The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP017440	Escherichia coli O157:H7 strain 3384 chromosome, complete genome	5438591	1231098	1245849	5438591	holin,tail,transposase	Enterobacteria_phage(42.86%)	18	NA	NA
WP_001223948.1|1231098_1231710_+	recombination protein NinG	NA	A0A1U9AJF8	Stx1_converting_phage	95.6	2.5e-92
WP_001028854.1|1231706_1232372_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001235472.1|1232368_1232992_+	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.1	2.2e-112
WP_001302581.1|1233244_1233988_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499458.1|1234073_1234241_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_000143068.1|1234648_1236502_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	97.7	0.0e+00
WP_000284517.1|1236651_1236867_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000731259.1|1236871_1237216_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_001171554.1|1237572_1237953_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|1237949_1238297_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_162829202.1|1238797_1240011_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001023396.1|1240228_1240498_+|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
WP_000442132.1|1240658_1241081_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	97.0	5.7e-72
WP_001301665.1|1241210_1242269_-	T3SS effector EspW	NA	NA	NA	NA	NA
WP_001144077.1|1242347_1242998_-	T3SS effector NleG family protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
WP_001132157.1|1243180_1243771_+	T3SS effector guanine nucleotide exchange factor EspM2	NA	NA	NA	NA	NA
WP_001217542.1|1244272_1244521_-	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_000162574.1|1245366_1245849_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
>prophage 2
NZ_CP017440	Escherichia coli O157:H7 strain 3384 chromosome, complete genome	5438591	1523427	1530166	5438591	integrase,transposase	Enterobacteria_phage(50.0%)	6	1512415:1512431	1532362:1532378
1512415:1512431	attL	GGTTGTCGATACCAATA	NA	NA	NA	NA
WP_000950857.1|1523427_1523997_+	hypothetical protein	NA	Q716G6	Shigella_phage	99.3	4.6e-69
WP_162829202.1|1524381_1525595_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000960724.1|1525763_1526444_+	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	71.0	1.8e-59
WP_000257010.1|1526453_1527590_+	phage DNA ejection protein	NA	Q716G3	Shigella_phage	72.8	1.4e-80
WP_000958700.1|1527764_1528922_-|integrase	prophage integrase IntS	integrase	E7DYQ6	Enterobacteria_phage	100.0	2.2e-222
WP_000368131.1|1529233_1530166_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
1532362:1532378	attR	GGTTGTCGATACCAATA	NA	NA	NA	NA
>prophage 3
NZ_CP017440	Escherichia coli O157:H7 strain 3384 chromosome, complete genome	5438591	1775785	1879661	5438591	holin,protease,tail,tRNA,terminase,transposase,portal	Enterobacteria_phage(64.29%)	119	NA	NA
WP_000569336.1|1775785_1776712_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
WP_000783120.1|1776716_1777448_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1777428_1777536_-	protein YohO	NA	NA	NA	NA	NA
WP_027868261.1|1777595_1778297_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	100.0	4.6e-103
WP_000063648.1|1778317_1779604_-	DUF3596 domain-containing protein	NA	Q9EY96	Enterobacteria_phage	100.0	7.6e-253
WP_001193437.1|1779637_1779892_-	excisionase family protein	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
WP_000556583.1|1779910_1780045_-	hypothetical protein	NA	A0A0P0ZDP5	Stx2-converting_phage	100.0	4.9e-22
WP_000457728.1|1780048_1780291_-	DUF4222 domain-containing protein	NA	B6DZ51	Enterobacteria_phage	100.0	1.5e-37
WP_000610375.1|1780378_1780741_-	DUF551 domain-containing protein	NA	Q9EY98	Enterobacteria_phage	100.0	1.8e-71
WP_000207903.1|1780737_1781094_-	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	100.0	3.1e-63
WP_001304101.1|1781427_1781604_-	hypothetical protein	NA	B6DZ55	Enterobacteria_phage	98.3	3.0e-27
WP_001289954.1|1781605_1782553_-	ead/Ea22-like family protein	NA	A0A0P0ZE96	Stx2-converting_phage	100.0	3.6e-183
WP_000763383.1|1782549_1782771_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_000188870.1|1782869_1783085_-	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	100.0	1.0e-32
WP_000548547.1|1783161_1783353_-	DUF1382 family protein	NA	A0A1I9LJM8	Stx_converting_phage	100.0	1.9e-27
WP_001303590.1|1783325_1783508_-	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	100.0	7.4e-29
WP_000186740.1|1783507_1784185_-	YqaJ viral recombinase family protein	NA	A0A1I9LJM9	Stx_converting_phage	100.0	4.6e-132
WP_000100847.1|1784181_1784967_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995395.1|1784972_1785269_-	host-nuclease inhibitor protein Gam	NA	Q9EYA6	Enterobacteria_phage	100.0	4.3e-50
WP_000372942.1|1785344_1785488_-	host cell division inhibitory peptide Kil	NA	Q9EYA7	Enterobacteria_phage	100.0	1.2e-18
WP_001198861.1|1785456_1785621_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000065377.1|1785693_1786062_-	DUF2528 family protein	NA	A0A1I9LJN3	Stx_converting_phage	100.0	7.6e-65
WP_001066169.1|1786322_1786904_+	superinfection exclusion B family protein	NA	Q9EYA9	Enterobacteria_phage	100.0	4.0e-100
WP_000256574.1|1786920_1787193_-	hypothetical protein	NA	Q9EYB0	Enterobacteria_phage	100.0	2.0e-41
WP_000990548.1|1787705_1788257_-	hypothetical protein	NA	A4KWR1	Enterobacteria_phage	100.0	4.1e-70
WP_001280993.1|1788263_1788545_-	hypothetical protein	NA	A4KWR2	Enterobacteria_phage	100.0	1.1e-44
WP_001299796.1|1788667_1789315_-	LexA family transcriptional regulator	NA	K7PH19	Enterobacteria_phage	100.0	1.2e-121
WP_001033078.1|1789423_1789642_+	helix-turn-helix transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	100.0	1.1e-34
WP_000035953.1|1789756_1790053_+	hypothetical protein	NA	Q9EYB4	Enterobacteria_phage	100.0	1.8e-48
WP_000185456.1|1790085_1791024_+	replication protein	NA	C1JJ53	Enterobacteria_phage	100.0	2.8e-172
WP_000788906.1|1791020_1791722_+	Replication protein 14	NA	Q9EYB6	Enterobacteria_phage	100.0	5.8e-130
WP_000145935.1|1791718_1792009_+	protein ren	NA	A0A0P0ZCJ0	Stx2-converting_phage	100.0	9.6e-47
WP_001000130.1|1792079_1792358_+	hypothetical protein	NA	Q9EYB9	Enterobacteria_phage	100.0	4.4e-49
WP_000103678.1|1792490_1792706_+	hypothetical protein	NA	A0A0N7KZ98	Stx2-converting_phage	100.0	7.7e-33
WP_001281772.1|1792716_1792953_+	restriction alleviation protein, Lar family	NA	Q8HA09	Enterobacteria_phage	100.0	1.2e-39
WP_001304104.1|1792909_1793356_+	recombination protein NinB	NA	A0A1I9LJP8	Stx_converting_phage	100.0	2.4e-81
WP_000153268.1|1793352_1793880_+	phage N-6-adenine-methyltransferase	NA	Q9EYC2	Enterobacteria_phage	100.0	1.6e-100
WP_001254255.1|1793876_1794053_+	NinE family protein	NA	A5VW90	Enterobacteria_phage	100.0	4.6e-28
WP_000924601.1|1794055_1794457_+	hypothetical protein	NA	Q9EYC4	Enterobacteria_phage	100.0	1.4e-72
WP_001543885.1|1794416_1794626_+	protein ninF	NA	G9L691	Escherichia_phage	97.1	3.5e-30
WP_001107983.1|1794618_1795224_+	recombination protein NinG	NA	Q9EYC6	Enterobacteria_phage	100.0	2.3e-98
WP_000144764.1|1795220_1795415_+	phage NinH family protein	NA	G9L694	Escherichia_phage	100.0	1.9e-30
WP_001204849.1|1795407_1795842_+	antitermination protein	NA	Q8VNP1	Enterobacteria_phage	100.0	4.3e-83
WP_000691354.1|1796348_1797296_+	Shiga toxin Stx1 subunit A	NA	Q777W4	Enterobacteria_phage	100.0	3.2e-171
WP_000752026.1|1797305_1797575_+	Shiga toxin Stx1a subunit B	NA	Q7AYI7	Enterobacteria_phage	100.0	1.6e-43
WP_000874257.1|1798085_1800032_+	DUF1737 domain-containing protein	NA	Q9EYC8	Enterobacteria_phage	100.0	0.0e+00
WP_000143458.1|1800169_1800349_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290230.1|1800389_1800635_+	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000284506.1|1800712_1800928_+|holin	class II holin family protein	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_000087728.1|1800932_1801466_+	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	100.0	1.8e-102
WP_001056806.1|1801736_1802306_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|1802305_1802452_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|1802679_1802865_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001302882.1|1803076_1803349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000348565.1|1803381_1803858_+	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	100.0	2.1e-83
WP_001077625.1|1803854_1805978_+|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	100.0	0.0e+00
WP_000102414.1|1805974_1806187_+	hypothetical protein	NA	S5MBY8	Escherichia_phage	97.1	1.1e-28
WP_000974564.1|1806186_1807689_+|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	100.0	4.8e-291
WP_164848152.1|1808595_1809809_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001097065.1|1811058_1811385_+	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001281350.1|1811377_1811659_+	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
WP_000974966.1|1811661_1812285_+|tail	phage tail protein	tail	Q9EYD6	Enterobacteria_phage	100.0	6.6e-101
WP_000682716.1|1812297_1812696_+|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000235090.1|1812703_1813456_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000479043.1|1813469_1813892_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	100.0	5.1e-73
WP_000532073.1|1813918_1814227_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	100.0	1.3e-54
WP_000918269.1|1814270_1816916_+|tail	phage tail tape measure protein	tail	Q9EYE1	Enterobacteria_phage	100.0	0.0e+00
WP_000847298.1|1816912_1817242_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001301816.1|1817241_1817940_+|tail	phage minor tail protein L	tail	Q9EYE3	Enterobacteria_phage	100.0	1.5e-133
WP_000194798.1|1817950_1818694_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	100.0	3.7e-151
WP_072147834.1|1818639_1819269_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	99.5	3.5e-110
WP_001356361.1|1819509_1820685_+	host specificity protein J	NA	Q9EYE6	Enterobacteria_phage	100.0	3.8e-235
WP_115801855.1|1820636_1822982_+	host specificity protein J	NA	Q9EYE7	Enterobacteria_phage	99.9	0.0e+00
WP_001228289.1|1823049_1823649_+	Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	100.0	2.6e-110
WP_000268835.1|1823713_1825027_+|tail	phage tail protein	tail	Q9EYE8	Enterobacteria_phage	100.0	8.8e-79
WP_001023431.1|1825028_1825298_+|tail	phage tail fiber C-terminal domain-containing protein	tail	Q9EYE9	Enterobacteria_phage	100.0	2.9e-45
WP_001261937.1|1825665_1825914_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	97.6	9.1e-38
WP_001301761.1|1826428_1828114_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	100.0	1.7e-305
WP_000598641.1|1828110_1828830_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1828876_1829347_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|1829388_1829850_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001087225.1|1829974_1831978_-	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	100.0	0.0e+00
WP_001302810.1|1831974_1833111_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	100.0	1.9e-167
WP_000528951.1|1833103_1833835_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001294377.1|1833853_1835383_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001302026.1|1835393_1836482_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_000636932.1|1837722_1838040_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000356841.1|1838101_1841731_-	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_001301615.1|1848688_1850722_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.4e-54
WP_001005448.1|1850853_1851963_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_010904812.1|1852224_1852506_+	DUF2574 family protein	NA	NA	NA	NA	NA
WP_000682830.1|1852797_1853340_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000677408.1|1853427_1854102_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000945390.1|1854117_1856598_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_001301545.1|1856608_1857643_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000153070.1|1857724_1858063_-	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_000134629.1|1858280_1859132_-	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000019944.1|1859252_1859525_+	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_000735648.1|1859634_1859949_-	outer membrane protein	NA	NA	NA	NA	NA
WP_000836936.1|1859958_1860306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000141034.1|1861356_1861596_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001195634.1|1861929_1862718_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000822268.1|1862714_1863515_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_001301907.1|1863579_1864398_+	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	37.6	4.2e-23
WP_000434038.1|1864449_1865196_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000011970.1|1865169_1866135_-	kinase	NA	NA	NA	NA	NA
WP_000846238.1|1866131_1867136_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	4.9e-13
WP_000859148.1|1867132_1868410_-	MFS transporter	NA	NA	NA	NA	NA
WP_000129551.1|1868666_1869719_+	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_001301486.1|1870017_1870872_+	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_000853846.1|1870900_1872163_+	tagatose-bisphosphate aldolase subunit GatZ	NA	NA	NA	NA	NA
WP_000182899.1|1872172_1872625_+	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_000823288.1|1872655_1872940_+	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000490679.1|1872943_1874299_+	galactitol permease IIC component	NA	NA	NA	NA	NA
WP_000844219.1|1874346_1875387_+	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000178551.1|1875486_1876266_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000807362.1|1876347_1877247_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
WP_001303579.1|1877652_1877970_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000476014.1|1878299_1879661_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.7	1.9e-217
>prophage 4
NZ_CP017440	Escherichia coli O157:H7 strain 3384 chromosome, complete genome	5438591	1977674	2050072	5438591	integrase,holin,head,tail,terminase,transposase,portal,capsid	Enterobacteria_phage(32.65%)	71	1977181:1977196	2034261:2034276
1977181:1977196	attL	AAACGGTTCCCCATAC	NA	NA	NA	NA
WP_162829204.1|1977674_1978888_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	97.6	8.2e-164
WP_000966626.1|1979259_1981407_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_000998048.1|1982854_1984393_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|1984442_1984790_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|1984786_1985167_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000973176.1|1985528_1986074_+	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_001295633.1|1986070_1986814_+	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_001193830.1|1986825_1987905_+	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000986334.1|1987966_1988902_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001011474.1|1989358_1990276_+	nitrogen assimilation transcriptional regulator NAC	NA	NA	NA	NA	NA
WP_001011000.1|1990377_1991328_+	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_000532909.1|1993714_1994431_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001060244.1|1994773_1996228_-	AMP nucleosidase	NA	NA	NA	NA	NA
WP_000378596.1|1996329_1997646_-	shikimate transporter	NA	NA	NA	NA	NA
WP_000480501.1|1997959_1999012_+	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_001302302.1|2007746_2008544_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000533600.1|2008779_2009802_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.4	2.0e-99
WP_000094838.1|2009801_2010005_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000034457.1|2010063_2012535_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_000199485.1|2012630_2012819_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449168.1|2012815_2013004_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_000367376.1|2013484_2013637_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	8.7e-07
WP_000444607.1|2013911_2014556_-	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	24.9	2.8e-06
WP_001261752.1|2014653_2014881_+	cell division protein	NA	NA	NA	NA	NA
WP_000693816.1|2014877_2015303_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262409.1|2015371_2016409_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	68.3	1.1e-87
WP_072143023.1|2016320_2016863_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	96.7	6.4e-84
WP_000450610.1|2016897_2017596_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	59.5	1.6e-71
WP_000702797.1|2017617_2017842_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	42.3	3.6e-09
WP_001290006.1|2017838_2018195_+	hypothetical protein	NA	A0A222YY85	Escherichia_phage	65.8	3.1e-15
WP_001414276.1|2018227_2018380_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000111243.1|2018376_2018688_+	hypothetical protein	NA	A0A222YY67	Escherichia_phage	83.5	2.4e-51
WP_000137954.1|2018814_2019378_+	hypothetical protein	NA	H6WZG0	Escherichia_phage	94.9	4.5e-48
WP_001278460.1|2019487_2019592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000902687.1|2019778_2019991_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	7.6e-25
WP_001310296.1|2020158_2020437_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	1.3e-11
WP_001265075.1|2020438_2021488_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.3e-109
WP_000904141.1|2021500_2021860_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.9	1.5e-36
WP_001059369.1|2021856_2022546_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	1.5e-58
WP_001303558.1|2023179_2023608_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.4	4.9e-63
WP_000023257.1|2024085_2025936_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.4	0.0e+00
WP_162829202.1|2026017_2027231_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_024165672.1|2027541_2027757_+|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	98.6	7.7e-33
WP_000731204.1|2027761_2028106_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	99.1	1.7e-58
WP_000992126.1|2028156_2028690_+	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	97.7	1.4e-99
WP_001303555.1|2028845_2029028_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001280929.1|2029040_2029172_+	hypothetical protein	NA	A0A0N7BYT9	Escherichia_phage	88.4	9.4e-10
WP_001208680.1|2029399_2029585_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001302690.1|2030111_2030426_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001299328.1|2030507_2030732_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.7	4.1e-21
WP_000235436.1|2031126_2031636_+|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001302857.1|2031607_2033536_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.9	3.3e-260
WP_000259002.1|2033519_2033726_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000831796.1|2033722_2035315_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
2034261:2034276	attR	GTATGGGGAACCGTTT	NA	NA	NA	NA
WP_001254002.1|2035304_2036810_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000256723.1|2036846_2037194_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001301534.1|2037251_2037518_+|capsid	major capsid protein	capsid	NA	NA	NA	NA
WP_029208397.1|2037499_2038240_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_000479117.1|2038253_2038685_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_000533402.1|2038711_2039125_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_101975986.1|2039105_2040968_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	83.5	1.4e-268
WP_001304129.1|2040919_2041684_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	98.0	3.3e-134
WP_000847298.1|2041680_2042010_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001151105.1|2042009_2042708_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_000194798.1|2042718_2043462_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	100.0	3.7e-151
WP_072147834.1|2043407_2044037_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	99.5	3.5e-110
WP_001413764.1|2044277_2045453_+	host specificity protein J	NA	Q9EYE6	Enterobacteria_phage	98.2	1.5e-231
WP_115801853.1|2045404_2047756_+	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	99.6	0.0e+00
WP_001230508.1|2047823_2048423_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_000268861.1|2048487_2049801_+|tail	phage tail protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.0	4.8e-77
WP_001023407.1|2049802_2050072_+|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
>prophage 5
NZ_CP017440	Escherichia coli O157:H7 strain 3384 chromosome, complete genome	5438591	2427061	2543222	5438591	holin,protease,head,tail,terminase,transposase,portal,capsid	Enterobacteria_phage(29.73%)	139	NA	NA
WP_001260835.1|2427061_2427883_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|2427982_2428066_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743952.1|2428158_2428494_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091829.1|2428890_2430144_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019530.1|2430250_2431144_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225276.1|2431278_2432499_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919231.1|2432623_2433319_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_071525082.1|2433271_2434564_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148710.1|2434721_2435336_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526515.1|2435378_2436233_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|2436234_2436852_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_001414236.1|2436862_2439286_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.3e-208
WP_000041704.1|2439346_2441773_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	1.1e-212
WP_000778147.1|2441971_2442277_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001303515.1|2442384_2443095_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|2443097_2443658_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705189.1|2443692_2444034_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001302046.1|2444168_2444495_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000005552.1|2445483_2445735_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_000048458.1|2445807_2448279_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.1	3.2e-58
WP_001090200.1|2448371_2448563_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|2448559_2448748_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001171930.1|2449316_2449535_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240334.1|2449606_2449906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303511.1|2450258_2450537_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001302048.1|2450538_2450730_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001169686.1|2450750_2451122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000172738.1|2451219_2451522_+	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	8.6e-06
WP_000693943.1|2451518_2451944_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000095669.1|2451966_2452929_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	57.3	4.8e-82
WP_000788938.1|2452935_2453676_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	90.2	4.6e-125
WP_001118159.1|2454486_2454882_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	7.8e-31
WP_000206793.1|2454938_2455523_+	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	84.8	1.9e-33
WP_001278450.1|2455638_2455743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000887477.1|2455931_2456144_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_012779366.1|2456311_2456590_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265161.1|2456591_2457641_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.7	1.4e-108
WP_001217455.1|2457653_2458013_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	5.9e-38
WP_001059381.1|2458009_2458699_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
WP_001303509.1|2459337_2459766_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	97.8	4.4e-64
WP_070081082.1|2460244_2462095_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.2	0.0e+00
WP_024180155.1|2462534_2462750_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.3e-32
WP_000731259.1|2462754_2463099_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000992137.1|2463149_2463683_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_001056806.1|2463953_2464523_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|2464522_2464669_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|2464896_2465082_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000095736.1|2465506_2465734_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_000279786.1|2465775_2466141_+	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
WP_000958416.1|2466430_2466994_+|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_001301491.1|2466990_2468652_+|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000173030.1|2468715_2470653_+|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001063094.1|2470697_2470919_+	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	98.6	1.3e-35
WP_001304108.1|2470864_2473444_+|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	97.3	0.0e+00
WP_000125988.1|2473446_2473773_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001007905.1|2473782_2474133_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573391.1|2474129_2474576_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133388.1|2474572_2474917_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275434.1|2474982_2475699_+	immunoglobulin domain-containing protein	NA	A0A0P0ZDV1	Stx2-converting_phage	100.0	1.6e-127
WP_000710952.1|2475713_2476088_+|tail	phage tail assembly chaperone	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001453746.1|2476183_2476393_+	DUF4035 domain-containing protein	NA	A0A0P0ZED8	Stx2-converting_phage	100.0	2.6e-33
WP_000212822.1|2476440_2479683_+|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	97.4	0.0e+00
WP_000807954.1|2479675_2480017_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001179481.1|2480016_2480715_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.0	1.1e-128
WP_000194720.1|2480725_2481469_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	97.6	5.0e-148
WP_050439450.1|2481414_2482047_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.1	3.9e-101
WP_001304109.1|2482388_2483564_+	host specificity protein J	NA	Q9EYE6	Enterobacteria_phage	96.9	1.2e-228
WP_001230508.1|2485930_2486530_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_000268860.1|2486594_2487818_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	B6DZB7	Enterobacteria_phage	94.8	8.7e-81
WP_001023362.1|2487819_2488089_+|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	6.4e-45
WP_001121225.1|2489488_2490139_+	type III secretion system effector NleG7	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_000998048.1|2490721_2492260_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|2492309_2492657_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|2492653_2493034_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_001120551.1|2493996_2494239_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_070081083.1|2494949_2496194_-	exonuclease	NA	H6WRX1	Salmonella_phage	50.3	1.4e-86
WP_000199475.1|2496286_2496475_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449175.1|2496471_2496660_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_001133037.1|2497224_2497434_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394548.1|2497434_2498073_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_000380316.1|2498084_2498237_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
WP_001416688.1|2498529_2498868_-	peptidase S24	NA	H9C160	Pectobacterium_phage	30.1	1.9e-06
WP_000747948.1|2499259_2499502_+	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_000693878.1|2499485_2499911_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262402.1|2499979_2501023_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	65.1	1.4e-82
WP_000139447.1|2501015_2501477_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.2	4.0e-79
WP_000450627.1|2501510_2502227_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.8	3.3e-72
WP_000603384.1|2502259_2502541_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
WP_000699809.1|2502537_2502765_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_001289673.1|2502757_2503069_+	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	92.2	7.2e-56
WP_000683609.1|2503196_2503415_+	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
WP_000104474.1|2503416_2503974_+	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_000935259.1|2504207_2504420_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000756596.1|2504539_2504884_+	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000191872.1|2505005_2505278_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
WP_001265229.1|2505279_2506329_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
WP_001217444.1|2506341_2506647_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	66.3	7.1e-32
WP_000640035.1|2506709_2507264_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	67.4	1.0e-65
WP_000917763.1|2507488_2507686_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	8.9e-28
WP_000301797.1|2507821_2508535_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001302123.1|2508985_2509417_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.5	1.6e-66
WP_000023184.1|2509894_2511745_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.9	0.0e+00
WP_024180155.1|2512183_2512399_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.3e-32
WP_000731259.1|2512403_2512748_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000992137.1|2512798_2513332_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_001056806.1|2513602_2514172_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539795.1|2514171_2514318_+	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	87.0	1.1e-11
WP_001208680.1|2514540_2514726_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001302717.1|2515251_2515566_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001303940.1|2515647_2515872_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
WP_000867493.1|2516258_2516804_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	82.8	4.7e-79
WP_001027223.1|2516778_2518704_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.1	0.0e+00
WP_000198153.1|2518700_2518907_+	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_070081084.1|2518903_2520505_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.5	6.7e-307
WP_000123254.1|2520485_2521805_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001295978.1|2521814_2522147_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000063265.1|2522202_2523228_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_000158906.1|2523269_2523668_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000753016.1|2523679_2524033_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	92.3	1.9e-57
WP_000975020.1|2524047_2524581_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	5.9e-58
WP_000683063.1|2524577_2524973_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	81.7	3.3e-58
WP_000235090.1|2524980_2525733_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000479046.1|2525746_2526169_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.4e-70
WP_000533440.1|2526195_2526609_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_000081804.1|2526589_2529202_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	95.9	0.0e+00
WP_000847298.1|2529198_2529528_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001151105.1|2529527_2530226_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_000194798.1|2530236_2530980_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	100.0	3.7e-151
WP_072147834.1|2530925_2531555_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	99.5	3.5e-110
WP_000514945.1|2531795_2535275_+	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	99.4	0.0e+00
WP_001230508.1|2535342_2535942_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_000268860.1|2536006_2537230_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	B6DZB7	Enterobacteria_phage	94.8	8.7e-81
WP_001023362.1|2537231_2537501_+|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	6.4e-45
WP_001131658.1|2537614_2538190_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.9	4.1e-89
WP_001356599.1|2538262_2538892_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	91.5	6.1e-78
WP_001143808.1|2538973_2539615_+	T3SS effector NleG family protein	NA	B6DZC0	Enterobacteria_phage	96.2	8.6e-104
WP_001120551.1|2539776_2540019_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_000527769.1|2541522_2542983_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.9e-42
WP_000214712.1|2543018_2543222_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
>prophage 6
NZ_CP017440	Escherichia coli O157:H7 strain 3384 chromosome, complete genome	5438591	2725379	2782487	5438591	integrase,holin,tail,head,tRNA,terminase,capsid	Escherichia_phage(36.51%)	69	2721837:2721852	2781648:2781663
2721837:2721852	attL	TCAGAAAAAAGCGCGC	NA	NA	NA	NA
WP_001295593.1|2725379_2725814_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
WP_001143784.1|2726394_2727036_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	100.0	6.8e-109
WP_001443810.1|2727117_2727747_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	92.2	1.3e-77
WP_001131659.1|2727819_2728395_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.4	5.3e-89
WP_001023992.1|2728507_2728777_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A0P0ZCV7	Stx2-converting_phage	95.5	4.2e-44
WP_000268955.1|2728778_2730092_-|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	99.1	9.7e-78
WP_001230550.1|2730156_2730756_-	Ail/Lom family outer membrane beta-barrel protein	NA	B6ETG5	Enterobacteria_phage	100.0	3.0e-111
WP_000515042.1|2730826_2734324_-	host specificity protein J	NA	A0A0P0ZEQ8	Stx2-converting_phage	94.3	0.0e+00
WP_000649829.1|2734457_2734985_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_064732755.1|2735175_2735808_-|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	90.4	3.4e-97
WP_000194763.1|2735753_2736497_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.2	5.4e-150
WP_001152159.1|2736507_2737206_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.4	1.3e-129
WP_000807964.1|2737205_2737547_-|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
WP_000212768.1|2737539_2740620_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	93.3	0.0e+00
WP_001453698.1|2740671_2740881_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030060.1|2740976_2741351_-|tail	phage tail assembly chaperone	tail	A0A0N7KZA2	Stx2-converting_phage	99.2	3.0e-64
WP_001275479.1|2741356_2742073_-	immunoglobulin domain-containing protein	NA	A0A0P0ZD29	Stx2-converting_phage	97.5	4.0e-126
WP_000133393.1|2742141_2742486_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	9.4e-57
WP_000573391.1|2742482_2742929_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007911.1|2742925_2743276_-|head	phage head closure protein	head	H6WZL5	Escherichia_phage	100.0	2.0e-59
WP_000125984.1|2743285_2743612_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001063094.1|2746138_2746360_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	98.6	1.3e-35
WP_000173030.1|2746404_2748342_-|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_070081086.1|2748405_2750067_-|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	99.8	0.0e+00
WP_000958416.1|2750063_2750627_-|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_000279786.1|2750916_2751282_-	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
WP_000095736.1|2751323_2751551_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_012816791.1|2751975_2752161_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|2752388_2752535_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|2752534_2753104_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992137.1|2753374_2753908_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_000731221.1|2753958_2754303_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	95.6	1.8e-55
WP_000284522.1|2754307_2754523_-|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	97.2	1.3e-32
WP_000143079.1|2754672_2756526_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.4	0.0e+00
WP_000466957.1|2757100_2757532_-	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	97.2	3.3e-67
WP_000640158.1|2758093_2758648_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	69.1	5.0e-68
WP_000247761.1|2758644_2758935_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	87.5	3.3e-47
WP_000940319.1|2758934_2759534_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	92.0	1.1e-105
WP_000138556.1|2760033_2761425_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_000016656.1|2761424_2762414_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001100703.1|2762381_2763533_-	DNA cytosine methyltransferase	NA	Q8JKX6	Natrialba_phage	36.9	1.0e-22
WP_000365100.1|2763964_2764210_-	hypothetical protein	NA	Q9G078	Enterobacteria_phage	70.7	5.9e-13
WP_000208018.1|2764288_2764450_-	hypothetical protein	NA	A0A192Y6F5	Salmonella_phage	89.4	3.2e-15
WP_000224233.1|2764460_2764724_-	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	8.8e-31
WP_000935420.1|2764975_2765188_-	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	94.3	5.8e-33
WP_001141110.1|2765293_2765716_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	88.5	3.1e-62
WP_000450712.1|2765731_2766493_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	90.5	7.0e-121
WP_000788980.1|2766515_2767262_-	ATP-binding protein	NA	V5UQI5	Shigella_phage	81.3	5.6e-115
WP_001304174.1|2767268_2768057_-	hypothetical protein	NA	G9L6A8	Escherichia_phage	64.3	2.0e-41
WP_000693803.1|2768134_2768557_-	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	92.9	1.3e-68
WP_001072342.1|2768553_2768808_-	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	61.6	1.3e-18
WP_000233319.1|2768887_2769307_+	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	46.5	5.5e-19
WP_001326317.1|2769549_2769729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001169151.1|2769739_2769895_+	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_001312793.1|2769891_2770380_-	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_000560223.1|2770821_2771043_+	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.0e-36
WP_001352098.1|2771042_2771213_+	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_001344816.1|2771287_2771563_+	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	95.6	4.0e-42
WP_070081087.1|2771664_2774265_+	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.4	3.0e-248
WP_000166313.1|2774257_2775067_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	4.0e-106
WP_001443846.1|2775122_2775272_+	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	95.9	2.5e-22
WP_001302840.1|2775309_2775498_+	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	98.4	5.5e-27
WP_000079604.1|2775597_2775813_+	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000040839.1|2775814_2777050_+|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	99.5	3.8e-241
WP_001157407.1|2777101_2778037_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000123746.1|2778165_2779539_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001625136.1|2779571_2779742_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000387388.1|2780016_2781000_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000628061.1|2781254_2782487_+	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
2781648:2781663	attR	GCGCGCTTTTTTCTGA	NA	NA	NA	NA
>prophage 7
NZ_CP017440	Escherichia coli O157:H7 strain 3384 chromosome, complete genome	5438591	2867433	2940973	5438591	integrase,holin,protease,tail,head,terminase,transposase,portal,capsid	Stx2-converting_phage(41.51%)	80	2882935:2882962	2941110:2941137
WP_000422055.1|2867433_2868483_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559268.1|2868702_2869461_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	6.7e-07
WP_001278878.1|2869457_2870048_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_001291216.1|2870087_2870960_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001302160.1|2871172_2872756_-	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001295575.1|2872783_2873404_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001285675.1|2873400_2874282_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001700591.1|2874419_2874464_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001194604.1|2874555_2876118_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_000763520.1|2876117_2877713_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.2	5.0e-52
WP_000983857.1|2877713_2879075_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.2	4.3e-36
WP_000209521.1|2879086_2880280_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000443092.1|2880279_2881086_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000807651.1|2881466_2881646_+	general stress protein	NA	NA	NA	NA	NA
WP_001056491.1|2881731_2882232_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079499.1|2882277_2882784_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
2882935:2882962	attL	GTGGTATCGATATCCATGTACCACACTG	NA	NA	NA	NA
WP_001144877.1|2886254_2886845_-	T3SS effector guanine nucleotide exchange factor EspM1	NA	NA	NA	NA	NA
WP_001303944.1|2887028_2887676_+	T3SS effector E3 ubiquitin-protein ligase NleG	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
WP_001414184.1|2887812_2887959_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303943.1|2888386_2888665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171554.1|2889004_2889385_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|2889381_2889729_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|2889778_2891317_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000938103.1|2892282_2892852_-	T3SS effector caspase inhibitor NleF	NA	NA	NA	NA	NA
WP_000950979.1|2892917_2893829_-	type III secretion system effector kinase NleH1-2	NA	A5LH48	Enterobacteria_phage	82.2	3.0e-134
WP_106409364.1|2893935_2894058_-|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	91.3	3.8e-05
WP_001025672.1|2895655_2896981_+	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	81.2	1.9e-214
WP_001023474.1|2898007_2898277_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1U9AJC2	Stx1_converting_phage	98.9	3.2e-44
WP_000216532.1|2898278_2899592_-|tail	phage tail protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.9	2.1e-80
WP_001228304.1|2899743_2900343_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	96.5	1.6e-107
WP_000514792.1|2900410_2903887_-	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.3	0.0e+00
WP_001152128.1|2904074_2904512_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	100.0	6.5e-63
WP_000807954.1|2904511_2904853_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_000212897.1|2904845_2907926_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	94.2	0.0e+00
WP_001453698.1|2907978_2908188_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030063.1|2908283_2908658_-|tail	phage tail assembly chaperone	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001275500.1|2908663_2909380_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	97.5	3.1e-126
WP_000133388.1|2909438_2909783_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573391.1|2909779_2910226_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007905.1|2910222_2910573_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125988.1|2910582_2910909_-|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001304108.1|2910911_2913491_-|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	97.3	0.0e+00
WP_001063025.1|2913436_2913658_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
WP_000173030.1|2913702_2915640_-|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001301491.1|2915703_2917365_-|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000958416.1|2917361_2917925_-|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_000279786.1|2918214_2918580_-	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
WP_000095736.1|2918621_2918849_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_012816791.1|2919273_2919459_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|2919686_2919833_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|2919832_2920402_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992137.1|2920672_2921206_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_000731259.1|2921256_2921601_-	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000284517.1|2921605_2921821_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000143067.1|2921970_2923824_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	97.9	0.0e+00
WP_000935548.1|2924620_2925679_-	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	94.3	1.1e-199
WP_000917750.1|2925829_2926027_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.0e-28
WP_000640048.1|2926268_2926799_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
WP_000904166.1|2926807_2927167_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.9	3.6e-35
WP_001302148.1|2927179_2928226_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.2	4.2e-108
WP_010917803.1|2928227_2928506_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_001217394.1|2928575_2928833_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000961820.1|2929053_2929266_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	70.0	1.4e-15
WP_001449026.1|2929544_2930303_-	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_001505071.1|2931001_2931166_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000774808.1|2931162_2931744_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	80.2	8.6e-79
WP_157825328.1|2931930_2932473_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.7	1.5e-85
WP_000020556.1|2932384_2933425_-	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	7.9e-91
WP_000705621.1|2933396_2933948_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000912298.1|2933931_2934159_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000787428.1|2934235_2934643_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_001240336.1|2934906_2935206_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171903.1|2935278_2935497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394552.1|2935519_2935927_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
WP_000920491.1|2935904_2936138_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449192.1|2936611_2936800_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001090200.1|2936796_2936988_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000048551.1|2937080_2939552_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.2	1.1e-58
WP_000113189.1|2939616_2939865_+	excisionase	NA	NA	NA	NA	NA
WP_000113674.1|2939842_2940973_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	51.4	3.4e-103
2941110:2941137	attR	GTGGTATCGATATCCATGTACCACACTG	NA	NA	NA	NA
>prophage 8
NZ_CP017440	Escherichia coli O157:H7 strain 3384 chromosome, complete genome	5438591	2987669	3159873	5438591	integrase,holin,head,tRNA,tail,protease,lysis,terminase,transposase,portal,capsid	Enterobacteria_phage(32.77%)	195	3020379:3020394	3166530:3166550
WP_001299679.1|2987669_2988926_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_001130692.1|2989139_2989763_+	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_001260332.1|2989762_2990614_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_001298109.1|2990764_2991712_+	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
WP_001033352.1|2991836_2993516_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.6	1.3e-23
WP_000823885.1|2993570_2993849_-	stress-induced protein YchH	NA	NA	NA	NA	NA
WP_000152933.1|2994126_2994711_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000505866.1|2994827_2995919_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_000733713.1|2998740_2999811_+	dihydroxyacetone kinase subunit DhaK	NA	NA	NA	NA	NA
WP_001302889.1|2999821_3000454_+	dihydroxyacetone kinase ADP-binding subunit DhaL	NA	NA	NA	NA	NA
WP_001302890.1|3000464_3001883_+	dihydroxyacetone kinase subunit DhaM	NA	NA	NA	NA	NA
WP_000060146.1|3004222_3005245_+	iron ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001223662.1|3005244_3006225_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_000173324.1|3006221_3006980_+	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.7	1.5e-14
WP_000576838.1|3007798_3008653_+	ModD protein	NA	NA	NA	NA	NA
WP_001302893.1|3008678_3010649_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_000511315.1|3010698_3010953_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_162829200.1|3011801_3013014_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	100.0	1.5e-170
WP_001295616.1|3013202_3013814_-	membrane-bound lytic murein transglycosylase EmtA	NA	NA	NA	NA	NA
WP_000051572.1|3013913_3014828_+	muramoyltetrapeptide carboxypeptidase	NA	NA	NA	NA	NA
WP_000340206.1|3014923_3016660_+	potassium/proton antiporter	NA	NA	NA	NA	NA
WP_000197859.1|3017051_3018122_-	catabolic alanine racemase DadX	NA	NA	NA	NA	NA
WP_001266908.1|3018131_3019430_-	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_000190855.1|3019792_3021325_+	SpoVR family protein	NA	NA	NA	NA	NA
3020379:3020394	attL	AAGAAGAGAAAGCCCG	NA	NA	NA	NA
WP_000234823.1|3021376_3022096_-	fatty acid metabolism transcriptional regulator FadR	NA	NA	NA	NA	NA
3020379:3020394	attL	AAGAAGAGAAAGCCCG	NA	NA	NA	NA
WP_000406391.1|3022317_3023859_+	Na(+)/H(+) antiporter NhaB	NA	NA	NA	NA	NA
WP_000943459.1|3024004_3024535_+	disulfide bond formation protein DsbB	NA	NA	NA	NA	NA
WP_000457644.1|3024580_3025849_-	DNA polymerase V catalytic protein	NA	I6RSM4	Salmonella_phage	83.2	3.0e-209
WP_000897378.1|3025848_3026268_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	62.1	6.9e-38
WP_001304191.1|3026640_3027552_+	hemolysin HlyE	NA	NA	NA	NA	NA
WP_000807626.1|3027758_3028220_-	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
WP_000284277.1|3028296_3028956_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_001295992.1|3029027_3029321_-	YcgL domain-containing protein	NA	NA	NA	NA	NA
WP_000874954.1|3029332_3029491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000695220.1|3029561_3029963_+	PPC domain-containing protein	NA	NA	NA	NA	NA
WP_001056834.1|3030065_3030434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000072536.1|3030953_3031649_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_000101055.1|3031672_3032485_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_001185665.1|3032488_3032755_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_162829202.1|3033920_3035134_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000361110.1|3035307_3035892_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001201843.1|3036390_3037344_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001226373.1|3037530_3039015_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000998048.1|3039317_3040856_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|3040905_3041253_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|3041249_3041630_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000937476.1|3041705_3041954_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	1.7e-12
WP_000239881.1|3042010_3042679_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000134810.1|3043176_3043359_+	general stress protein	NA	NA	NA	NA	NA
WP_001166090.1|3043437_3043938_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079482.1|3043974_3044481_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000488340.1|3044499_3045390_+	manganese catalase family protein	NA	NA	NA	NA	NA
WP_000885629.1|3045509_3046091_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.2	2.3e-100
WP_000268883.1|3046090_3049006_-|tail	phage tail protein	tail	A0A0P0ZE15	Stx2-converting_phage	98.3	1.5e-57
WP_001230340.1|3049070_3049670_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	99.0	8.8e-111
WP_000515612.1|3049736_3053135_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.7	0.0e+00
WP_000090920.1|3053195_3053828_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	1.7e-96
WP_000194779.1|3053764_3054508_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_001152612.1|3054513_3055212_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
WP_000847331.1|3055211_3055541_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	100.0	2.5e-59
WP_000840323.1|3055537_3058087_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	87.3	0.0e+00
WP_000459457.1|3058079_3058514_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479161.1|3058495_3058918_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	2.4e-70
WP_001143002.1|3058933_3059674_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.9	8.3e-127
WP_000683105.1|3059681_3060077_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_000975100.1|3060073_3060652_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
WP_000753014.1|3060663_3061017_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	98.3	2.9e-61
WP_000158906.1|3061028_3061427_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000063265.1|3061468_3062494_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_001295978.1|3062549_3062882_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000123254.1|3062891_3064211_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001301524.1|3064191_3065793_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000198153.1|3065789_3065996_-	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001027365.1|3065992_3067918_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.2	0.0e+00
WP_000453564.1|3067892_3068438_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	97.8	2.6e-93
WP_001300120.1|3068826_3069021_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	98.4	1.5e-27
WP_001031427.1|3069185_3069392_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_000079504.1|3069677_3070088_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	2.7e-71
WP_000738495.1|3070379_3070673_+	serum resistance lipoprotein Bor	NA	K7PL54	Enterobacteria_phage	99.0	1.5e-47
WP_010917798.1|3070763_3070946_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	93.3	4.7e-15
WP_001180487.1|3071162_3071639_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	95.6	4.3e-84
WP_000544528.1|3071625_3071931_-|holin	phage holin family protein	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_001097228.1|3072252_3072942_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.9	1.7e-57
WP_000971093.1|3072938_3073079_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	71.1	7.7e-10
WP_001099695.1|3073075_3073438_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	7.3e-60
WP_000774504.1|3073434_3073725_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_000224907.1|3073717_3073888_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_001053040.1|3073887_3074343_-	recombination protein NinB	NA	I6PD71	Cronobacter_phage	64.9	8.6e-58
WP_000709077.1|3074844_3076371_-	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	31.1	1.2e-31
WP_001302833.1|3076428_3076551_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001070446.1|3076615_3076948_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_000145915.1|3077015_3077318_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_000788869.1|3077314_3078016_-	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	99.6	1.3e-129
WP_000088655.1|3078940_3079177_+	excisionase	NA	NA	NA	NA	NA
WP_000741454.1|3079166_3080309_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	100.0	8.1e-206
WP_000444477.1|3080422_3081673_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_001248690.1|3081844_3082498_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000476093.1|3082507_3082969_+	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001301861.1|3083022_3084129_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001301618.1|3084164_3084806_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000423729.1|3084809_3086180_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
3086098:3086113	attR	AAGAAGAGAAAGCCCG	NA	NA	NA	NA
WP_001265474.1|3086348_3087020_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
3086098:3086113	attR	AAGAAGAGAAAGCCCG	NA	NA	NA	NA
WP_000735407.1|3087019_3088480_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_000133425.1|3089336_3089618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000127900.1|3089631_3091293_-|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	81.4	9.8e-277
WP_000113645.1|3091276_3091633_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	81.4	9.4e-52
WP_000174068.1|3091756_3091939_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001145903.1|3091922_3092363_-	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	71.9	1.2e-61
WP_000134113.1|3092362_3092659_-|head,tail	phage head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	65.3	4.0e-32
WP_001020660.1|3092655_3092994_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	52.7	1.9e-30
WP_000267612.1|3092990_3094202_-|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	79.2	1.2e-188
WP_000504050.1|3094203_3094776_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	63.5	1.2e-61
WP_001137345.1|3094815_3095973_-|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	64.9	2.8e-137
WP_001132080.1|3096265_3096490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000233299.1|3096614_3096887_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000126692.1|3096897_3097308_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000198852.1|3097304_3097556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000761781.1|3097926_3100059_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	52.6	5.8e-173
WP_000770148.1|3100055_3100355_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000794515.1|3100360_3100603_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000659212.1|3100592_3100784_-	hypothetical protein	NA	A0A1W6JPD9	Morganella_phage	50.0	1.7e-07
WP_000920682.1|3100783_3100969_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001453500.1|3100961_3101159_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_001304194.1|3101184_3101928_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000953272.1|3101985_3102174_-	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	66.0	2.0e-13
WP_000085257.1|3102538_3103768_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	55.9	6.4e-132
WP_001301987.1|3104016_3105138_+	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_000359446.1|3105186_3106413_-	peptidase T	NA	NA	NA	NA	NA
WP_000531594.1|3106662_3107799_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000799385.1|3107782_3108646_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000938118.1|3109009_3110371_+	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	29.2	1.4e-50
WP_001303921.1|3110431_3110707_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301984.1|3113015_3116417_-	type III secretion system effector EspN	NA	A0A0N7KZG3	Stx2-converting_phage	39.2	1.7e-219
WP_001301673.1|3117007_3119356_-	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_115801847.1|3119375_3119465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071526731.1|3119477_3119714_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	80.3	2.8e-20
WP_000967271.1|3119659_3120397_-|tail	phage tail protein	tail	B6ETG2	Enterobacteria_phage	100.0	8.2e-151
WP_000835336.1|3120450_3121329_-	phage repressor protein/antirepressor Ant	NA	I6R977	Salmonella_phage	77.2	2.5e-93
WP_010904626.1|3121631_3121742_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_000170104.1|3121851_3122106_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_070081090.1|3122122_3122821_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	99.1	1.6e-132
WP_000807954.1|3122820_3123162_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_000212899.1|3123154_3126397_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	97.9	0.0e+00
WP_001453698.1|3126449_3126659_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030063.1|3126754_3127129_-|tail	phage tail assembly chaperone	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001275507.1|3127134_3127851_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	98.3	2.8e-127
WP_000133388.1|3127909_3128254_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573374.1|3128250_3128697_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007901.1|3128693_3129044_-|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000126019.1|3129053_3129380_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_000267292.1|3129459_3131961_-|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	99.2	0.0e+00
WP_001063099.1|3131906_3132128_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000173030.1|3132172_3134110_-|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001301491.1|3134173_3135835_-|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000958416.1|3135831_3136395_-|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_000279786.1|3136684_3137050_-	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
WP_001302295.1|3137091_3137277_+	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	88.5	1.4e-19
WP_000347013.1|3137406_3137547_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000735655.1|3137903_3138128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001208682.1|3138192_3138399_-	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_000539792.1|3138626_3138773_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|3138772_3139342_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992148.1|3139612_3140146_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
WP_000731241.1|3140196_3140541_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000284518.1|3140545_3140761_-|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
WP_001289717.1|3140836_3141106_-	DUF826 domain-containing protein	NA	A0A2R2Z348	Escherichia_phage	75.3	8.2e-08
WP_001213059.1|3141143_3141326_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	67.8	1.0e-14
WP_000023170.1|3141473_3143411_-	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	76.8	2.5e-292
WP_000762929.1|3144489_3145311_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.6	1.3e-83
WP_001217410.1|3145307_3145682_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	2.1e-33
WP_001265168.1|3145694_3146744_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.4	1.2e-107
WP_001341388.1|3146745_3147024_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000887477.1|3147191_3147404_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_001278450.1|3147592_3147697_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000207955.1|3147812_3148400_-	DUF551 domain-containing protein	NA	K7PH57	Enterobacteria_phage	45.8	7.5e-38
WP_001014296.1|3148402_3148594_-	hypothetical protein	NA	G9L660	Escherichia_phage	98.4	1.6e-26
WP_000515959.1|3148595_3149033_-	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	94.0	1.9e-38
WP_000156547.1|3149019_3149337_-	hypothetical protein	NA	A0A088CQ13	Enterobacteria_phage	90.0	4.4e-45
WP_001017965.1|3149290_3149608_-	DUF4752 family protein	NA	A0A1I9LJV1	Stx_converting_phage	92.4	2.1e-42
WP_001310212.1|3149597_3149900_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	87.9	1.9e-45
WP_072140318.1|3149896_3150178_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.1	1.4e-29
WP_000451012.1|3150210_3150927_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.4	2.1e-71
WP_072143019.1|3150960_3151503_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	92.2	2.3e-81
WP_001262323.1|3151414_3152452_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	79.5	3.3e-89
WP_000693915.1|3152520_3152946_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000711018.1|3152929_3153253_-	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	6.2e-10
WP_000948454.1|3153377_3153854_+	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
WP_001414141.1|3154169_3154322_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
WP_000559928.1|3154436_3154952_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077699040.1|3155084_3155474_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	60.0	1.3e-38
WP_000003742.1|3155535_3155805_+	excisionase	NA	NA	NA	NA	NA
WP_000074985.1|3155773_3156892_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z04	Phage_21	43.9	1.0e-83
WP_000580316.1|3157058_3157853_+	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
WP_000759316.1|3157849_3158896_+	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
WP_000952736.1|3159051_3159873_-	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
3166530:3166550	attR	AAAGCGCCGCTGGATGCGCTG	NA	NA	NA	NA
>prophage 9
NZ_CP017440	Escherichia coli O157:H7 strain 3384 chromosome, complete genome	5438591	3387348	3538432	5438591	integrase,holin,tail,protease,head,terminase,bacteriocin,transposase,portal,capsid	Escherichia_phage(46.27%)	178	3484979:3484994	3540197:3540212
WP_001028088.1|3387348_3387843_+	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	99.0	7.6e-52
WP_001301708.1|3387863_3389192_+	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	100.0	1.8e-236
WP_001273654.1|3389274_3389382_-	hypothetical protein	NA	Q9KX95	Enterobacteria_phage	100.0	3.4e-10
WP_000203825.1|3390340_3390970_+	anti-repressor protein	NA	A0A0N6WET9	Escherichia_phage	100.0	2.6e-113
WP_000763353.1|3391017_3391239_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C094	Escherichia_phage	100.0	1.3e-35
WP_001024844.1|3391235_3391520_+	DUF4752 family protein	NA	A0A1I9LJV1	Stx_converting_phage	100.0	3.2e-47
WP_001120841.1|3391997_3392405_+	DUF551 domain-containing protein	NA	A0A1I9LJU9	Stx_converting_phage	99.3	7.1e-80
WP_000426668.1|3392404_3392800_+	hypothetical protein	NA	A0A1I9LJU8	Stx_converting_phage	100.0	4.7e-68
WP_000935259.1|3393033_3393246_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000756595.1|3393365_3393710_+	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	100.0	4.6e-56
WP_000331690.1|3394260_3402642_-	hypothetical protein	NA	A0A0N7C080	Escherichia_phage	100.0	0.0e+00
WP_000012450.1|3402711_3403977_-	hypothetical protein	NA	A0A1I9LJU3	Stx_converting_phage	100.0	1.4e-206
WP_000540391.1|3403987_3404239_-|bacteriocin	bacteriocin	bacteriocin	A0A2R2Z351	Escherichia_phage	100.0	7.9e-13
WP_000455644.1|3404248_3404695_-	hypothetical protein	NA	A0A1I9LJU1	Stx_converting_phage	100.0	1.4e-76
WP_000509481.1|3404697_3405354_-	hypothetical protein	NA	A0A2R2Z361	Escherichia_phage	100.0	2.4e-109
WP_000035558.1|3405447_3405849_-	hypothetical protein	NA	A0A2R2Z359	Escherichia_phage	100.0	3.7e-73
WP_000078907.1|3405905_3406046_-	Hok/Gef family protein	NA	A0A2R2X2B4	Escherichia_phage	100.0	3.1e-19
WP_000835360.1|3406278_3407013_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A2R2Z365	Escherichia_phage	100.0	1.3e-135
WP_001301884.1|3407103_3407721_-	hypothetical protein	NA	A0A2R2Z362	Escherichia_phage	100.0	1.1e-121
WP_000455634.1|3407726_3408005_-	outer membrane protein	NA	A0A2R2Z367	Escherichia_phage	100.0	1.1e-50
WP_000197192.1|3408019_3409288_-	host specificity protein J	NA	A0A2R2Z364	Escherichia_phage	100.0	4.9e-220
WP_001146326.1|3409284_3410910_-	hypothetical protein	NA	A0A1I9LJT3	Stx_converting_phage	100.0	0.0e+00
WP_001303606.1|3411204_3411393_-	hypothetical protein	NA	A0A2R2Z344	Escherichia_phage	100.0	6.9e-30
WP_001024006.1|3411532_3411802_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1I9LJT0	Stx_converting_phage	100.0	2.2e-45
WP_000117994.1|3411803_3413741_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1I9LJS9	Stx_converting_phage	100.0	1.1e-64
WP_000207924.1|3413737_3414388_-	hypothetical protein	NA	A0A1I9LJS8	Stx_converting_phage	100.0	2.7e-121
WP_000829200.1|3414387_3414951_-	hypothetical protein	NA	A0A2R2Z349	Escherichia_phage	100.0	3.2e-102
WP_001290743.1|3414934_3415396_-	hypothetical protein	NA	A0A2R2Z354	Escherichia_phage	100.0	7.8e-75
WP_001140442.1|3415445_3415835_-	hypothetical protein	NA	A0A2R2Z353	Escherichia_phage	100.0	9.9e-63
WP_000214474.1|3415890_3417105_-|capsid	N4-gp56 family major capsid protein	capsid	A0A2R2Z358	Escherichia_phage	100.0	1.3e-233
WP_000345010.1|3417128_3418136_-	hypothetical protein	NA	A0A2R2Z355	Escherichia_phage	100.0	2.3e-180
WP_000787519.1|3418293_3420438_-|portal	portal protein	portal	A0A2R2Z346	Escherichia_phage	100.0	0.0e+00
WP_000143988.1|3420437_3422144_-|terminase	terminase	terminase	A0A2R2Z350	Escherichia_phage	100.0	0.0e+00
WP_001086069.1|3422124_3422931_-|terminase	terminase	terminase	A0A2R2Z334	Escherichia_phage	100.0	7.6e-134
WP_001301714.1|3422986_3423190_-	hypothetical protein	NA	A0A2R2Z338	Escherichia_phage	100.0	7.7e-35
WP_000738505.1|3423339_3423633_+	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	100.0	6.8e-48
WP_015971382.1|3423723_3423909_-	Rz1 protein precursor	NA	A0A0P0ZBL2	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|3424136_3424283_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|3424282_3424852_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000087728.1|3425122_3425656_-	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	100.0	1.8e-102
WP_000284506.1|3425660_3425876_-|holin	class II holin family protein	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_001290212.1|3425952_3426225_-	DUF826 domain-containing protein	NA	A0A1I9LJR2	Stx_converting_phage	100.0	1.2e-22
WP_000143458.1|3426265_3426445_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_162829202.1|3426906_3428119_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000738068.1|3430317_3430587_-	Shiga toxin Stx2a subunit B	NA	A0A2R2Z326	Escherichia_phage	100.0	1.2e-43
WP_000649753.1|3430598_3431558_-	Shiga toxin Stx2c subunit A	NA	Q776Q3	Enterobacteria_phage	100.0	5.6e-176
WP_001204880.1|3432341_3432776_-	antitermination protein	NA	G9L695	Escherichia_phage	100.0	2.8e-82
WP_000144764.1|3432768_3432963_-	phage NinH family protein	NA	G9L694	Escherichia_phage	100.0	1.9e-30
WP_001107955.1|3432959_3433565_-	recombination protein NinG	NA	A0A1I9LJQ2	Stx_converting_phage	100.0	2.3e-98
WP_001004024.1|3433564_3434287_-	phage antirepressor KilAC domain-containing protein	NA	A0A0N7C231	Escherichia_phage	100.0	7.8e-130
WP_000211422.1|3434361_3435096_-	phage antirepressor Ant	NA	A0A0N7C203	Escherichia_phage	100.0	1.9e-123
WP_001254256.1|3435370_3435553_-	NinE family protein	NA	A0A0N7C1X3	Escherichia_phage	100.0	5.7e-29
WP_000153280.1|3435549_3436077_-	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	100.0	9.5e-101
WP_000814576.1|3436073_3436520_-	recombination protein NinB	NA	A0A0N7C2V1	Escherichia_phage	100.0	2.4e-81
WP_001281772.1|3436476_3436713_-	restriction alleviation protein, Lar family	NA	Q8HA09	Enterobacteria_phage	100.0	1.2e-39
WP_000103679.1|3436723_3436939_-	hypothetical protein	NA	A0A1I9LJP7	Stx_converting_phage	100.0	1.3e-32
WP_001000127.1|3437071_3437350_-	hypothetical protein	NA	Q9ZWY1	Enterobacteria_phage	100.0	3.4e-49
WP_001036032.1|3437420_3437690_-	hypothetical protein	NA	A0A0N7C059	Escherichia_phage	100.0	8.4e-45
WP_000131484.1|3437689_3439126_-	AAA family ATPase	NA	A0A0N7C224	Escherichia_phage	100.0	6.1e-275
WP_000065666.1|3439115_3440015_-	hypothetical protein	NA	A0A0N7C1Z7	Escherichia_phage	100.0	1.2e-164
WP_000166207.1|3440007_3440154_-	DUF2740 family protein	NA	Q687G5	Enterobacteria_phage	100.0	1.1e-19
WP_000438540.1|3440186_3440483_-	hypothetical protein	NA	A0A0N7BZS9	Escherichia_phage	100.0	6.8e-48
WP_000067727.1|3440624_3440840_-	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_001302016.1|3440915_3441611_+	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	100.0	8.6e-134
WP_001130059.1|3442112_3442634_+	hypothetical protein	NA	A0A0N7BTU4	Escherichia_phage	100.0	1.8e-88
WP_000438343.1|3443201_3443384_+	hypothetical protein	NA	A0A0N7C057	Escherichia_phage	100.0	2.8e-28
WP_000088203.1|3443361_3443634_+	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	100.0	5.7e-41
WP_000394299.1|3443692_3443944_+	hypothetical protein	NA	A4KWV4	Enterobacteria_phage	100.0	5.6e-43
WP_000065362.1|3444126_3444495_+	DUF2528 family protein	NA	A0A0N7C1W2	Escherichia_phage	100.0	2.0e-65
WP_001198861.1|3444567_3444732_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000372937.1|3444700_3444844_+	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
WP_000995486.1|3444918_3445215_+	host-nuclease inhibitor protein Gam	NA	A0A0N7BTR9	Escherichia_phage	100.0	3.3e-50
WP_001302855.1|3445220_3446006_+	phage recombination protein Bet	NA	A0A0N7BTT9	Escherichia_phage	100.0	6.3e-149
WP_000186812.1|3446002_3446683_+	YqaJ viral recombinase family protein	NA	A0A0N6WET1	Escherichia_phage	100.0	1.6e-132
WP_000682306.1|3446679_3446862_+	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	100.0	4.3e-29
WP_000548534.1|3446834_3447026_+	DUF1382 family protein	NA	A0A0N7C481	Escherichia_phage	100.0	4.3e-27
WP_000188870.1|3447102_3447318_+	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	100.0	1.0e-32
WP_000774248.1|3447416_3447638_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	100.0	3.8e-35
WP_001289936.1|3447634_3448408_+	ead/Ea22-like family protein	NA	A0A0N7C1Y5	Escherichia_phage	100.0	1.7e-143
WP_000797281.1|3448559_3448748_+	hypothetical protein	NA	A0A1I9LJM4	Stx_converting_phage	100.0	2.8e-31
WP_000951705.1|3448749_3448965_+	hypothetical protein	NA	A0A1I9LJM3	Stx_converting_phage	100.0	3.0e-37
WP_001142590.1|3448966_3449185_+	DUF4014 family protein	NA	A0A1I9LJM2	Stx_converting_phage	100.0	3.5e-33
WP_000212746.1|3449186_3449474_+	hypothetical protein	NA	A0A1I9LJM1	Stx_converting_phage	100.0	9.2e-50
WP_001303965.1|3450449_3450749_+	hypothetical protein	NA	G9L655	Escherichia_phage	100.0	2.4e-53
WP_001208773.1|3450834_3451119_+	excisionase family protein	NA	G9L654	Escherichia_phage	100.0	9.1e-50
WP_000013654.1|3451171_3452482_+	DUF3596 domain-containing protein	NA	A0A1I9LJL6	Stx_converting_phage	100.0	3.2e-254
WP_000607020.1|3452478_3453057_+	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_001143120.1|3453077_3453305_+	YccJ family protein	NA	NA	NA	NA	NA
WP_001044286.1|3453342_3454584_-	bifunctional glucose-1-phosphatase/inositol phosphatase	NA	NA	NA	NA	NA
WP_000420639.1|3456391_3457312_+	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	2.5e-11
WP_000024560.1|3457311_3457617_+	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_000209883.1|3457770_3458370_-	molecular chaperone TorD	NA	NA	NA	NA	NA
WP_001063176.1|3458366_3460913_-	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	30.7	1.7e-70
WP_001230236.1|3460912_3462085_-	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
WP_001120119.1|3462214_3462907_+	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	4.5e-18
WP_001264927.1|3462879_3463908_-	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
WP_001054754.1|3463990_3466735_+	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	31.9	9.2e-38
WP_000818441.1|3466806_3467880_+	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_050554528.1|3467928_3468063_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001303885.1|3468090_3468321_-	protein YmcE	NA	NA	NA	NA	NA
WP_071524879.1|3468295_3468484_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066490.1|3468494_3468707_-	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
WP_000087763.1|3468992_3469205_+	cold shock-like protein CspH	NA	NA	NA	NA	NA
WP_001299283.1|3469646_3469952_+	threonine-rich inner membrane protein GfcA	NA	NA	NA	NA	NA
WP_001301846.1|3470058_3470703_+	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_001038071.1|3470699_3471446_+	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_000742329.1|3471445_3473542_+	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_001295357.1|3473587_3474727_+	polysaccharide export protein	NA	NA	NA	NA	NA
WP_000057871.1|3474714_3475161_+	protein-tyrosine-phosphatase Etp	NA	NA	NA	NA	NA
WP_000208668.1|3475180_3477361_+	tyrosine-protein kinase	NA	NA	NA	NA	NA
WP_001301957.1|3477480_3478785_-	bifunctional acid phosphatase/4-phytase	NA	NA	NA	NA	NA
WP_000270305.1|3478864_3478957_-	cytochrome bd-II oxidase subunit CbdX	NA	NA	NA	NA	NA
WP_000460778.1|3478969_3480106_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_000263572.1|3480117_3481662_-	cytochrome bd-II oxidase subunit 1	NA	NA	NA	NA	NA
WP_000004940.1|3481795_3482653_-	hydrogenase expression/formation protein	NA	NA	NA	NA	NA
WP_000063969.1|3482649_3483048_-	hydrogenase-1 operon protein HyaE	NA	NA	NA	NA	NA
WP_000003653.1|3483044_3483632_-|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_001186424.1|3483628_3484336_-	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000107391.1|3484354_3486148_-	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
3484979:3484994	attL	ATTCAGCTGCTGAATG	NA	NA	NA	NA
WP_001301613.1|3486144_3487263_-	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_001023352.1|3489536_3489806_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A0P0ZEF0	Stx2-converting_phage	100.0	3.4e-46
WP_000268862.1|3489807_3491121_-|tail	phage tail protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.5	2.0e-78
WP_001230444.1|3491185_3491785_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	99.0	8.8e-111
WP_000515108.1|3491852_3495326_-	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	96.5	0.0e+00
WP_000649830.1|3495459_3495987_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	59.9	2.0e-58
WP_050546863.1|3496177_3496810_-|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.5	5.8e-105
WP_000194760.1|3496755_3497499_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.6	2.4e-150
WP_001151078.1|3497509_3498208_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	98.3	2.9e-129
WP_000847304.1|3498207_3498537_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
WP_010904726.1|3498533_3499298_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	94.9	2.4e-129
WP_101975986.1|3499249_3501112_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	83.5	1.4e-268
WP_000533402.1|3501092_3501506_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479117.1|3501532_3501964_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_029208397.1|3501977_3502718_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_001301534.1|3502699_3502966_-|capsid	major capsid protein	capsid	NA	NA	NA	NA
WP_000256723.1|3503023_3503371_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001254002.1|3503407_3504913_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000831796.1|3504902_3506495_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
WP_000259002.1|3506491_3506698_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_001302857.1|3506681_3508610_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.9	3.3e-260
WP_000998048.1|3508873_3510412_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|3510461_3510809_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|3510805_3511186_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_070081091.1|3511261_3511537_-	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	51.5	2.4e-10
WP_000411791.1|3512287_3512494_+|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	97.1	4.5e-30
WP_000138558.1|3512749_3513022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001003118.1|3513181_3513715_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
WP_000675931.1|3513935_3514049_+	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_012816791.1|3514270_3514456_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001303878.1|3514983_3515298_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000874392.1|3516654_3518505_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.1	0.0e+00
WP_000261909.1|3519272_3519986_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000265265.1|3520606_3521425_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000090264.1|3521576_3521948_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	83.2	4.0e-53
WP_001217436.1|3521937_3522309_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_001265172.1|3522321_3523371_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.2e-110
WP_001341388.1|3523372_3523651_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000813263.1|3523818_3523974_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	94.1	1.9e-17
WP_000160654.1|3524578_3525352_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001151233.1|3525703_3526117_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.1	9.8e-61
WP_000450992.1|3526132_3526903_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	6.1e-80
WP_000788751.1|3526924_3527671_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	84.2	6.2e-114
WP_001205823.1|3527677_3528769_-	hypothetical protein	NA	V5URT9	Shigella_phage	70.0	5.1e-133
WP_000273724.1|3528847_3529303_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000693855.1|3529509_3529935_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000887453.1|3529918_3530191_-	helix-turn-helix domain-containing protein	NA	A0A0U2S629	Escherichia_phage	45.8	1.1e-12
WP_000986592.1|3530299_3530701_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	54.5	7.4e-13
WP_000536233.1|3530728_3530920_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303876.1|3530919_3531207_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000379575.1|3531484_3531640_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_000394511.1|3531781_3532171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001133046.1|3532357_3532543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000413705.1|3533116_3533305_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001098307.1|3533301_3533493_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000034474.1|3533586_3536058_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_000273151.1|3536125_3536368_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_001299351.1|3536345_3537365_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.3e-85
WP_000375128.1|3537772_3538432_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	1.8e-48
3540197:3540212	attR	ATTCAGCTGCTGAATG	NA	NA	NA	NA
>prophage 10
NZ_CP017440	Escherichia coli O157:H7 strain 3384 chromosome, complete genome	5438591	3769369	3807466	5438591	integrase,holin,protease,tail,lysis,terminase,portal	Enterobacteria_phage(51.16%)	50	3768954:3768968	3807540:3807554
3768954:3768968	attL	TTAGTATAAAAAAGC	NA	NA	NA	NA
WP_001247925.1|3769369_3770068_-|protease	T3SS effector zinc metalloprotease NleD	protease	NA	NA	NA	NA
WP_000951026.1|3770298_3771180_-	type III secretion system effector kinase NleH1-1	NA	A5LH48	Enterobacteria_phage	90.1	8.6e-147
WP_072127173.1|3771349_3771511_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	72.5	3.9e-13
WP_115801843.1|3772007_3773027_-|protease	type III secretion system effector zinc metalloprotease NleC	protease	NA	NA	NA	NA
WP_000950813.1|3773060_3774041_-	type III secretion system effector arginine glycosyltransferase NleB2	NA	Q8HAB2	Salmonella_phage	49.5	2.9e-87
WP_001024022.1|3774217_3774487_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1I9LJT0	Stx_converting_phage	98.9	4.9e-45
WP_000741879.1|3774488_3775805_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q6H9S9	Enterobacteria_phage	95.6	2.0e-67
WP_001233141.1|3775864_3776464_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	92.5	1.8e-103
WP_000515426.1|3776534_3779948_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.1	0.0e+00
WP_000090841.1|3780008_3780617_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.1	2.4e-100
WP_000194779.1|3780553_3781297_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_001152360.1|3781302_3782001_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	3.9e-134
WP_000447253.1|3782010_3782340_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_000371994.1|3782339_3785405_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.9	0.0e+00
WP_001161009.1|3785376_3785706_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_001300035.1|3785714_3786101_-|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
WP_000211123.1|3786161_3786905_-|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	98.0	9.5e-131
WP_001079422.1|3786915_3787317_-|tail	tail protein	tail	A5LH34	Enterobacteria_phage	98.5	2.0e-71
WP_000677094.1|3787313_3787892_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.0	6.1e-101
WP_001283153.1|3787903_3788179_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_001097050.1|3788171_3788495_-	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001136597.1|3788581_3790609_-|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.4	0.0e+00
WP_127446149.1|3790553_3790889_-|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.1	9.1e-57
WP_010904538.1|3791010_3792135_-|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.4	5.4e-194
WP_001072975.1|3792062_3792275_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000934137.1|3792271_3794374_-|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	96.7	0.0e+00
WP_000349509.1|3794373_3794865_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	87.2	1.3e-72
WP_001139679.1|3795539_3795692_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	8.9e-20
WP_000092302.1|3795679_3796147_-|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	97.4	9.4e-76
WP_000075107.1|3796143_3796641_-	lysozyme RrrD	NA	A0A1B5FP97	Escherichia_phage	98.2	7.1e-90
WP_000284524.1|3796640_3796856_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_012578864.1|3796998_3797397_+	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000499454.1|3797477_3797636_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001302581.1|3797721_3798465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097238.1|3798648_3799338_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_032160865.1|3799352_3799475_-	YlcG family protein	NA	NA	NA	NA	NA
WP_000750155.1|3799812_3800772_+	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_001028854.1|3800983_3801649_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001108055.1|3801645_3802266_-	recombination protein NinG	NA	Q716C3	Shigella_phage	96.1	1.6e-94
WP_000567001.1|3802258_3802429_-	protein ninF	NA	Q716C4	Shigella_phage	96.4	7.9e-25
WP_001254218.1|3802425_3802608_-	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	96.7	4.8e-28
WP_000186844.1|3803305_3803986_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	3.5e-132
WP_000682316.1|3803982_3804165_+	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	95.0	4.1e-27
WP_000548536.1|3804137_3804329_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	96.8	1.1e-25
WP_000188862.1|3804405_3804621_+	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	98.6	2.9e-32
WP_000763363.1|3804719_3804941_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	98.6	6.4e-35
WP_000120056.1|3805151_3805754_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000545728.1|3805996_3806164_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	1.3e-27
WP_001303849.1|3806203_3806422_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_089625990.1|3806527_3807466_+|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	99.7	2.0e-173
3807540:3807554	attR	TTAGTATAAAAAAGC	NA	NA	NA	NA
>prophage 11
NZ_CP017440	Escherichia coli O157:H7 strain 3384 chromosome, complete genome	5438591	4350591	4402197	5438591	integrase,tail,transposase	Enterobacteria_phage(34.78%)	56	4343748:4343764	4399643:4399659
4343748:4343764	attL	CGGCGATTTTTTCCAGC	NA	NA	NA	NA
WP_000998048.1|4350591_4352130_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|4352179_4352527_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|4352523_4352904_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000803998.1|4353167_4353431_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000866436.1|4353430_4353571_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_001147284.1|4353640_4353832_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000389022.1|4354656_4355199_+	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_000730972.1|4355273_4355861_+	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_000716386.1|4355918_4356587_+	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_001131063.1|4356612_4359138_+	fimbrial usher EcpC	NA	NA	NA	NA	NA
WP_001265657.1|4359127_4360771_+	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_001301550.1|4360739_4361450_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_001303809.1|4361762_4362092_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001019920.1|4362339_4362954_-	YagU family protein	NA	NA	NA	NA	NA
WP_000070685.1|4363371_4364061_+	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_000643341.1|4364057_4365014_+	aldehyde oxidoreductase FAD-binding subunit PaoB	NA	NA	NA	NA	NA
WP_000667043.1|4365010_4367209_+	aldehyde oxidoreductase molybdenum-binding subunit PaoC	NA	A0A0P0I429	Acinetobacter_phage	25.7	1.5e-38
WP_000121321.1|4367218_4368175_+	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_000171064.1|4368353_4369481_-	MFS transporter	NA	NA	NA	NA	NA
WP_001303808.1|4369622_4370681_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_010917758.1|4370926_4371829_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001301751.1|4372531_4372810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000361969.1|4372976_4373699_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000687183.1|4373797_4374697_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000205213.1|4375372_4376329_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000016225.1|4376461_4378795_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	72.5	0.0e+00
WP_000562750.1|4378808_4379132_-	DUF5375 family protein	NA	NA	NA	NA	NA
WP_001071227.1|4379131_4379353_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000973389.1|4379349_4379907_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	64.9	9.3e-30
WP_001244581.1|4379903_4380164_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	65.1	1.3e-23
WP_000154958.1|4381097_4381850_+	septation initiation protein	NA	NA	NA	NA	NA
WP_000968317.1|4381846_4382398_+	Polarity suppression protein	NA	NA	NA	NA	NA
WP_001185340.1|4382403_4382676_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000350115.1|4383085_4383652_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000647284.1|4383651_4384242_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000999326.1|4384272_4384905_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000251694.1|4384897_4385356_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303996.1|4385355_4385973_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000082144.1|4385945_4386362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001130487.1|4386365_4387547_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	61.3	2.4e-144
WP_000246059.1|4388509_4389253_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000355475.1|4390076_4390850_+	hypothetical protein	NA	A0A289ZIY5	Serratia_phage	44.7	5.0e-50
WP_000904979.1|4390907_4391462_-	site-specific DNA recombinase	NA	A0A0F7LA37	Escherichia_phage	88.4	2.8e-87
WP_001115553.1|4391491_4391902_+|tail	tail fiber protein	tail	A0A0F7LBW5	Escherichia_phage	97.6	2.2e-65
WP_000344820.1|4391922_4392366_+|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	97.3	7.0e-81
WP_000805544.1|4392337_4392931_-|tail	tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	61.7	5.2e-55
WP_001096963.1|4392930_4393725_-|tail	tail fiber protein	tail	K7PH60	Enterobacterial_phage	92.9	2.8e-80
WP_000788819.1|4393724_4394036_-	hypothetical protein	NA	A0A0M5M1K4	Salmonella_phage	73.2	9.7e-29
WP_000251069.1|4394987_4395281_-	lambda phage CII family protein	NA	A2SY75	Escherichia_phage	100.0	3.7e-46
WP_000437875.1|4395399_4395600_-	hypothetical protein	NA	A4KWT7	Enterobacteria_phage	100.0	4.3e-30
WP_001274756.1|4395700_4396414_+	LexA family transcriptional regulator	NA	A4KWV9	Enterobacteria_phage	99.2	3.5e-130
WP_000708838.1|4396541_4396931_+	hypothetical protein	NA	A0A0R6PGY5	Moraxella_phage	36.3	1.7e-06
WP_001303805.1|4397170_4397416_+	transcription antitermination protein	NA	J3JZZ6	Escherichia_phage	90.5	1.0e-12
WP_000893282.1|4398485_4399739_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	3.4e-96
4399643:4399659	attR	CGGCGATTTTTTCCAGC	NA	NA	NA	NA
WP_001285288.1|4399750_4400854_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749881.1|4401141_4402197_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
>prophage 12
NZ_CP017440	Escherichia coli O157:H7 strain 3384 chromosome, complete genome	5438591	4420983	4443688	5438591	plate,transposase	uncultured_Caudovirales_phage(50.0%)	17	NA	NA
WP_000027427.1|4420983_4422156_-|transposase	ISAs1-like element ISEc26 family transposase	transposase	NA	NA	NA	NA
WP_120795385.1|4422236_4422422_+	protein YncO	NA	NA	NA	NA	NA
WP_000247943.1|4422336_4422600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000420837.1|4424564_4425701_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_001451375.1|4426446_4426998_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_000509132.1|4427066_4431281_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	45.6	2.0e-23
WP_000103107.1|4431356_4433498_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	7.0e-25
WP_001142958.1|4433707_4434226_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000037399.1|4434922_4435423_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000123970.1|4435457_4435682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000056994.1|4435732_4437124_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000599596.1|4437214_4437628_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000393844.1|4437631_4439482_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000348794.1|4439445_4440528_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_001113707.1|4440552_4441833_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_001080153.1|4441829_4442354_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000246434.1|4442356_4443688_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 1
NZ_CP017441	Escherichia coli O157:H7 strain 3384 plasmid pO157, complete sequence	92729	49392	58184	92729	transposase,integrase	Macacine_betaherpesvirus(66.67%)	6	45962:45975	52550:52563
45962:45975	attL	TACAGTTCAAAAAG	NA	NA	NA	NA
WP_000016989.1|49392_50199_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	99.1	3.7e-56
WP_162829202.1|50921_52135_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_071525396.1|52096_52435_+	RepB family plasmid replication initiator protein	NA	I3WF20	Macacine_betaherpesvirus	100.0	1.6e-40
WP_000772446.1|53022_54189_+	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	100.0	7.0e-229
52550:52563	attR	CTTTTTGAACTGTA	NA	NA	NA	NA
WP_000817031.1|54188_55160_+	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	100.0	4.8e-175
WP_000138832.1|56459_58184_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	53.0	8.3e-170
