The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP016043	Edwardsiella hoshinae strain ATCC 35051 chromosome, complete genome	3811650	1736556	1748108	3811650	holin,transposase	Enterobacteria_phage(23.08%)	16	NA	NA
WP_167352271.1|1736556_1737189_-	helix-turn-helix domain-containing protein	NA	A8CGC0	Salmonella_phage	55.3	3.7e-59
WP_070245634.1|1737285_1737471_+	hypothetical protein	NA	A5VW97	Enterobacteria_phage	55.7	1.4e-11
WP_070244874.1|1737647_1738097_+	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	57.0	4.4e-38
WP_156774564.1|1738127_1738292_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083275005.1|1738291_1738465_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_070244875.1|1738461_1739565_+	replication protein O	NA	A0A1C9IHW0	Salmonella_phage	72.9	9.4e-58
WP_070244876.1|1739561_1740296_+	DNA replication protein	NA	A0A1P8DTF3	Proteus_phage	39.5	3.9e-36
WP_070244877.1|1740285_1740561_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_083275066.1|1740983_1741880_+	transcriptional regulator	NA	A0A1U9GXD3	Vibrio_phage	42.4	1.4e-32
WP_083275006.1|1741809_1742289_+	DUF968 domain-containing protein	NA	K7PJS6	Enterobacterial_phage	52.9	2.2e-32
WP_070244878.1|1742567_1743122_+	hypothetical protein	NA	K7PKJ4	Enterobacteria_phage	65.0	2.0e-61
WP_167352257.1|1743299_1743470_+	hypothetical protein	NA	K7PJQ2	Enterobacteria_phage	68.4	5.5e-10
WP_070244879.1|1743591_1743930_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	47.7	1.6e-24
WP_070244880.1|1743932_1744484_+	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	71.3	9.7e-72
WP_070244881.1|1745013_1745556_+	DUF2514 family protein	NA	A0A291AXG6	Shigella_phage	36.0	3.8e-12
WP_156774565.1|1746957_1748108_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	37.1	1.5e-45
>prophage 2
NZ_CP016043	Edwardsiella hoshinae strain ATCC 35051 chromosome, complete genome	3811650	1940538	1949855	3811650	tRNA	Brazilian_cedratvirus(16.67%)	11	NA	NA
WP_024523388.1|1940538_1941303_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	27.5	2.9e-05
WP_070245635.1|1941295_1942321_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_024523386.1|1942307_1942511_-	protein DsrB	NA	NA	NA	NA	NA
WP_005285818.1|1942600_1942897_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	41.1	2.4e-13
WP_024523385.1|1942901_1945289_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	25.8	9.5e-07
WP_024523384.1|1945303_1946287_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	42.6	6.4e-34
WP_106120997.1|1946474_1946519_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_024523383.1|1946687_1947044_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_005293643.1|1947086_1947284_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_070244941.1|1947380_1947923_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	34.8	5.7e-16
WP_024523381.1|1947926_1949855_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.4	3.3e-127
>prophage 3
NZ_CP016043	Edwardsiella hoshinae strain ATCC 35051 chromosome, complete genome	3811650	3205796	3249648	3811650	terminase,head,capsid,tail,lysis,holin,plate,portal,integrase,tRNA	Erwinia_phage(27.5%)	48	3212016:3212074	3245815:3245873
WP_070245282.1|3205796_3206822_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.4	1.3e-106
WP_005295814.1|3207035_3207251_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_024523602.1|3207439_3209188_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	36.4	3.9e-74
WP_024523601.1|3209423_3211265_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
WP_024523600.1|3211355_3211850_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
3212016:3212074	attL	ACTCATAATCGCTTGGTCGTTGGTTCAAACCCAACAGGGGCCACCAAATTTTAGCTTTA	NA	NA	NA	NA
WP_005281637.1|3212202_3212421_-	DNA-binding transcriptional regulator	NA	A0A2I8TV89	Erwinia_phage	69.4	4.6e-25
WP_070245283.1|3212495_3213650_-	phage late control D family protein	NA	A0A218M4J7	Erwinia_phage	70.7	5.6e-146
WP_070245284.1|3213649_3214132_-|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	62.3	5.3e-50
WP_070245285.1|3214143_3216588_-|tail	phage tail tape measure protein	tail	U5N0T4	Enterobacteria_phage	66.6	6.1e-267
WP_070245286.1|3216580_3216721_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	80.0	4.0e-14
WP_005295823.1|3216750_3217044_-|tail	phage tail assembly protein	tail	Q37846	Escherichia_phage	67.9	9.8e-23
WP_070245287.1|3217104_3217623_-|tail	phage major tail tube protein	tail	S4TNZ0	Salmonella_phage	83.1	9.1e-80
WP_070245288.1|3217635_3218823_-|tail	phage tail sheath protein	tail	S4TRX2	Salmonella_phage	83.5	1.3e-190
WP_083275038.1|3219073_3219424_-	hypothetical protein	NA	A0A0M4S6V4	Salmonella_phage	37.9	3.0e-18
WP_070245290.1|3221069_3221681_-|tail	phage tail protein I	tail	A0A218M4J3	Erwinia_phage	78.1	2.3e-90
WP_070245291.1|3221673_3222582_-|plate	baseplate assembly protein	plate	A0A218M4K5	Erwinia_phage	79.8	2.6e-130
WP_047059219.1|3222586_3222937_-|plate	baseplate assembly protein	plate	A0A0M4RE59	Salmonella_phage	63.8	7.8e-35
WP_070245292.1|3222933_3223575_-|plate	phage baseplate assembly protein V	plate	Q6K1H6	Salmonella_virus	71.8	4.9e-83
WP_070245293.1|3223644_3224094_-	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	57.8	7.2e-41
WP_070245294.1|3224086_3224548_-|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	63.9	6.7e-50
WP_070245295.1|3224628_3225081_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A218M4K2	Erwinia_phage	41.2	9.5e-17
WP_070245296.1|3225077_3225575_-	glycoside hydrolase family 104 protein	NA	S4TUB1	Salmonella_phage	77.6	3.5e-73
WP_005281588.1|3225561_3225870_-|holin	holin	holin	O80308	Escherichia_phage	73.5	2.1e-31
WP_024523586.1|3225873_3226077_-|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	70.1	5.2e-23
WP_005281582.1|3226073_3226577_-|head	head completion/stabilization protein	head	A0A0F7LDJ1	Escherichia_phage	60.4	3.2e-53
WP_024523584.1|3226670_3227432_-|terminase	terminase	terminase	Q6K1I5	Salmonella_virus	60.2	5.3e-68
WP_070245297.1|3227435_3228539_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M4R4W2	Salmonella_phage	68.8	3.1e-138
WP_070245298.1|3228604_3229447_-|capsid	GPO family capsid scaffolding protein	capsid	A0A218M4L9	Erwinia_phage	64.9	1.7e-96
WP_070245299.1|3229608_3231375_+|terminase	terminase ATPase subunit family protein	terminase	A0A0M4RE51	Salmonella_phage	86.6	6.5e-303
WP_070245300.1|3231374_3232409_+|portal	phage portal protein	portal	Q6K1J0	Salmonella_virus	79.6	1.7e-162
WP_070245301.1|3232804_3234229_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_064169842.1|3234225_3235218_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020316745.1|3235168_3236320_-	DNA cytosine methyltransferase	NA	M1PSQ0	Streptococcus_phage	29.3	6.6e-30
WP_070245302.1|3236706_3236919_-	Tum protein	NA	A0A218M4I0	Erwinia_phage	77.0	4.0e-18
WP_167352273.1|3237033_3239079_-	replication endonuclease	NA	Q6K1F3	Salmonella_virus	73.7	8.3e-294
WP_070245673.1|3239249_3240254_-	phosphoadenosine phosphosulfate reductase family protein	NA	B7SYG0	Stenotrophomonas_phage	43.7	1.1e-68
WP_070245304.1|3240270_3240492_-	TraR/DksA family transcriptional regulator	NA	A0A0M4S5Q7	Salmonella_phage	54.8	5.1e-16
WP_070245305.1|3240491_3240719_-	DUF2732 family protein	NA	NA	NA	NA	NA
WP_070245306.1|3240785_3241127_-	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	55.8	7.2e-25
WP_083275039.1|3241090_3241291_-	DUF2724 domain-containing protein	NA	Q6K1F7	Salmonella_virus	69.7	1.5e-19
WP_070245307.1|3241292_3241799_-	phage regulatory CII family protein	NA	A0A0M4QWN1	Salmonella_phage	67.5	1.0e-59
WP_070245308.1|3241829_3242093_-	hypothetical protein	NA	A0A218M4I5	Erwinia_phage	98.9	6.9e-44
WP_070245309.1|3242222_3242801_+	phage repressor protein CI	NA	A0A218M4J1	Erwinia_phage	58.1	2.8e-61
WP_167352265.1|3242830_3243373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070245311.1|3243382_3244387_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	96.7	1.2e-189
WP_083275040.1|3244408_3245653_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070245674.1|3246311_3247211_+	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
3245815:3245873	attR	ACTCATAATCGCTTGGTCGTTGGTTCAAACCCAACAGGGGCCACCAAATTTTAGCTTTA	NA	NA	NA	NA
WP_024523565.1|3247215_3249648_+	formate C-acetyltransferase/glycerol dehydratase family glycyl radical enzyme	NA	A0A2H4YEI2	Aeromonas_phage	41.9	1.7e-06
