effector zinc metalloprotease NleD	protease	NA	NA	NA	NA
WP_000951026.1|3739756_3740638_-	type III secretion system effector kinase NleH1-1	NA	A5LH48	Enterobacteria_phage	90.1	8.6e-147
WP_072127173.1|3740806_3740968_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	72.5	3.9e-13
WP_115801843.1|3741464_3742484_-|protease	type III secretion system effector zinc metalloprotease NleC	protease	NA	NA	NA	NA
WP_000950813.1|3742517_3743498_-	type III secretion system effector arginine glycosyltransferase NleB2	NA	Q8HAB2	Salmonella_phage	49.5	2.9e-87
WP_001024022.1|3743674_3743944_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1I9LJT0	Stx_converting_phage	98.9	4.9e-45
WP_000741877.1|3743945_3745199_-|tail	phage tail protein	tail	A0A0P0ZDE7	Stx2-converting_phage	93.7	2.4e-70
WP_072140989.1|3745258_3745837_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	92.2	6.8e-100
WP_162829202.1|3745903_3747116_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001072975.1|3747181_3747394_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000934140.1|3747390_3749493_-|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	96.6	0.0e+00
WP_000349509.1|3749492_3749984_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	87.2	1.3e-72
WP_001139679.1|3750658_3750811_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	8.9e-20
WP_000092302.1|3750798_3751266_-|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	97.4	9.4e-76
WP_000075107.1|3751262_3751760_-	lysozyme RrrD	NA	A0A1B5FP97	Escherichia_phage	98.2	7.1e-90
WP_000284524.1|3751759_3751975_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_012578864.1|3752117_3752516_+	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000499454.1|3752596_3752755_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001302581.1|3752840_3753584_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097238.1|3753767_3754457_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_032160865.1|3754471_3754594_-	YlcG family protein	NA	NA	NA	NA	NA
WP_000750155.1|3754931_3755891_+	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_001028854.1|3756102_3756768_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001108055.1|3756764_3757385_-	recombination protein NinG	NA	Q716C3	Shigella_phage	96.1	1.6e-94
WP_000567001.1|3757377_3757548_-	protein ninF	NA	Q716C4	Shigella_phage	96.4	7.9e-25
WP_001254218.1|3757544_3757727_-	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	96.7	4.8e-28
WP_162829202.1|3758647_3759861_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000682316.1|3760414_3760597_+	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	95.0	4.1e-27
WP_000548536.1|3760569_3760761_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	96.8	1.1e-25
WP_000188862.1|3760837_3761053_+	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	98.6	2.9e-32
WP_000763363.1|3761151_3761373_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	98.6	6.4e-35
WP_000120056.1|3761583_3762186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000545728.1|3762428_3762596_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	1.3e-27
WP_001303849.1|3762635_3762854_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000533643.1|3762831_3763902_+|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	100.0	3.9e-202
3763976:3763990	attR	TTAGTATAAAAAAGC	NA	NA	NA	NA
>prophage 14
NZ_CP017438	Escherichia coli O157:H7 strain 2159 chromosome, complete genome	5416633	4275668	4312545	5416633	transposase,holin	Escherichia_phage(37.5%)	24	NA	NA
WP_000131044.1|4275668_4277702_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
WP_001301903.1|4277830_4278418_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000089099.1|4278431_4279904_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001159112.1|4279917_4281606_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.4	1.3e-61
WP_001356433.1|4282286_4282421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072140985.1|4284504_4285266_+	protein HyxA	NA	NA	NA	NA	NA
WP_000798051.1|4285307_4286402_+	adhesin	NA	NA	NA	NA	NA
WP_001356435.1|4286355_4286568_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_001301982.1|4287660_4288356_-	lactate utilization protein C	NA	NA	NA	NA	NA
WP_000023931.1|4288348_4289776_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_162829202.1|4289936_4291149_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000339591.1|4292346_4293201_-	DNA-binding transcriptional regulator RclR	NA	NA	NA	NA	NA
WP_001046339.1|4293426_4294752_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.4	1.6e-112
WP_000474077.1|4294860_4295097_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000417405.1|4295108_4295702_+	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_001458949.1|4295861_4296731_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	41.7	1.0e-51
WP_000621002.1|4296979_4297837_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000092592.1|4297957_4302211_-	intimin-like adhesin FdeC	NA	NA	NA	NA	NA
WP_162829202.1|4302926_4304140_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001038968.1|4304857_4305214_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001509407.1|4305501_4306428_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000860023.1|4306584_4307505_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_171878957.1|4308510_4309724_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	98.6	7.1e-168
WP_000998051.1|4311006_4312545_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.8	1.0e-299
>prophage 15
NZ_CP017438	Escherichia coli O157:H7 strain 2159 chromosome, complete genome	5416633	4346452	4404847	5416633	transposase,plate	Escherichia_phage(13.33%)	49	NA	NA
WP_162829348.1|4346452_4347665_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.7	4.9e-169
WP_087498070.1|4347764_4348607_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_001509364.1|4348629_4351281_-	AAA family ATPase	NA	A0A1B1IUG5	uncultured_Mediterranean_phage	25.1	5.4e-43
WP_000165865.1|4352348_4353224_+	GTPase family protein	NA	NA	NA	NA	NA
WP_000189397.1|4353437_4354145_+	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_001458941.1|4354146_4354296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000508241.1|4354307_4354523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000642925.1|4354614_4355025_+	hypothetical protein	NA	G5DES5	Salmonella_phage	42.6	2.1e-26
WP_000480477.1|4355090_4356029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001234373.1|4356118_4356937_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.0	6.1e-46
WP_000214420.1|4357028_4357514_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.0	2.0e-12
WP_001186786.1|4357529_4358006_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692308.1|4358074_4358296_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.1e-10
WP_162829348.1|4359033_4360246_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.7	4.9e-169
WP_000942525.1|4360892_4361963_+	DNA cytosine methyltransferase	NA	A0A1B1IRZ3	uncultured_Mediterranean_phage	29.6	2.6e-20
WP_001444700.1|4361941_4362601_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_000893282.1|4363120_4364374_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	3.4e-96
WP_001285288.1|4364385_4365489_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749881.1|4365776_4366832_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
WP_000174701.1|4366870_4367272_-	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000189536.1|4367329_4368574_-	esterase FrsA	NA	NA	NA	NA	NA
WP_001291990.1|4368665_4369124_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001293009.1|4369384_4370842_+	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_001059871.1|4371940_4372393_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001263495.1|4372402_4372801_-	type II toxin-antitoxin system mRNA interferase toxin YafO	NA	NA	NA	NA	NA
WP_000554757.1|4372803_4373097_-	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001226186.1|4373148_4374204_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000207556.1|4374274_4375060_-	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001301901.1|4375004_4376744_+	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_000543891.1|4377561_4378335_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.2e-19
WP_000729705.1|4378520_4378781_+	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_001303998.1|4378799_4379060_+	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
WP_001225679.1|4379215_4379956_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001301698.1|4379926_4380694_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_000284050.1|4380798_4381377_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_000973071.1|4381616_4384061_+	acyl-CoA dehydrogenase FadE	NA	NA	NA	NA	NA
WP_000532698.1|4384103_4384577_-	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_001118031.1|4384730_4385501_+	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_000027427.1|4385618_4386791_-|transposase	ISAs1-like element ISEc26 family transposase	transposase	NA	NA	NA	NA
WP_120795385.1|4386871_4387057_+	protein YncO	NA	NA	NA	NA	NA
WP_000247943.1|4386971_4387235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070080248.1|4389199_4390336_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_000509109.1|4394267_4398500_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	46.1	2.1e-25
WP_000103342.1|4398575_4400717_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	1.1e-25
WP_001142958.1|4400926_4401445_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000037399.1|4402141_4402642_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000123970.1|4402676_4402901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001509383.1|4402951_4404343_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000599596.1|4404433_4404847_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 16
NZ_CP017438	Escherichia coli O157:H7 strain 2159 chromosome, complete genome	5416633	5045087	5059752	5416633	tail,tRNA,integrase	Enterobacteria_phage(43.75%)	19	5040928:5040943	5058457:5058472
5040928:5040943	attL	TGCTGGTGGCAGGAAT	NA	NA	NA	NA
WP_000918366.1|5045087_5046503_-	replicative DNA helicase	NA	O80281	Escherichia_phage	78.1	8.3e-200
WP_000235522.1|5046585_5047569_+	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000891404.1|5047734_5047977_-	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_000543819.1|5048110_5049148_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_000332269.1|5049236_5050334_+|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	99.5	2.1e-211
WP_001217541.1|5050395_5050644_+	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_001143816.1|5050804_5051446_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	99.1	1.1e-106
WP_072140863.1|5051527_5052157_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	93.5	1.4e-79
WP_001118000.1|5052229_5052802_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	53.2	2.5e-46
WP_001023355.1|5052913_5053183_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A0P0ZEF0	Stx2-converting_phage	96.6	2.7e-43
WP_000268945.1|5053184_5054498_-|tail	phage tail protein	tail	A0A0P0ZE15	Stx2-converting_phage	98.2	2.5e-81
WP_001230514.1|5054562_5055162_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.0	5.7e-110
WP_000008211.1|5056483_5057020_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.3	3.1e-99
WP_001242740.1|5057010_5057361_+	hypothetical protein	NA	A0A0P0ZBF8	Stx2-converting_phage	94.8	1.6e-56
WP_000145668.1|5057357_5057642_+	hypothetical protein	NA	I6S1S6	Salmonella_phage	83.9	1.3e-40
WP_000829415.1|5057977_5058175_+	hypothetical protein	NA	K7PH57	Enterobacteria_phage	68.6	7.5e-11
WP_001093918.1|5058519_5058801_+	pyocin activator PrtN family protein	NA	K7PGU0	Enterobacteria_phage	98.9	8.7e-45
5058457:5058472	attR	ATTCCTGCCACCAGCA	NA	NA	NA	NA
WP_000654815.1|5058848_5059022_-	hypothetical protein	NA	K7PJQ2	Enterobacteria_phage	100.0	4.4e-23
WP_000956557.1|5059218_5059752_-	hypothetical protein	NA	K7PKJ4	Enterobacteria_phage	100.0	1.1e-99
>prophage 1
NZ_CP017439	Escherichia coli O157:H7 strain 2159 plasmid pO157, complete sequence	92596	3474	54867	92596	protease,integrase,transposase	Stx2-converting_phage(30.0%)	39	39658:39672	60057:60071
WP_162829348.1|3474_4687_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.7	4.9e-169
WP_000592771.1|4860_7071_+	catalase/peroxidase KatP	NA	NA	NA	NA	NA
WP_001172748.1|7114_7504_+	cytochrome b562 family protein	NA	NA	NA	NA	NA
WP_001034100.1|8729_12632_+|protease	serine protease autotransporter EspP	protease	Q9LA58	Enterobacterial_phage	40.4	9.5e-238
WP_001171540.1|13000_13381_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000612591.1|13377_13725_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|13774_15313_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_001302199.1|17259_18081_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_000975743.1|18080_19187_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_000550559.1|19276_20998_+	phosphoethanolamine transferase CptA	NA	NA	NA	NA	NA
WP_001302181.1|21071_22070_+	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_001358886.1|22938_25635_+|protease	metalloprotease StcE	protease	NA	NA	NA	NA
WP_001302175.1|25721_26597_+	type II secretion system protein GspC	NA	NA	NA	NA	NA
WP_001302177.1|26597_28565_+	variant type II secretion system secretin EtpD	NA	NA	NA	NA	NA
WP_000092338.1|28564_30070_+	type II secretion system ATPase GspE	NA	NA	NA	NA	NA
WP_001173152.1|30071_31295_+	type II secretion system inner membrane protein GspF	NA	NA	NA	NA	NA
WP_001231211.1|31325_31760_+	type II secretion system major pseudopilin GspG	NA	NA	NA	NA	NA
WP_000082929.1|31756_32311_+	type II secretion system minor pseudopilin GspH	NA	NA	NA	NA	NA
WP_000173396.1|32325_32673_+	type II secretion system minor pseudopilin GspI	NA	NA	NA	NA	NA
WP_000082782.1|32669_33269_+	type II secretion system minor pseudopilin GspJ	NA	NA	NA	NA	NA
WP_000776550.1|33265_34243_+	type II secretion system minor pseudopilin GspK	NA	NA	NA	NA	NA
WP_071525076.1|34281_35454_+	type II secretion system protein GspL	NA	NA	NA	NA	NA
WP_001004187.1|35440_35953_+	type II secretion system protein M	NA	NA	NA	NA	NA
WP_000096786.1|36010_36844_+	prepilin peptidase	NA	NA	NA	NA	NA
WP_000971918.1|36935_37337_+	GspS family T2SS pilot lipoprotein variant EptO	NA	NA	NA	NA	NA
WP_000839950.1|39227_39743_+	enterohemolysin-activating lysine-acyltransferase EhxC	NA	NA	NA	NA	NA
39658:39672	attL	AAATATTCAGGCAAT	NA	NA	NA	NA
WP_000217739.1|39744_42741_+	enterohemolysin EhxA	NA	NA	NA	NA	NA
WP_000987091.1|42790_44911_+	enterohemolysin T1SS ABC transporter permease/ATPase EhxB	NA	W8CYL7	Bacillus_phage	30.2	7.1e-46
WP_001213545.1|44914_46354_+	enterohemolysin T1SS ABC transporter subunit EhxD	NA	NA	NA	NA	NA
WP_010891288.1|47096_47327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001066920.1|47447_48188_+|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	2.0e-24
WP_000361615.1|48472_49450_-	replication initiation protein	NA	J9Q7H0	Salmonella_phage	58.9	5.1e-100
WP_000708307.1|49857_50058_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001248529.1|50054_50675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010891291.1|50671_51355_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_000813634.1|51813_52032_+	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_001159868.1|52033_52339_+	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_000016988.1|52339_53122_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.2	1.9e-49
WP_162829202.1|53653_54867_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
60057:60071	attR	AAATATTCAGGCAAT	NA	NA	NA	NA
