The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP049978	Bacillus sp. RZ2MS9 chromosome, complete genome	5357194	258508	266457	5357194		uncultured_virus(33.33%)	6	NA	NA
WP_000917311.1|258508_258793_+	co-chaperone GroES	NA	A0A221S3C8	uncultured_virus	54.8	1.2e-20
WP_001029993.1|258831_260466_+	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	58.0	1.5e-157
WP_162841983.1|260869_262411_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	31.7	8.9e-22
WP_000833096.1|262797_264123_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	29.4	4.1e-44
WP_000929880.1|264266_264968_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.0	9.5e-40
WP_000719210.1|264951_266457_+	aminopeptidase AmpS	NA	W8CYF6	Bacillus_phage	30.0	7.8e-31
>prophage 2
NZ_CP049978	Bacillus sp. RZ2MS9 chromosome, complete genome	5357194	311044	319420	5357194		Synechococcus_phage(50.0%)	8	NA	NA
WP_000625682.1|311044_312352_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	25.3	4.9e-21
WP_070757983.1|312440_313160_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	G8EYA2	Synechococcus_phage	44.3	1.0e-49
WP_000278823.1|313152_313407_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_000666787.1|313403_314087_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_000055562.1|314070_316290_+	phosphoribosylformylglycinamidine synthase II	NA	A6N228	Microbacterium_phage	41.2	2.6e-163
WP_000879025.1|316274_317690_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	35.4	3.3e-55
WP_001262439.1|317795_318836_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	45.9	1.2e-67
WP_000088589.1|318832_319420_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	37.4	9.1e-28
>prophage 3
NZ_CP049978	Bacillus sp. RZ2MS9 chromosome, complete genome	5357194	1267682	1323330	5357194	bacteriocin,integrase,portal,capsid,terminase,coat	Acinetobacter_phage(27.27%)	57	1307598:1307618	1323406:1323426
WP_001277719.1|1267682_1268150_-|coat	spore coat protein CotY	coat	NA	NA	NA	NA
WP_000191204.1|1268292_1270359_-	ATP-dependent helicase	NA	A0A068EQC7	Bacillus_phage	31.5	2.9e-76
WP_000543307.1|1270459_1270882_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000765863.1|1270883_1271402_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000084013.1|1271495_1272227_-	esterase family protein	NA	NA	NA	NA	NA
WP_070757201.1|1272430_1273342_+	DMT family transporter	NA	NA	NA	NA	NA
WP_070757200.1|1273418_1273991_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_000140099.1|1273983_1274652_-	DUF4386 domain-containing protein	NA	NA	NA	NA	NA
WP_000878734.1|1274853_1275252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000107211.1|1275407_1276886_-	sodium/proline symporter PutP	NA	NA	NA	NA	NA
WP_070757199.1|1277916_1279335_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_000636321.1|1279331_1279919_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	48.4	1.2e-48
WP_001067361.1|1279915_1280941_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	34.8	4.6e-51
WP_000536698.1|1280942_1281704_+	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	40.6	5.3e-36
WP_000865118.1|1281700_1282315_+	N-(5'phosphoribosyl)anthranilate isomerase	NA	NA	NA	NA	NA
WP_001105015.1|1282311_1283505_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_048568776.1|1283508_1284285_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000946131.1|1284358_1284718_+	DUF4029 domain-containing protein	NA	NA	NA	NA	NA
WP_044584232.1|1284832_1286332_+	lactate permease	NA	NA	NA	NA	NA
WP_001128613.1|1286422_1287106_+	YukJ family protein	NA	NA	NA	NA	NA
WP_000424530.1|1287120_1287954_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000650090.1|1288150_1288936_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_001099940.1|1288955_1290191_+	YARHG domain-containing protein	NA	NA	NA	NA	NA
WP_048568778.1|1290237_1290660_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070757198.1|1290860_1292195_+	CoA-disulfide reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.7	2.6e-17
WP_000996781.1|1292355_1292766_+	DUF3908 family protein	NA	NA	NA	NA	NA
WP_070757197.1|1292796_1294338_-	SagB/ThcOx family dehydrogenase	NA	NA	NA	NA	NA
WP_070757196.1|1294353_1296303_-	TOMM precursor leader peptide-binding protein	NA	NA	NA	NA	NA
WP_048568782.1|1296299_1298219_-|bacteriocin	putative thiazole-containing bacteriocin maturation protein	bacteriocin	NA	NA	NA	NA
WP_000569926.1|1298343_1299603_-	2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase	NA	NA	NA	NA	NA
WP_070757195.1|1299736_1302604_-	2-oxoglutarate dehydrogenase E1 component	NA	NA	NA	NA	NA
WP_000428506.1|1303428_1303638_+	helix-turn-helix transcriptional regulator	NA	S5M643	Brevibacillus_phage	41.1	1.3e-05
WP_001109895.1|1303640_1304018_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001178294.1|1304046_1304229_+	DUF3976 domain-containing protein	NA	NA	NA	NA	NA
WP_070757194.1|1304361_1304721_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083320159.1|1304843_1305764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070757193.1|1305946_1306999_+	hypothetical protein	NA	NA	NA	NA	NA
1307598:1307618	attL	CGACCTCCACCCTGTCAAGGT	NA	NA	NA	NA
WP_070757192.1|1307810_1309109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070757191.1|1309285_1310014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168369335.1|1310292_1310469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070757190.1|1310490_1310697_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070757189.1|1311338_1311542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070757188.1|1311725_1311974_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168369336.1|1312045_1312216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070757375.1|1312355_1312595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070757186.1|1312738_1314064_-	hypothetical protein	NA	A0A1P8CWT6	Bacillus_phage	36.9	5.2e-63
WP_139147410.1|1314697_1315024_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070757184.1|1315020_1315368_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070757183.1|1315415_1315760_+	hypothetical protein	NA	A0A0S2MXX9	Enterococcus_phage	38.8	2.2e-13
WP_070757182.1|1315899_1316340_+|terminase	phage terminase small subunit P27 family	terminase	NA	NA	NA	NA
WP_070757181.1|1316336_1316621_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070757180.1|1316797_1317034_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070757179.1|1317311_1318604_+|portal	phage portal protein	portal	A0A060AFC9	Staphylococcus_phage	33.8	1.2e-64
WP_070757374.1|1318665_1320324_+|capsid	phage major capsid protein	capsid	A0A1G5SCB8	Enterococcus_phage	35.2	4.2e-54
WP_070757178.1|1320682_1321177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070757177.1|1321315_1322071_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070757176.1|1322175_1323330_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4S6G4	Salmonella_phage	20.9	5.6e-05
1323406:1323426	attR	CGACCTCCACCCTGTCAAGGT	NA	NA	NA	NA
>prophage 4
NZ_CP049978	Bacillus sp. RZ2MS9 chromosome, complete genome	5357194	1910548	1918709	5357194		Bacillus_phage(83.33%)	7	NA	NA
WP_070757548.1|1910548_1911838_+	C40 family peptidase	NA	A0A217EQL1	Bacillus_phage	38.7	1.9e-09
WP_001194306.1|1911937_1912702_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000453861.1|1912942_1914703_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	98.0	2.4e-273
WP_048568907.1|1914789_1915467_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	98.7	3.3e-122
WP_001231621.1|1915463_1916537_+	HAMP domain-containing sensor histidine kinase	NA	W8CYF6	Bacillus_phage	98.0	6.1e-187
WP_000818985.1|1916826_1917546_+	3-ketoacyl-ACP reductase	NA	W8CYX9	Bacillus_phage	100.0	5.9e-61
WP_070757546.1|1917836_1918709_+	aminoglycoside 6-adenylyltransferase	NA	A0A1X9I6F2	Streptococcus_phage	44.7	2.8e-65
>prophage 5
NZ_CP049978	Bacillus sp. RZ2MS9 chromosome, complete genome	5357194	2568048	2574697	5357194		Bacillus_phage(42.86%)	10	NA	NA
WP_001139345.1|2568048_2568264_-	spore germination protein	NA	A0A2H4J3A3	uncultured_Caudovirales_phage	83.8	3.4e-25
WP_000369348.1|2568500_2568632_+	DUF3983 domain-containing protein	NA	A0A1B1P7V8	Bacillus_phage	79.1	2.9e-11
WP_000097509.1|2568996_2569797_+	C1 family peptidase	NA	A0A2K9L1Z4	Tupanvirus	37.2	1.0e-37
WP_002061468.1|2569816_2570029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002061469.1|2570093_2570294_+	N-acetylmuramoyl-L-alanine amidase	NA	D2XR33	Bacillus_phage	90.9	1.0e-15
WP_070757805.1|2570431_2571313_-	serine/threonine protein kinase	NA	NA	NA	NA	NA
WP_000372690.1|2571440_2571950_+	GrpB family protein	NA	A0A2K5B2B6	Erysipelothrix_phage	36.0	1.4e-16
WP_000411452.1|2572067_2572598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001163828.1|2572610_2573285_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	30.7	2.8e-28
WP_058839783.1|2573281_2574697_+	HAMP domain-containing sensor histidine kinase	NA	A0A1V0SKH0	Klosneuvirus	23.1	8.2e-06
>prophage 6
NZ_CP049978	Bacillus sp. RZ2MS9 chromosome, complete genome	5357194	3615153	3625709	5357194	bacteriocin	uncultured_Caudovirales_phage(45.45%)	15	NA	NA
WP_000413738.1|3615153_3615774_+	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	62.2	8.2e-19
WP_000976240.1|3615866_3616670_-	DUF4097 family beta strand repeat protein	NA	NA	NA	NA	NA
WP_048567461.1|3616670_3617213_-	DUF1700 domain-containing protein	NA	NA	NA	NA	NA
WP_001102627.1|3617205_3617529_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_030027264.1|3617901_3618132_-|bacteriocin	bacteriocin biosynthesis protein	bacteriocin	A0A1B1P7Q9	Bacillus_phage	80.3	1.1e-26
WP_030027266.1|3618305_3619301_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A218KCJ1	Bacillus_phage	47.5	1.5e-78
WP_030027267.1|3619369_3620191_-	M23 family metallopeptidase	NA	A0A2H4J669	uncultured_Caudovirales_phage	33.9	7.8e-09
WP_030027273.1|3620438_3621407_-	lysozyme family protein	NA	A0A1W6JSC2	Bacillus_phage	45.5	1.5e-30
WP_000464424.1|3621645_3622032_-	DUF1492 domain-containing protein	NA	A0A288WG73	Bacillus_phage	70.6	2.2e-46
WP_000900735.1|3622006_3622171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069605450.1|3622440_3623313_-	DnaD domain protein	NA	A0A2H4J394	uncultured_Caudovirales_phage	60.5	8.1e-97
WP_001189064.1|3623465_3623660_-	hypothetical protein	NA	A0A2H4J4V8	uncultured_Caudovirales_phage	71.0	5.9e-16
WP_069605451.1|3623671_3624430_-	antirepressor	NA	A0A2H4JBC7	uncultured_Caudovirales_phage	69.4	4.6e-96
WP_048567457.1|3624632_3624845_-	hypothetical protein	NA	A6M975	Geobacillus_virus	63.0	2.1e-11
WP_033683142.1|3625049_3625709_+	helix-turn-helix domain-containing protein	NA	A0A2H4J441	uncultured_Caudovirales_phage	41.0	8.7e-35
>prophage 7
NZ_CP049978	Bacillus sp. RZ2MS9 chromosome, complete genome	5357194	4443070	4450755	5357194		Staphylococcus_phage(16.67%)	10	NA	NA
WP_048568486.1|4443070_4443994_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	43.5	2.0e-45
WP_070756976.1|4444119_4445055_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	24.5	1.0e-20
WP_000018029.1|4445056_4445749_-	response regulator transcription factor	NA	B5LWA6	Feldmannia_species_virus	28.8	1.4e-06
WP_001293578.1|4445917_4446091_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001014310.1|4446091_4446286_+	YwbE family protein	NA	NA	NA	NA	NA
WP_001255971.1|4446324_4447524_-	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	41.2	1.6e-71
WP_000587818.1|4447818_4448142_+	heme oxygenase	NA	NA	NA	NA	NA
WP_070756977.1|4448214_4448979_-	class B sortase	NA	NA	NA	NA	NA
WP_070756978.1|4449011_4449782_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	28.6	9.9e-14
WP_001036847.1|4449771_4450755_-	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	27.2	2.5e-17
