The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP017403	Bordetella pertussis strain 509 chromosome, complete genome	4140370	27282	70038	4140370	tRNA,transposase	Synechococcus_phage(50.0%)	43	NA	NA
WP_010929577.1|27282_28233_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_023995007.1|28314_28650_-	CoA transferase	NA	NA	NA	NA	NA
WP_010929578.1|28674_29109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019247164.1|29141_30359_-	thiolase family protein	NA	NA	NA	NA	NA
WP_010929580.1|30364_30862_-	MaoC family dehydratase	NA	NA	NA	NA	NA
WP_019247165.1|31069_32005_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010929582.1|32214_33006_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_010929583.1|33048_34470_+	MmgE/PrpD family protein	NA	NA	NA	NA	NA
WP_005012067.1|34625_35576_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814398.1|35572_36763_-	MFS transporter	NA	NA	NA	NA	NA
WP_010929585.1|37012_37924_+|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_010929586.1|37925_40064_+|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_003814404.1|40060_40600_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_003814405.1|40603_41332_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_010929587.1|41318_42212_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_003814410.1|42282_42678_+	lactoylglutathione lyase	NA	NA	NA	NA	NA
WP_050833520.1|42687_43218_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	35.4	2.9e-12
WP_023997043.1|43346_43646_-	DUF1974 domain-containing protein	NA	NA	NA	NA	NA
WP_010930208.1|43663_44614_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929589.1|45200_45749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003815265.1|45720_45957_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003815255.1|46084_46978_+	membrane protein	NA	NA	NA	NA	NA
WP_010929590.1|48147_49395_+	homoserine O-acetyltransferase	NA	NA	NA	NA	NA
WP_003817748.1|49391_50006_+	methionine biosynthesis protein MetW	NA	NA	NA	NA	NA
WP_005012067.1|50141_51092_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_029443813.1|51134_52391_+	muropeptide transporter	NA	NA	NA	NA	NA
WP_014906036.1|52502_53567_+	porin	NA	NA	NA	NA	NA
WP_010929592.1|53624_54359_-	aspartate/glutamate racemase family protein	NA	NA	NA	NA	NA
WP_019247224.1|54364_54955_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.6	3.2e-20
WP_003817737.1|54979_55669_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_023852650.1|55665_56427_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_010929594.1|56506_57406_-	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005012808.1|57499_58450_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929595.1|59250_60477_-	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_047122776.1|60476_60890_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010929597.1|61079_62021_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019248755.1|62444_63419_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010929599.1|63475_64057_-	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_010929600.1|64069_64372_-	Rieske 2Fe-2S domain-containing protein	NA	NA	NA	NA	NA
WP_029443770.1|64490_65549_-	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	NA	NA	NA	NA
WP_019247832.1|65583_66855_-	TRAP transporter large permease	NA	NA	NA	NA	NA
WP_010929603.1|67484_68666_-	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005012808.1|69087_70038_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP017403	Bordetella pertussis strain 509 chromosome, complete genome	4140370	185342	243846	4140370	tRNA,transposase	Planktothrix_phage(22.22%)	54	NA	NA
WP_014486111.1|185342_186293_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929608.1|186289_188164_-	polysaccharide biosynthesis protein	NA	A0A2P1ELS8	Moumouvirus	26.9	2.0e-23
WP_003807102.1|189511_190216_-	DUF2837 family protein	NA	NA	NA	NA	NA
WP_003807104.1|190212_191319_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_010929610.1|191580_192174_-	sugar transferase	NA	NA	NA	NA	NA
WP_023853419.1|192170_193358_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	NA	NA	NA	NA
WP_010929612.1|193420_194680_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_010929613.1|194703_195792_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A0N9R0B2	Chrysochromulina_ericina_virus	36.3	4.8e-46
WP_010929614.1|195799_196900_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A2K9L0G1	Tupanvirus	29.7	3.3e-31
WP_003807114.1|196903_197479_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_003807115.1|197482_198535_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_010929615.1|198665_199673_+	lipopolysaccharide heptosyltransferase I	NA	NA	NA	NA	NA
WP_010929616.1|199674_200961_+	3-deoxy-D-manno-octulosonic acid transferase	NA	NA	NA	NA	NA
WP_003807124.1|200977_201133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010929617.1|201157_201961_-	type III pantothenate kinase	NA	NA	NA	NA	NA
WP_010929618.1|201957_202824_-	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_010929619.1|202898_204029_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003807131.1|204028_204868_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	32.4	9.1e-21
WP_010930208.1|204981_205932_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929620.1|206849_207452_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010929621.1|207481_208135_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003807138.1|208267_209524_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	40.5	6.2e-66
WP_023853421.1|209604_210471_+	D-amino acid aminotransferase	NA	NA	NA	NA	NA
WP_003818417.1|210546_210822_+	YbeD family protein	NA	NA	NA	NA	NA
WP_010929623.1|210829_211492_+	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_003807146.1|211553_212555_+	lipoyl synthase	NA	NA	NA	NA	NA
WP_003807148.1|212569_213118_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	53.4	3.7e-47
WP_010929624.1|213175_214072_-	dTDP-4-dehydrorhamnose reductase	NA	NA	NA	NA	NA
WP_010929625.1|214068_215130_-	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	44.8	1.6e-78
WP_010929626.1|215165_216116_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929627.1|217015_218209_+	cystathionine beta-lyase	NA	NA	NA	NA	NA
WP_010929628.1|218290_218920_-	thiol:disulfide interchange protein DsbA/DsbL	NA	NA	NA	NA	NA
WP_010927242.1|218981_219665_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_023853376.1|219674_221357_-|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003815933.1|221644_221992_+	DUF1840 domain-containing protein	NA	NA	NA	NA	NA
WP_003815930.1|222082_222400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010930525.1|222682_223699_+|transposase	IS110-like element IS1663 family transposase	transposase	NA	NA	NA	NA
WP_003815929.1|223774_224575_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_003815927.1|224571_225447_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_019248181.1|225457_226750_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010929634.1|226792_227833_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.7	6.0e-22
WP_010929635.1|227938_228760_-	phosphodiesterase	NA	NA	NA	NA	NA
WP_005012067.1|228860_229811_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_014905488.1|229909_230815_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.7	9.8e-21
WP_003815918.1|230811_231645_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_010929637.1|232481_233492_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_019247800.1|233488_233878_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_033446324.1|234759_236025_+	amidase	NA	NA	NA	NA	NA
WP_010929639.1|236115_237816_-	2-isopropylmalate synthase	NA	NA	NA	NA	NA
WP_010929640.1|238242_238890_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050457416.1|238888_240328_+	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_023853394.1|240438_240723_+	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_010929512.1|240750_241629_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005012067.1|242895_243846_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP017403	Bordetella pertussis strain 509 chromosome, complete genome	4140370	272629	334157	4140370	tRNA,transposase	Diachasmimorpha_longicaudata_entomopoxvirus(10.0%)	50	NA	NA
WP_010930892.1|272629_273580_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929659.1|275023_275926_-	YgcG family protein	NA	NA	NA	NA	NA
WP_003815889.1|275903_276533_-	LemA family protein	NA	NA	NA	NA	NA
WP_010929660.1|276815_278246_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	29.8	5.8e-44
WP_010929661.1|278279_278909_+	LysE family transporter	NA	NA	NA	NA	NA
WP_003815895.1|278957_280565_+	peptide chain release factor 3	NA	A0A2K9L6L3	Tupanvirus	37.8	9.3e-14
WP_010929663.1|280589_281273_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003815898.1|281354_281831_-	bacterioferritin	NA	NA	NA	NA	NA
WP_005012067.1|282037_282988_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929664.1|284103_284631_+	META domain-containing protein	NA	NA	NA	NA	NA
WP_010929665.1|284722_285538_+	META and DUF4377 domain-containing protein	NA	NA	NA	NA	NA
WP_003808370.1|285598_286333_+	sulfurtransferase	NA	NA	NA	NA	NA
WP_010929666.1|286370_288449_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	23.6	1.5e-27
WP_003808374.1|288698_288971_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033446322.1|289072_290158_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_010929668.1|290161_292066_+	BamA/TamA family outer membrane protein	NA	NA	NA	NA	NA
WP_014486044.1|292062_295737_+	DUF490 domain-containing protein	NA	NA	NA	NA	NA
WP_010929670.1|295797_296361_+	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	75.3	2.6e-72
WP_003808385.1|296368_296791_-	glyoxalase	NA	NA	NA	NA	NA
WP_010929671.1|296818_297238_-	glyoxalase/bleomycin resistance/dioxygenase family protein	NA	NA	NA	NA	NA
WP_077274090.1|297266_297713_-	GNAT family N-acetyltransferase	NA	Q9AZG4	Lactococcus_phage	29.4	1.2e-08
WP_003808391.1|297839_298337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003808393.1|298491_300762_+	arginine/lysine/ornithine decarboxylase	NA	NA	NA	NA	NA
WP_019249381.1|300837_302043_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005012067.1|302141_303092_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929673.1|303194_303830_+	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	73.8	2.8e-83
WP_010929674.1|303826_304720_+	ZIP family metal transporter	NA	NA	NA	NA	NA
WP_010929675.1|305114_306215_+	glycine cleavage system aminomethyltransferase GcvT	NA	NA	NA	NA	NA
WP_010929676.1|306296_306671_+	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_010929677.1|306730_309595_+	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	51.4	1.2e-261
WP_010929678.1|309739_310480_-	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010929679.1|310549_311761_+	CoA transferase	NA	NA	NA	NA	NA
WP_010929680.1|311789_312758_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005012067.1|313371_314322_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003818201.1|314870_315245_-	MerR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_010929807.1|315319_316378_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_005012067.1|316401_317352_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929833.1|318908_319754_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_010929834.1|319841_321005_-	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_010929835.1|321423_322395_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010929836.1|322433_323861_-	amidase	NA	NA	NA	NA	NA
WP_023853625.1|323980_324772_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010929838.1|324890_327344_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.8	2.3e-112
WP_010929839.1|327438_328548_-	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	32.6	1.2e-41
WP_010929554.1|328550_329960_-	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_003816025.1|330365_330500_+	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_003816026.1|330595_330967_+	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_003816027.1|330963_331236_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	52.2	7.0e-15
WP_010927254.1|331284_332976_+	membrane protein insertase YidC	NA	NA	NA	NA	NA
WP_005012067.1|333206_334157_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP017403	Bordetella pertussis strain 509 chromosome, complete genome	4140370	339643	345992	4140370	integrase	Acinetobacter_phage(16.67%)	10	337582:337599	350848:350865
337582:337599	attL	CAGGCCGAGGCCTTCGCG	NA	NA	NA	NA
WP_010929843.1|339643_340633_+|integrase	site-specific integrase	integrase	A0A1B1P9F9	Acinetobacter_phage	44.4	4.4e-75
WP_010926403.1|340629_340830_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010929845.1|340942_341284_-	hypothetical protein	NA	A0A0H5ARN8	Pseudomonas_phage	45.3	1.0e-10
WP_019247983.1|341294_342479_-	hypothetical protein	NA	A0A291L9X3	Bordetella_phage	37.8	1.5e-24
WP_010929847.1|342515_343043_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010929848.1|343100_343748_-	YqaJ viral recombinase family protein	NA	A0A0U2BXF3	Paracoccus_phage	41.4	2.0e-31
WP_050833446.1|343744_344731_-	DNA recombinase	NA	A9DEN8	Yersinia_phage	61.1	3.4e-67
WP_010926410.1|344734_344917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010926411.1|344913_345291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010929850.1|345524_345992_-	hypothetical protein	NA	Q3HQX1	Burkholderia_phage	71.3	2.1e-43
350848:350865	attR	CAGGCCGAGGCCTTCGCG	NA	NA	NA	NA
>prophage 5
NZ_CP017403	Bordetella pertussis strain 509 chromosome, complete genome	4140370	415176	469743	4140370	transposase	Orpheovirus(14.29%)	49	NA	NA
WP_005012067.1|415176_416127_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010927231.1|416263_417181_+	reductase	NA	NA	NA	NA	NA
WP_003815842.1|417177_417426_+	glutaredoxin family protein	NA	NA	NA	NA	NA
WP_019248029.1|417422_418628_+	CoA transferase	NA	NA	NA	NA	NA
WP_014486045.1|418700_419696_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_014906039.1|419718_420939_-	CoA transferase	NA	NA	NA	NA	NA
WP_014486047.1|420935_421580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010929483.1|423310_424120_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014486048.1|424424_425378_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	42.5	5.6e-59
WP_014486049.1|425476_426460_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_014486050.1|426386_427088_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_014486051.1|427136_427907_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_019247259.1|427903_429082_-	CoA transferase	NA	NA	NA	NA	NA
WP_014486052.1|429249_430956_-	thiamine pyrophosphate-requiring protein	NA	NA	NA	NA	NA
WP_019248098.1|430952_431849_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014486054.1|431889_433479_-	sulfurtransferase	NA	NA	NA	NA	NA
WP_003807867.1|433528_434521_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_003807865.1|434589_435189_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014486055.1|435649_436630_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010929577.1|436705_437656_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_047122777.1|437744_438659_+	DMT family transporter	NA	NA	NA	NA	NA
WP_010929782.1|438655_439315_+	LysE family translocator	NA	NA	NA	NA	NA
WP_003814709.1|439404_440328_+	alpha/beta fold hydrolase	NA	A0A1C9C5K3	Heterosigma_akashiwo_virus	27.2	4.8e-07
WP_010929783.1|440333_440789_-	multidrug/biocide efflux PACE transporter	NA	NA	NA	NA	NA
WP_023853020.1|440785_441787_-	ChbG/HpnK family deacetylase	NA	NA	NA	NA	NA
WP_042962164.1|441721_442117_+	GtrA family protein	NA	NA	NA	NA	NA
WP_010927086.1|442076_443696_-	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_003814720.1|443692_444751_-	glycosyltransferase family 2 protein	NA	I1TED8	Salmonella_phage	40.5	2.8e-59
WP_033446199.1|444880_445375_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_022997984.1|445467_446445_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929785.1|446640_447846_+	sodium/glutamate symporter	NA	NA	NA	NA	NA
WP_010929786.1|447842_449354_+	TAXI family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_003814726.1|449369_450683_-	short-chain fatty acid transporter	NA	NA	NA	NA	NA
WP_003814728.1|450873_451053_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003814730.1|451462_452197_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	43.8	1.4e-41
WP_010929577.1|454641_455592_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_019247421.1|455723_456122_-	GTP-binding protein	NA	E4ZFJ7	Streptococcus_phage	44.3	9.0e-19
WP_003814701.1|456532_457003_-	universal stress protein	NA	NA	NA	NA	NA
WP_003820700.1|457091_457436_-	TIGR01244 family phosphatase	NA	NA	NA	NA	NA
WP_010929788.1|457535_458936_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_010929789.1|460724_461243_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	38.9	2.1e-12
WP_003814694.1|461353_462109_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	40.8	2.9e-42
WP_003814691.1|462304_463537_+	CoA transferase	NA	NA	NA	NA	NA
WP_010929791.1|463529_464315_+	crotonase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_003814685.1|464381_465353_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_003814681.1|465363_466341_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_019247419.1|466466_467639_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_010929793.1|467665_468694_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_005013747.1|468792_469743_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP017403	Bordetella pertussis strain 509 chromosome, complete genome	4140370	542647	651991	4140370	tRNA,transposase	Acinetobacter_phage(27.27%)	91	NA	NA
WP_005012808.1|542647_543598_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929985.1|543699_544128_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010929984.1|544200_546396_+	DUF1156 domain-containing protein	NA	NA	NA	NA	NA
WP_005012067.1|546617_547568_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_023852739.1|547527_548052_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_003814467.1|548183_549155_+	FecR family protein	NA	NA	NA	NA	NA
WP_010929983.1|549274_551719_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_010929982.1|551734_552325_-	polyisoprenoid-binding protein	NA	NA	NA	NA	NA
WP_005012067.1|552568_553519_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814462.1|553676_554942_-	saccharopine dehydrogenase family protein	NA	NA	NA	NA	NA
WP_003814461.1|554975_556073_-	carboxynorspermidine decarboxylase	NA	NA	NA	NA	NA
WP_005013747.1|556727_557678_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814459.1|557678_558248_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010929980.1|558315_559131_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010929978.1|560995_561937_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_010929977.1|561936_562821_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_010927038.1|562824_564477_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.8	6.0e-16
WP_010929976.1|564516_565914_+	amidase family protein	NA	NA	NA	NA	NA
WP_010929975.1|565955_567335_+	aminotransferase class III-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_003814443.1|567374_567593_-	DUF1059 domain-containing protein	NA	NA	NA	NA	NA
WP_003814441.1|567933_568806_+	oxaloacetate decarboxylase	NA	NA	NA	NA	NA
WP_010929577.1|568965_569916_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814437.1|570647_571025_+	4a-hydroxytetrahydrobiopterin dehydratase	NA	NA	NA	NA	NA
WP_003814436.1|571009_571711_-	membrane protein	NA	NA	NA	NA	NA
WP_010931409.1|571854_572547_-	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_023852735.1|572546_573587_-	phosphotransferase	NA	NA	NA	NA	NA
WP_033446130.1|573765_576132_+	LPS-assembly protein LptD	NA	NA	NA	NA	NA
WP_010931412.1|576128_577688_+	chaperone SurA	NA	NA	NA	NA	NA
WP_010931413.1|577712_578510_+	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_010931414.1|578541_579687_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	42.2	1.7e-41
WP_003814419.1|579791_581234_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_010929184.1|581236_582466_-	spore maturation protein	NA	NA	NA	NA	NA
WP_005012808.1|584603_585554_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010927663.1|585645_586596_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931400.1|586936_587887_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931399.1|590210_591359_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_010931398.1|591403_592027_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010931397.1|592179_593172_+	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_003815313.1|593168_593906_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_003815315.1|593985_594807_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_010931396.1|594895_595759_+	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
WP_003815317.1|595885_596122_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033454484.1|598171_599140_+	succinylglutamate desuccinylase	NA	NA	NA	NA	NA
WP_003817805.1|599198_600176_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_010931394.1|600183_601104_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_023852622.1|601100_602801_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.7	1.0e-15
WP_010931393.1|602803_603709_+	hydrolase	NA	NA	NA	NA	NA
WP_010931392.1|603752_604886_+	M20 family metallopeptidase	NA	NA	NA	NA	NA
WP_005012067.1|605015_605966_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931391.1|606064_608134_-	UvrD-helicase domain-containing protein	NA	A7KV33	Bacillus_phage	37.3	2.6e-101
WP_019247688.1|608176_610279_-	primosomal protein N'	NA	NA	NA	NA	NA
WP_010931389.1|610585_611662_-	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
WP_010931388.1|611737_612622_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003815341.1|612804_613227_-	F0F1 ATP synthase subunit epsilon	NA	NA	NA	NA	NA
WP_010931387.1|613236_614637_-	F0F1 ATP synthase subunit beta	NA	NA	NA	NA	NA
WP_003817813.1|614679_615585_-	F0F1 ATP synthase subunit gamma	NA	NA	NA	NA	NA
WP_010931386.1|615683_617225_-	F0F1 ATP synthase subunit alpha	NA	NA	NA	NA	NA
WP_003815348.1|617259_617799_-	F0F1 ATP synthase subunit delta	NA	NA	NA	NA	NA
WP_010931385.1|617811_618282_-	F0F1 ATP synthase subunit B	NA	NA	NA	NA	NA
WP_003815363.1|618419_618662_-	F0F1 ATP synthase subunit C	NA	NA	NA	NA	NA
WP_003815364.1|618778_619660_-	F0F1 ATP synthase subunit A	NA	NA	NA	NA	NA
WP_003815365.1|619732_620053_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_005012808.1|620904_621855_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003815367.1|623178_623955_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_010931383.1|623989_625762_+	M61 family metallopeptidase	NA	NA	NA	NA	NA
WP_010931382.1|625763_626666_-	NAD(P)/FAD-dependent oxidoreductase	NA	G3MA85	Bacillus_virus	24.0	1.9e-08
WP_003817821.1|626790_627150_+	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_010931381.1|627181_628144_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	64.5	4.6e-93
WP_005012067.1|628242_629193_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931380.1|629205_630141_-	D-2-hydroxyacid dehydrogenase family protein	NA	A0A1J0F959	Only_Syngen_Nebraska_virus	27.7	6.4e-15
WP_010931379.1|630200_631040_-	thiol:disulfide interchange protein DsbC	NA	NA	NA	NA	NA
WP_010931378.1|631036_632206_-	UbiH/UbiF family hydroxylase	NA	NA	NA	NA	NA
WP_003815379.1|632202_633492_-	murein transglycosylase A	NA	NA	NA	NA	NA
WP_003815381.1|633534_633909_-	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
WP_023852620.1|634023_634752_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_010931377.1|634759_635464_+	phosphoglycolate phosphatase	NA	NA	NA	NA	NA
WP_019248071.1|635727_637248_+	anthranilate synthase component I	NA	S4VNU7	Pandoravirus	32.0	3.1e-43
WP_003815390.1|637303_637867_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	62.1	1.1e-65
WP_003817833.1|637885_638917_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	42.7	7.4e-73
WP_010931375.1|638913_639702_+	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	53.0	5.1e-66
WP_019247413.1|639722_639881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014905441.1|639877_640867_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012067.1|642623_643574_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931374.1|644796_645699_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003814312.1|645700_646555_-	formyltetrahydrofolate deformylase	NA	NA	NA	NA	NA
WP_010931373.1|646601_647711_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_010931372.1|647721_648240_-	flavin reductase family protein	NA	NA	NA	NA	NA
WP_003814302.1|648269_648902_-	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_003814300.1|648973_649633_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_023852703.1|649629_650769_-	MFS transporter	NA	NA	NA	NA	NA
WP_019247745.1|651118_651991_+|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
>prophage 7
NZ_CP017403	Bordetella pertussis strain 509 chromosome, complete genome	4140370	656405	720238	4140370	tRNA,transposase	Pandoravirus(12.5%)	47	NA	NA
WP_010930525.1|656405_657422_-|transposase	IS110-like element IS1663 family transposase	transposase	NA	NA	NA	NA
WP_003814287.1|657693_658320_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010931367.1|658375_659503_-	aminodeoxychorismate synthase component I	NA	S4VT78	Pandoravirus	37.8	3.8e-38
WP_003814283.1|659508_665226_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	39.5	1.0e-195
WP_003814277.1|665793_666738_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	23.2	8.4e-07
WP_003814275.1|666926_667862_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_010931365.1|667979_669551_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_019247692.1|669630_670839_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_010931364.1|671387_672254_+	DMT family transporter	NA	NA	NA	NA	NA
WP_003814254.1|674614_674836_+	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_010930158.1|675166_676183_+|transposase	IS110-like element IS1663 family transposase	transposase	NA	NA	NA	NA
WP_003814252.1|676267_676519_-	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_003814250.1|676522_677338_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_010931362.1|677450_678329_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_003820957.1|678440_680204_-|tRNA	glutamine--tRNA ligase/YqeY domain fusion protein	tRNA	A0A222YZ70	Escherichia_phage	50.0	5.0e-162
WP_010931361.1|680319_681660_+	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_010927010.1|682729_684154_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_003814239.1|684153_684855_-	response regulator	NA	W8CYM9	Bacillus_phage	36.6	5.6e-32
WP_014905422.1|686359_687310_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_023994844.1|687405_688377_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010931357.1|688381_689062_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_003814742.1|689199_689592_+	OsmC family protein	NA	NA	NA	NA	NA
WP_010929632.1|689699_690716_-|transposase	IS110-like element IS1663 family transposase	transposase	NA	NA	NA	NA
WP_003814739.1|690955_691741_-	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_010931356.1|691835_693245_-	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_010927090.1|693255_694056_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_010931355.1|694076_694847_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_010931354.1|694889_695357_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	50.7	5.6e-36
WP_005013747.1|695353_696304_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003818344.1|698252_699131_-	fatty acid desaturase	NA	NA	NA	NA	NA
WP_019247959.1|700057_703036_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013747.1|703389_704340_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931353.1|704336_705425_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_010931352.1|705460_706324_-	3-alpha,7-alpha, 12-alpha-trihydroxy-5-beta-cholest-24-enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_010931351.1|707463_707853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014486103.1|707856_708639_-	crotonase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_047122778.1|708672_709458_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_010931349.1|709733_710873_+	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010931348.1|710869_711661_+	ATP-binding cassette domain-containing protein	NA	A0A1M7XV31	Cedratvirus	29.4	1.7e-08
WP_010931347.1|711657_712407_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.8	1.9e-09
WP_010931346.1|712403_713276_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_004566224.1|713275_714277_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_019248372.1|714273_715437_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_003808193.1|715462_716146_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_019248373.1|716099_717434_+	AMP-binding protein	NA	NA	NA	NA	NA
WP_010931344.1|717426_718521_+	CoA transferase	NA	NA	NA	NA	NA
WP_010929591.1|719287_720238_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP017403	Bordetella pertussis strain 509 chromosome, complete genome	4140370	739149	808330	4140370	protease,tRNA,transposase,integrase	Bacillus_phage(20.0%)	54	744881:744940	816458:817507
WP_005013747.1|739149_740100_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931335.1|740198_741674_-	M81 family metallopeptidase	NA	NA	NA	NA	NA
WP_010931334.1|743261_744149_-	ABC transporter permease	NA	NA	NA	NA	NA
744881:744940	attL	CTGTGAAGATTCAATAGGTTGTATGCATGGTTCATCCGAACCGGATTTGAGAAACTGGAA	NA	NA	NA	NA
WP_005012808.1|744978_745929_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931332.1|746187_747753_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010931331.1|749530_750856_-	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_010931330.1|751038_752496_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	21.1	7.6e-15
WP_003816386.1|752459_752957_-	dihydrofolate reductase	NA	A0A140HLG8	Bacillus_phage	38.9	3.0e-24
WP_010931328.1|752987_753959_-	thymidylate synthase	NA	J7KKN7	Erwinia_phage	33.3	4.8e-50
WP_023994724.1|754011_754443_-	OsmC family protein	NA	NA	NA	NA	NA
WP_010931327.1|754572_755241_+	2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase	NA	NA	NA	NA	NA
WP_003808448.1|755969_757073_+	glycosyl transferase	NA	NA	NA	NA	NA
WP_010931326.1|757178_758453_+	Vi polysaccharide biosynthesis UDP-N-acetylglucosamine C-6 dehydrogenase TviB	NA	NA	NA	NA	NA
WP_010930472.1|758464_759490_+	Vi polysaccharide biosynthesis UDP-N-acetylglucosaminuronic acid C-4 epimerase TviC	NA	A0A2K9L4U8	Tupanvirus	44.2	4.7e-72
WP_010931325.1|759491_760862_+	membrane protein	NA	NA	NA	NA	NA
WP_010931324.1|760862_761999_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_010931323.1|762045_763971_+	asparagine synthase (glutamine-hydrolyzing)	NA	A0A2K9R7N5	Dishui_lake_phycodnavirus	29.0	1.0e-27
WP_010931322.1|763967_765089_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_010931321.1|765085_766240_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_010931320.1|766236_767367_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_003808462.1|767374_768940_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_010931319.1|768946_770329_-	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	31.6	6.2e-51
WP_003808465.1|770607_771219_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010931317.1|771310_772726_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_003818936.1|772743_773454_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_010931316.1|773450_774773_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_023853096.1|774918_776814_+	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_003818932.1|776939_778253_-	fumarylacetoacetase	NA	NA	NA	NA	NA
WP_003818930.1|778361_779660_-	homogentisate 1,2-dioxygenase	NA	NA	NA	NA	NA
WP_010931314.1|779842_780751_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003808487.1|780760_780970_-	DUF2783 domain-containing protein	NA	NA	NA	NA	NA
WP_003808489.1|780981_782661_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_010931313.1|782762_783716_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_010925978.1|783806_784634_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	NA	NA	NA	NA
WP_010931312.1|784632_786519_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_003818921.1|786515_787115_+	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_010931311.1|787163_788063_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_010931310.1|788271_789222_+	ribose-phosphate pyrophosphokinase	NA	A0A2K9L8D8	Tupanvirus	35.5	7.3e-43
WP_029443719.1|789344_789959_+	50S ribosomal protein L25/general stress protein Ctc	NA	NA	NA	NA	NA
WP_010931308.1|790087_790684_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_010931307.1|790680_791463_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_010931306.1|791535_792627_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_010931305.1|792906_794034_+|integrase	site-specific integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	33.6	1.4e-48
WP_010931304.1|794375_795422_+	Fic family protein	NA	NA	NA	NA	NA
WP_019247951.1|795932_798689_+	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_010931302.1|798690_801642_+	restriction endonuclease subunit M	NA	G8I4P9	Mycobacterium_phage	25.1	2.9e-21
WP_010931301.1|801657_802869_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_076879586.1|802865_803066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013747.1|803052_804003_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_077274087.1|804019_804514_+	DUF4276 family protein	NA	NA	NA	NA	NA
WP_019247740.1|804517_804775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019248155.1|805318_806230_+	UvrD-helicase domain-containing protein	NA	NA	NA	NA	NA
WP_029443992.1|806311_806596_+	ATP-dependent helicase	NA	A0A1V0SIN4	Klosneuvirus	34.1	6.8e-05
WP_010929577.1|807379_808330_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
816458:817507	attR	CTGTGAAGATTCAATAGGTTGTATGCATGGTTCATCCGAACCGGATTTGAGAAACTGGAAATCGCCACCCCCCCAGTTCACTCAAGGAGCCCGGCCGGATGAACACCCATAAGCATGCCCGATTGACCTTCCTACGTCGACTCGAAATGGTCCAGCAATTGATCGCCCATCAAGTTTGTGTGCCTGAAGCGGCCCGCGCCTATGGGGTCACCGCGCCGACTGTGCGCAAATGGCTGGGCCGCTTCCTGGCTCAGGGCCAGGCGGGCTTGGCCGATGCGTCCTCGCGCCCGACGGTCTCGCCCCGAGCGATTGCGCCGGCCAAGGCGCTGGCTATCGTGGAGCTGCGCCGCAAGCGGCTGACCCAAGCGCGCATCGCCCAGGCGCTGGGCGTGTCAGCCAGCACCGTCAGCCGCGTCCTGGCCCGCGCCGGTCTGTCGCACCTGGCCGACCTGGAGCCGGCCGAGCCGGTGGTGCGCTACGAGCATCAGGCCCCCGGCGATCTGCTGCACATCGACATCAAGAAGCTGGGACGTATCCAGCGCCCTGGCCACCGGGTCACGGGCAACCGACGCGATACCGTTGAGGGGGCCGGCTGGGACTTCGTCTTCGTGGCCATCGATGACCACGCCCGCGTGGCCTTCACCGACATCCACCCCGACGAGCGCTTCCCCAGCGCCGTCCAGTTCCTCAAGGACGCAGTGGCCTACTACCAGCGCCTGGGCGTGACCATCCAGCGCTTGCTCACCGACAATGGCTCGGCCTTTCGCAGCCGCGCCTTCGCCGCGCTGTGCCATGAGCTGGGCATCAAGCACCGCTTTACCCGACCTTACCGCCCACAGACCAATGGCAAGGCCGAACGCTTCATCCAGTCGGCCTTGCGTGAGTGGGCTTACGCTCACACCTACCAGAACTCCCAACACCGAGCCGATGCCATGAAATCCTGGCTACACCACTACAACTGGCATCGACCCCACCAAGGCATCGGGCGCGCTGTACCCATCTCCAGACTCAACCTGGACGAATACAACCTATTGACAGTTCACAACTAGC	NA	NA	NA	NA
>prophage 10
NZ_CP017403	Bordetella pertussis strain 509 chromosome, complete genome	4140370	924244	981081	4140370	protease,tRNA,transposase	Pseudomonas_phage(37.5%)	49	NA	NA
WP_005012067.1|924244_925195_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012067.1|925293_926244_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931247.1|926342_927206_-	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_010931246.1|927202_928102_-	TonB family protein	NA	NA	NA	NA	NA
WP_019248069.1|928139_930023_-	RNB domain-containing ribonuclease	NA	NA	NA	NA	NA
WP_010931244.1|930094_930688_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_003814955.1|930698_932069_-	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_023853327.1|932151_932700_+	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_003814953.1|932778_933213_+	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_003814952.1|933302_933752_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_003814951.1|933761_935108_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_010931242.1|936073_937171_+	DUF3426 domain-containing protein	NA	NA	NA	NA	NA
WP_010931241.1|937182_938124_+	carbohydrate kinase family protein	NA	NA	NA	NA	NA
WP_010931240.1|938296_938800_+	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_003814943.1|939080_939320_+	acyl carrier protein	NA	NA	NA	NA	NA
WP_080478561.1|939297_940707_+	D-alanyl-lipoteichoic acid biosynthesis protein DltD	NA	NA	NA	NA	NA
WP_010931239.1|940836_941964_+	membrane-bound O-acyltransferase	NA	A0A125RNP0	Pseudomonas_phage	30.8	3.7e-25
WP_023853325.1|941983_943438_+	D-alanine--poly(phosphoribitol) ligase	NA	A0A2K9L3I8	Tupanvirus	25.1	7.3e-26
WP_023853329.1|943445_944006_-	YggT family protein	NA	NA	NA	NA	NA
WP_010931236.1|944159_944687_-	histone H1-like DNA-binding protein	NA	NA	NA	NA	NA
WP_003814929.1|945004_946201_-	ribonucleotide-diphosphate reductase subunit beta	NA	A0A2H4P762	Pseudomonas_phage	28.9	1.0e-33
WP_010931235.1|946222_949150_-	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2H4P767	Pseudomonas_phage	43.9	3.4e-171
WP_019247415.1|949455_952518_-	indolepyruvate ferredoxin oxidoreductase family protein	NA	NA	NA	NA	NA
WP_003814925.1|953079_953532_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_023998238.1|953733_954243_+	lipoprotein	NA	NA	NA	NA	NA
WP_010931233.1|954311_955499_+	MFS transporter	NA	NA	NA	NA	NA
WP_033446281.1|955502_956909_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_010931231.1|957044_959504_+	bifunctional acetate--CoA ligase family protein/GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005012067.1|959500_960451_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012067.1|960549_961500_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931230.1|961598_962273_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010931229.1|962569_964066_+	membrane protein	NA	NA	NA	NA	NA
WP_003820592.1|964182_965571_+	ATP-dependent RNA helicase DbpA	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	33.5	4.6e-54
WP_003820593.1|965676_966066_+	VOC family protein	NA	NA	NA	NA	NA
WP_019248167.1|966077_966770_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_010931228.1|966784_967621_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_010931227.1|967623_968433_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.9	2.6e-33
WP_010931226.1|969689_970364_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_023853313.1|970377_970929_-	ribosome-associated protein	NA	NA	NA	NA	NA
WP_004567741.1|970987_972352_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_004567739.1|972693_973791_+	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010927106.1|974086_974515_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_010931224.1|974524_974917_+	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_003820599.1|975105_976170_+	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
WP_010931223.1|976206_976953_+	membrane protein	NA	NA	NA	NA	NA
WP_003814883.1|977040_977412_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	56.9	4.7e-30
WP_010931222.1|977481_978618_-	anhydro-N-acetylmuramic acid kinase	NA	NA	NA	NA	NA
WP_010931221.1|978623_980039_-	M23 family metallopeptidase	NA	A8ATH6	Listeria_phage	46.9	1.9e-18
WP_005012067.1|980130_981081_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 11
NZ_CP017403	Bordetella pertussis strain 509 chromosome, complete genome	4140370	1055375	1186769	4140370	tRNA,transposase	Bacillus_virus(20.0%)	120	NA	NA
WP_003813026.1|1055375_1056491_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_003813022.1|1056591_1057410_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_010931185.1|1057507_1058119_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_010931184.1|1058278_1059655_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	47.5	2.2e-109
WP_003813017.1|1059717_1060176_+	cytochrome c	NA	NA	NA	NA	NA
WP_003813013.1|1060260_1060956_-	cytochrome b561	NA	NA	NA	NA	NA
WP_003813010.1|1061017_1061299_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010931182.1|1061861_1062614_+	DUF3053 domain-containing protein	NA	NA	NA	NA	NA
WP_003813006.1|1062658_1063735_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_005012067.1|1063731_1064682_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_014486100.1|1064784_1065447_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_019249309.1|1065541_1065712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003818702.1|1067068_1068265_+	CoA transferase	NA	NA	NA	NA	NA
WP_014486098.1|1068285_1069089_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_019247598.1|1069169_1069466_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019247597.1|1069496_1070060_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_014486097.1|1070100_1070958_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003818698.1|1070965_1071715_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.5	6.2e-29
WP_014486096.1|1071736_1072609_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_014486095.1|1072637_1073417_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_014486094.1|1073450_1074248_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003808978.1|1076902_1077295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014486091.1|1077288_1078149_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003818691.1|1078152_1079115_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_014486089.1|1079891_1080581_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.8	4.8e-12
WP_010930208.1|1081441_1082392_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931181.1|1082504_1083374_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010926062.1|1083444_1084140_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_010931179.1|1084129_1084639_+	nucleoside deaminase	NA	NA	NA	NA	NA
WP_010931178.1|1084635_1085856_+	MFS transporter	NA	NA	NA	NA	NA
WP_010931177.1|1085803_1086706_-	transcriptional regulator GcvA	NA	NA	NA	NA	NA
WP_023997744.1|1087592_1088879_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931176.1|1088917_1090291_+	amidase	NA	NA	NA	NA	NA
WP_010931175.1|1090329_1091031_-	riboflavin synthase	NA	NA	NA	NA	NA
WP_010931174.1|1091329_1092319_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_003809010.1|1092419_1092881_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_010931173.1|1092896_1093445_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010931172.1|1093586_1095062_-	acyl--CoA ligase	NA	Q75ZG1	Hepacivirus	25.6	3.0e-35
WP_010931171.1|1095167_1096259_+	DUF2817 domain-containing protein	NA	NA	NA	NA	NA
WP_010931170.1|1096262_1097045_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_019248105.1|1097054_1097843_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	40.0	6.7e-34
WP_010931168.1|1098968_1099403_-	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_010931167.1|1099399_1100410_-	zinc-binding dehydrogenase	NA	NA	NA	NA	NA
WP_003809025.1|1100453_1101380_-	VOC family protein	NA	NA	NA	NA	NA
WP_003809026.1|1101665_1102034_+	DUF861 domain-containing protein	NA	NA	NA	NA	NA
WP_005013747.1|1102250_1103201_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931165.1|1103245_1105672_+	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	33.8	1.2e-86
WP_010931164.1|1105720_1106413_+	HD domain-containing protein	NA	A0A1D6Y7U0	Golden_Marseillevirus	29.9	4.7e-07
WP_010931163.1|1106485_1107685_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_003819549.1|1107702_1108608_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010931162.1|1108723_1109653_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_010931161.1|1109678_1111025_+	MFS transporter	NA	NA	NA	NA	NA
WP_019247888.1|1111037_1111802_+	SDR family oxidoreductase	NA	A0A0M4JSW6	Mollivirus	26.5	3.1e-12
WP_010931159.1|1111815_1112598_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_005012067.1|1112790_1113741_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931158.1|1113802_1114912_-	porin	NA	NA	NA	NA	NA
WP_003815281.1|1115424_1116261_-	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0P0BXC9	Ostreococcus_lucimarinus_virus	33.3	1.6e-33
WP_010931157.1|1116387_1117296_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005012067.1|1117292_1118243_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_019247492.1|1118628_1119171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010930176.1|1120206_1121157_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_019247402.1|1121398_1121767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019248356.1|1121812_1122937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003820818.1|1124071_1124812_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010931155.1|1124915_1125536_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010931154.1|1125537_1127646_-	AsmA family protein	NA	NA	NA	NA	NA
WP_023996698.1|1127790_1128402_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_003820813.1|1128481_1128946_-	redox-sensitive transcriptional activator SoxR	NA	NA	NA	NA	NA
WP_019248355.1|1129221_1129407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010931153.1|1129458_1130211_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_010931152.1|1130217_1131480_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_023852748.1|1131521_1132760_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_003820806.1|1133837_1134965_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.3	1.2e-23
WP_003814524.1|1134975_1135803_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_010931150.1|1135789_1136656_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_010931149.1|1138022_1138427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033446288.1|1138789_1139701_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_003820799.1|1139715_1140426_+	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010931147.1|1140422_1141667_+	DUF521 domain-containing protein	NA	NA	NA	NA	NA
WP_003820797.1|1141668_1142103_+	DUF126 domain-containing protein	NA	NA	NA	NA	NA
WP_003814535.1|1142131_1142437_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_005012067.1|1142535_1143486_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_029443926.1|1143542_1144691_-	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_010930176.1|1144771_1145722_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931144.1|1146253_1147051_-	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_019248416.1|1147098_1147752_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003814544.1|1147708_1148797_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	36.4	8.7e-32
WP_003814547.1|1148961_1151187_-	glycoside hydrolase family 31 protein	NA	NA	NA	NA	NA
WP_023852715.1|1153464_1154361_+	inositol monophosphatase	NA	NA	NA	NA	NA
WP_005012067.1|1154481_1155432_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931141.1|1155428_1157120_-	AMP-binding protein	NA	A0A2H4PQU7	Staphylococcus_phage	28.1	9.4e-33
WP_010931140.1|1157181_1158378_+	amidohydrolase	NA	NA	NA	NA	NA
WP_003814552.1|1158391_1159270_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010929220.1|1159376_1160423_+	YeiH family putative sulfate export transporter	NA	NA	NA	NA	NA
WP_003814554.1|1160486_1160897_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_003814555.1|1160907_1162380_+	magnesium transporter	NA	NA	NA	NA	NA
WP_010931139.1|1163522_1164674_-	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_003813114.1|1164821_1165832_-	acyltransferase family protein	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	24.6	3.6e-16
WP_010931138.1|1166002_1166968_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_033446289.1|1167142_1167973_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003813109.1|1168059_1168326_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_003820295.1|1168330_1169242_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_010931136.1|1169291_1171154_+	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_003813103.1|1171310_1172108_+	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_010926331.1|1172327_1172708_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_003813095.1|1172755_1173079_+	primosomal replication protein N	NA	NA	NA	NA	NA
WP_003813094.1|1173171_1173444_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_010931135.1|1173459_1173915_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_019248136.1|1174031_1174868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003813089.1|1174864_1176238_+	replicative DNA helicase	NA	C7BGG1	Burkholderia_phage	58.2	4.0e-135
WP_019248137.1|1176258_1177227_-	bile acid:sodium symporter	NA	NA	NA	NA	NA
WP_003813085.1|1177306_1178284_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_003813082.1|1178388_1180068_-	PhoH family protein	NA	A0A2I7SAD7	Vibrio_phage	36.9	1.5e-70
WP_003813079.1|1180147_1180612_-	peroxiredoxin	NA	NA	NA	NA	NA
WP_003813077.1|1180614_1181067_-	Xcc1710-like domain-containing protein	NA	NA	NA	NA	NA
WP_010931132.1|1181283_1182471_+	alanine transaminase	NA	NA	NA	NA	NA
WP_003813074.1|1182467_1183772_+	homoserine dehydrogenase	NA	NA	NA	NA	NA
WP_010931131.1|1183768_1185175_+	threonine synthase	NA	NA	NA	NA	NA
WP_003813070.1|1185388_1185610_+	YgdI/YgdR family lipoprotein	NA	NA	NA	NA	NA
WP_005012808.1|1185818_1186769_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 12
NZ_CP017403	Bordetella pertussis strain 509 chromosome, complete genome	4140370	1190321	1252629	4140370	protease,transposase	uncultured_Mediterranean_phage(28.57%)	47	NA	NA
WP_005012067.1|1190321_1191272_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_023853341.1|1191871_1192639_+	2-dehydro-3-deoxyglucarate aldolase	NA	NA	NA	NA	NA
WP_003812908.1|1192756_1193020_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_010931128.1|1193120_1194125_-	DUF4880 domain-containing protein	NA	NA	NA	NA	NA
WP_010931127.1|1194325_1195927_-	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_010931126.1|1195952_1196711_-	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_010931125.1|1196802_1197459_-	adenylate kinase	NA	NA	NA	NA	NA
WP_010931124.1|1197549_1198314_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_003812895.1|1198323_1198512_-	Trm112 family protein	NA	NA	NA	NA	NA
WP_010931123.1|1198567_1199611_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_010931122.1|1199607_1200021_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_003812889.1|1200017_1200638_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_005012067.1|1200918_1201869_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931120.1|1202036_1203428_+	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	32.0	1.4e-29
WP_010931119.1|1203500_1204079_+	superoxide dismutase [Fe]	NA	NA	NA	NA	NA
WP_019247560.1|1204195_1205593_+	chloride channel protein	NA	NA	NA	NA	NA
WP_010931117.1|1205708_1206914_+	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_003820399.1|1207013_1207532_-	hypothetical protein	NA	A0A1B1IUW8	uncultured_Mediterranean_phage	42.2	5.1e-14
WP_003812875.1|1207626_1207872_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	76.6	1.3e-20
WP_003820400.1|1208099_1208414_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	43.8	1.2e-10
WP_023853340.1|1208512_1213693_+	alpha-2-macroglobulin family protein	NA	NA	NA	NA	NA
WP_050833419.1|1213689_1215858_+	penicillin-binding protein 1C	NA	NA	NA	NA	NA
WP_010931114.1|1215913_1218229_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	41.9	4.1e-164
WP_003820402.1|1218233_1219553_+	PqiA/YebS family transporter subunit	NA	NA	NA	NA	NA
WP_014905522.1|1219571_1221245_+	MCE family protein	NA	NA	NA	NA	NA
WP_010931111.1|1221249_1221918_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_010931110.1|1222074_1225896_+	trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_005015810.1|1226226_1227177_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003812857.1|1227198_1228344_+	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003820410.1|1228492_1229422_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003812851.1|1229418_1230507_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_010931109.1|1230503_1231307_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.5	7.9e-14
WP_003812846.1|1231303_1232035_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.0	1.4e-12
WP_010931108.1|1232092_1233382_-	MFS transporter	NA	NA	NA	NA	NA
WP_010931107.1|1233478_1234081_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003812839.1|1238634_1238973_-	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_010931105.1|1239680_1239947_+	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_005012067.1|1241653_1242604_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931103.1|1242600_1243932_-	MFS transporter	NA	NA	NA	NA	NA
WP_010931102.1|1245192_1247193_+	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_003819722.1|1247185_1247827_+	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
WP_003809276.1|1247823_1248231_+	cytochrome o ubiquinol oxidase subunit IV	NA	NA	NA	NA	NA
WP_010931101.1|1248227_1249028_+	SURF1 family protein	NA	NA	NA	NA	NA
WP_010931100.1|1249102_1249807_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010931099.1|1249838_1250633_+	N-formylglutamate deformylase	NA	NA	NA	NA	NA
WP_010929956.1|1250629_1251580_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012808.1|1251678_1252629_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 13
NZ_CP017403	Bordetella pertussis strain 509 chromosome, complete genome	4140370	1353707	1419157	4140370	transposase	Planktothrix_phage(33.33%)	53	NA	NA
WP_076879576.1|1353707_1354658_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930048.1|1354756_1355707_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003811244.1|1355805_1356417_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_010930290.1|1356651_1357779_+	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010930289.1|1357889_1358978_-	sn-glycerol-3-phosphate import ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	31.2	2.2e-19
WP_003811259.1|1359030_1359882_-	sn-glycerol-3-phosphate ABC transporter permease UgpE	NA	NA	NA	NA	NA
WP_003811262.1|1359901_1360783_-	sn-glycerol-3-phosphate ABC transporter permease UgpA	NA	NA	NA	NA	NA
WP_010930288.1|1360959_1362273_-	sn-glycerol-3-phosphate ABC transporter substrate-binding protein UgpB	NA	NA	NA	NA	NA
WP_003811267.1|1362483_1363317_+	pyrroline-5-carboxylate reductase	NA	NA	NA	NA	NA
WP_010930287.1|1363313_1363895_+	queuosine precursor transporter	NA	A0A2I7SAW6	Vibrio_phage	37.3	9.4e-17
WP_005015810.1|1364248_1365199_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930286.1|1365214_1366330_+	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003811272.1|1366432_1367359_+	high-affinity branched-chain amino acid ABC transporter permease LivH	NA	NA	NA	NA	NA
WP_010930285.1|1367358_1368597_+	high-affinity branched-chain amino acid ABC transporter permease LivM	NA	NA	NA	NA	NA
WP_003811277.1|1368593_1369361_+	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG	NA	A0A2H4PQG7	Staphylococcus_phage	26.4	1.2e-14
WP_003811279.1|1369361_1370063_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.4	7.8e-18
WP_019247793.1|1370144_1370591_-	glutamate racemase	NA	NA	NA	NA	NA
WP_010930283.1|1371480_1372119_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_005012808.1|1372887_1373838_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003811293.1|1374059_1374437_-	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_003811295.1|1374584_1375082_+	DUF2384 domain-containing protein	NA	NA	NA	NA	NA
WP_010930291.1|1375078_1375606_+	RES family NAD+ phosphorylase	NA	NA	NA	NA	NA
WP_003811298.1|1375739_1376555_+	exported protein	NA	NA	NA	NA	NA
WP_010930292.1|1376567_1377749_-	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_003811301.1|1377796_1378690_-	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_010930293.1|1378816_1379287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010930294.1|1379412_1380240_-	DUF3298 domain-containing protein	NA	NA	NA	NA	NA
WP_010930295.1|1381331_1381796_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_010930296.1|1381807_1382509_-	thiol:disulfide oxidoreductase	NA	NA	NA	NA	NA
WP_003811310.1|1382618_1383119_-	glutathione peroxidase	NA	Q6VZR0	Canarypox_virus	38.4	4.7e-25
WP_010930297.1|1383201_1384380_-	DUF1501 domain-containing protein	NA	NA	NA	NA	NA
WP_003811313.1|1386007_1386343_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_010930298.1|1386530_1387979_+	CoA transferase	NA	NA	NA	NA	NA
WP_023852799.1|1388036_1388381_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	58.4	3.0e-31
WP_003811316.1|1388487_1389027_-	peroxiredoxin	NA	NA	NA	NA	NA
WP_010929577.1|1389119_1390070_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_023852768.1|1390168_1390576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019247530.1|1390808_1391240_-	BcpO-related WXXGXW repeat protein	NA	NA	NA	NA	NA
WP_010930300.1|1391421_1391826_-	DoxX family protein	NA	NA	NA	NA	NA
WP_010930301.1|1393062_1393386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010926674.1|1393388_1394276_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_003811322.1|1394308_1394734_-	universal stress protein	NA	NA	NA	NA	NA
WP_019247534.1|1394805_1395159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003811324.1|1395398_1395905_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050833447.1|1395943_1397275_-	transcriptional regulator PtsJ	NA	NA	NA	NA	NA
WP_003811326.1|1397334_1398150_+	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_010930303.1|1398146_1399001_+	pyridoxine/pyridoxal/pyridoxamine kinase	NA	NA	NA	NA	NA
WP_019248253.1|1402063_1404628_-	malto-oligosyltrehalose synthase	NA	NA	NA	NA	NA
WP_010930305.1|1405994_1407749_-	malto-oligosyltrehalose trehalohydrolase	NA	NA	NA	NA	NA
WP_010930306.1|1407745_1409866_-	glycogen debranching protein GlgX	NA	NA	NA	NA	NA
WP_010930307.1|1409870_1412066_-	1,4-alpha-glucan branching protein GlgB	NA	NA	NA	NA	NA
WP_010930308.1|1412062_1415404_-	maltose alpha-D-glucosyltransferase	NA	NA	NA	NA	NA
WP_010930208.1|1418206_1419157_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 14
NZ_CP017403	Bordetella pertussis strain 509 chromosome, complete genome	4140370	1758674	1824364	4140370	protease,tRNA,transposase	Salmonella_phage(15.38%)	60	NA	NA
WP_023853254.1|1758674_1760618_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_004566380.1|1760614_1761535_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010930928.1|1761554_1762142_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_003813784.1|1762134_1763025_-	GTPase Era	NA	NA	NA	NA	NA
WP_023853248.1|1763021_1763783_-	ribonuclease III	NA	M4QNJ2	Ostreococcus_lucimarinus_virus	33.0	3.1e-20
WP_010930929.1|1763788_1764673_-	signal peptidase I	NA	NA	NA	NA	NA
WP_010930930.1|1764695_1766489_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	23.5	8.4e-24
WP_004566381.1|1766619_1768107_-|protease	DegQ family serine endoprotease	protease	W5SAB9	Pithovirus	31.5	1.2e-07
WP_010930931.1|1768144_1769203_-	siderophore-interacting protein	NA	NA	NA	NA	NA
WP_023853242.1|1769202_1769703_-	sigma-E factor negative regulatory protein	NA	NA	NA	NA	NA
WP_003813797.1|1769715_1770315_-	RNA polymerase sigma factor RpoE	NA	A0A0F6TH34	Sinorhizobium_phage	26.1	2.2e-05
WP_010930933.1|1770311_1770812_-	membrane protein	NA	NA	NA	NA	NA
WP_003813802.1|1770813_1772043_-	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_003813816.1|1772232_1772472_-	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	46.6	5.4e-11
WP_003813819.1|1772654_1773407_-	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.3	6.9e-12
WP_010930934.1|1773408_1774344_-	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_010930935.1|1774425_1775412_-	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_003821347.1|1775411_1776470_-	phosphate acyltransferase PlsX	NA	NA	NA	NA	NA
WP_003813827.1|1776526_1776709_-	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_010930936.1|1776760_1777354_-	DUF177 domain-containing protein	NA	NA	NA	NA	NA
WP_003821345.1|1777462_1778062_+	septum formation protein Maf	NA	NA	NA	NA	NA
WP_010930937.1|1778058_1778769_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_010930938.1|1778770_1779598_+	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_003814009.1|1781404_1782646_-	MFS transporter	NA	NA	NA	NA	NA
WP_003814010.1|1782657_1783431_-	peroxide stress protein YaaA	NA	NA	NA	NA	NA
WP_005012067.1|1783457_1784408_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814011.1|1784506_1785289_-	3-hydroxybutyrate dehydrogenase	NA	NA	NA	NA	NA
WP_019248324.1|1785377_1786583_-	transporter	NA	NA	NA	NA	NA
WP_003814013.1|1787308_1788694_+	alcaligin siderophore biosynthesis protein AlcA	NA	NA	NA	NA	NA
WP_003814014.1|1788712_1789318_+	alcaligin siderophore biosynthesis protein AlcB	NA	NA	NA	NA	NA
WP_010930939.1|1789314_1791171_+	alcaligin siderophore biosynthesis protein AlcC	NA	NA	NA	NA	NA
WP_003814016.1|1791167_1791968_+	alcaligin siderophore biosynthesis protein AlcD	NA	NA	NA	NA	NA
WP_005013753.1|1791982_1793176_+	alcaligin siderophore biosynthesis protein AlcE	NA	NA	NA	NA	NA
WP_003814017.1|1793243_1794218_+	alcaligin siderophore biosynthesis transcriptional regulator AlcR	NA	NA	NA	NA	NA
WP_010930940.1|1794340_1795564_+	alcaligin siderophore export MFS transporter Bcr	NA	S4TR35	Salmonella_phage	29.4	9.8e-24
WP_010930941.1|1795674_1797879_+	TonB-dependent alcaligin siderophore receptor FauA	NA	NA	NA	NA	NA
WP_003814020.1|1798173_1798833_+	NAAT family transporter	NA	NA	NA	NA	NA
WP_019247690.1|1798840_1799047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019248325.1|1799385_1800141_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_003814022.1|1800156_1800318_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003814023.1|1800411_1800927_+	hypothetical protein	NA	T1SAR8	Salmonella_phage	44.6	5.1e-06
WP_003814024.1|1801199_1801517_+	virulence factor	NA	NA	NA	NA	NA
WP_005014990.1|1801704_1801941_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010930944.1|1802231_1803587_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	47.5	1.6e-83
WP_010930945.1|1803633_1804974_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	38.9	1.6e-75
WP_010930946.1|1805075_1805708_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_010930947.1|1805707_1808077_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	48.0	7.6e-81
WP_010930948.1|1808109_1809069_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	40.2	3.1e-57
WP_010929073.1|1809055_1809742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005015014.1|1809738_1810071_+	multidrug transporter	NA	NA	NA	NA	NA
WP_010929577.1|1810186_1811137_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814040.1|1811133_1813200_-	cation acetate symporter	NA	NA	NA	NA	NA
WP_003814042.1|1813199_1813472_-	DUF4212 domain-containing protein	NA	NA	NA	NA	NA
WP_017685545.1|1814166_1814256_+	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
WP_010930949.1|1814255_1816040_+	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_010930950.1|1816063_1818229_+	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	27.1	1.2e-24
WP_003814050.1|1818239_1818839_+	potassium-transporting ATPase subunit KdpC	NA	NA	NA	NA	NA
WP_003814052.1|1821660_1822356_+	two-component system response regulator KdpE	NA	NA	NA	NA	NA
WP_005013747.1|1822364_1823315_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013747.1|1823413_1824364_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 15
NZ_CP017403	Bordetella pertussis strain 509 chromosome, complete genome	4140370	1864592	1978686	4140370	tRNA,transposase	Salmonella_phage(16.67%)	109	NA	NA
WP_010930208.1|1864592_1865543_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_019247993.1|1865967_1868427_-	Flp pilus assembly complex ATPase component TadA	NA	NA	NA	NA	NA
WP_010930977.1|1868423_1869836_-	secretion protein	NA	NA	NA	NA	NA
WP_010930978.1|1869832_1870678_-	Flp pilus assembly protein CpaB	NA	NA	NA	NA	NA
WP_010930979.1|1870674_1871331_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010930980.1|1871921_1873238_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003812728.1|1873234_1873498_-	membrane protein	NA	NA	NA	NA	NA
WP_003812730.1|1873691_1873823_-	entericidin A/B family lipoprotein	NA	NA	NA	NA	NA
WP_010930981.1|1873849_1874545_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_010930982.1|1874739_1875276_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	55.5	5.9e-50
WP_050833460.1|1875304_1876906_-	protoheme IX synthesis protein	NA	NA	NA	NA	NA
WP_010930984.1|1876909_1878094_-	heme biosynthesis operon protein HemX	NA	NA	NA	NA	NA
WP_010930985.1|1878131_1878920_-	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_003820470.1|1878952_1879897_-	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_010930986.1|1880015_1880735_-	TerC family protein	NA	A0A0S4KZH7	Pseudomonas_phage	46.8	1.4e-41
WP_010930987.1|1880893_1881589_-	TerC family protein	NA	W8EBD0	Pseudomonas_phage	31.4	2.7e-18
WP_003812748.1|1881864_1882746_-	succinate--CoA ligase subunit alpha	NA	A0A2K9L1S3	Tupanvirus	32.1	3.6e-20
WP_003812749.1|1882765_1883926_-	ADP-forming succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
WP_010930988.1|1883936_1884539_-	DUF2889 domain-containing protein	NA	NA	NA	NA	NA
WP_010930989.1|1884743_1887038_-	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_003812755.1|1887199_1888129_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010930990.1|1888203_1888770_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_003812760.1|1888802_1889864_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	64.0	2.0e-113
WP_003812762.1|1890103_1890793_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_019247281.1|1890770_1892267_+	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	28.5	1.3e-22
WP_003820458.1|1892461_1894138_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_015041674.1|1894389_1895166_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_010930993.1|1895193_1896258_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.8	5.7e-28
WP_010930994.1|1896254_1898006_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_004567469.1|1898034_1899072_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_010930995.1|1899109_1899856_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_003820449.1|1899856_1900300_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010930996.1|1900300_1900693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010930997.1|1900700_1901864_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010930998.1|1902079_1902967_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023994674.1|1902983_1904291_+	CoA transferase	NA	NA	NA	NA	NA
WP_010931000.1|1904342_1904759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003812788.1|1904912_1905812_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	33.2	3.7e-44
WP_010926366.1|1905851_1907147_-	aspartate carbamoyltransferase	NA	A0A1J0F9B8	Only_Syngen_Nebraska_virus	35.1	1.4e-41
WP_003820436.1|1907253_1907667_-	membrane protein	NA	NA	NA	NA	NA
WP_010931001.1|1907668_1908103_-	lipoprotein	NA	NA	NA	NA	NA
WP_003812797.1|1908228_1908360_-	entericidin A/B family lipoprotein	NA	NA	NA	NA	NA
WP_023853497.1|1908535_1909276_+	nuclease, EndA/NucM family	NA	NA	NA	NA	NA
WP_023853503.1|1909417_1909750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|1910487_1911438_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_004567479.1|1911548_1911731_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010931004.1|1911830_1912427_-	lipoprotein	NA	NA	NA	NA	NA
WP_010931005.1|1912610_1913702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003812822.1|1914201_1914612_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023852697.1|1914670_1915000_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	42.2	2.7e-13
WP_010931007.1|1915017_1917435_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_010926359.1|1917447_1918470_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	38.6	1.0e-26
WP_003812832.1|1918544_1918904_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_003812834.1|1918919_1919117_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_005012808.1|1919452_1920403_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_076879566.1|1920501_1921452_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_023853496.1|1921591_1921837_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010931008.1|1921951_1923400_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_005012067.1|1923510_1924461_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929584.1|1924559_1925510_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_003816756.1|1925506_1925956_-	dUTP diphosphatase	NA	S4TNT3	Salmonella_phage	67.2	3.7e-45
WP_062826501.1|1926996_1927947_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_168169644.1|1927964_1928150_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_003820420.1|1928394_1929108_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_019247724.1|1929230_1929458_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003816758.1|1929752_1930391_-	DedA family protein	NA	NA	NA	NA	NA
WP_010931011.1|1930499_1931534_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_005012067.1|1931530_1932481_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931012.1|1932896_1933421_-	DNA-binding protein	NA	J9Q7G7	Salmonella_phage	32.9	6.5e-09
WP_004567322.1|1933424_1933694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010931013.1|1933892_1934954_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_010931014.1|1935037_1936672_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.1	2.9e-15
WP_010931015.1|1936673_1937477_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_010931016.1|1937505_1938465_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_010931017.1|1938468_1939983_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_019248147.1|1940019_1941024_-	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_033456131.1|1941031_1941265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010931018.1|1941454_1941925_-	DUF1801 domain-containing protein	NA	NA	NA	NA	NA
WP_010931019.1|1941960_1942572_-	LysE family translocator	NA	NA	NA	NA	NA
WP_010931020.1|1942602_1943226_-	FMN-binding negative transcriptional regulator	NA	NA	NA	NA	NA
WP_010931021.1|1943306_1944839_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_023853282.1|1944873_1946091_-	MFS transporter	NA	NA	NA	NA	NA
WP_010931023.1|1946158_1947190_-	alcohol dehydrogenase catalytic domain-containing protein	NA	A0A2K9L339	Tupanvirus	27.8	1.8e-26
WP_010931024.1|1947186_1948356_-	NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_010931025.1|1948349_1949030_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010931026.1|1949191_1950034_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010931027.1|1950196_1951168_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010931028.1|1951339_1952218_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_010931029.1|1952240_1953311_-	FUSC family protein	NA	NA	NA	NA	NA
WP_005013747.1|1953351_1954302_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931030.1|1954594_1955953_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_010931031.1|1956064_1957792_+	sulfate permease	NA	NA	NA	NA	NA
WP_019247978.1|1959064_1959478_-	DUF126 domain-containing protein	NA	NA	NA	NA	NA
WP_003816890.1|1959491_1960727_-	DUF521 domain-containing protein	NA	NA	NA	NA	NA
WP_010931033.1|1960734_1961529_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_010931034.1|1961525_1962329_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.2	2.7e-30
WP_010931035.1|1962355_1963333_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010931036.1|1963361_1964933_-	amidohydrolase	NA	NA	NA	NA	NA
WP_014905903.1|1964943_1965765_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_019247976.1|1967489_1968920_-	MFS transporter	NA	NA	NA	NA	NA
WP_010931038.1|1968932_1969622_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003816876.1|1969717_1971058_-	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_019247974.1|1971059_1971317_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_010931040.1|1971670_1973263_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	33.3	1.0e-17
WP_003812368.1|1973359_1974820_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	41.3	1.6e-97
WP_010931041.1|1975042_1975654_+	DUF2239 family protein	NA	NA	NA	NA	NA
WP_005015810.1|1975650_1976601_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930573.1|1976801_1977611_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_010931070.1|1977735_1978686_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 16
NZ_CP017403	Bordetella pertussis strain 509 chromosome, complete genome	4140370	2029936	2153515	4140370	tRNA,transposase	Synechococcus_phage(10.0%)	106	NA	NA
WP_005012067.1|2029936_2030887_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_167561023.1|2030985_2032995_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	33.0	9.8e-21
WP_010930543.1|2033045_2034011_+	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_010930542.1|2034000_2036862_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	25.5	1.0e-71
WP_010930541.1|2036864_2037371_+	lipoprotein signal peptidase	NA	NA	NA	NA	NA
WP_010930540.1|2037475_2038684_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	30.0	3.8e-36
WP_033446178.1|2038685_2039624_-	membrane protein	NA	NA	NA	NA	NA
WP_010930538.1|2039785_2040259_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_076879559.1|2040255_2041206_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_004566334.1|2041316_2041757_-	DUF937 domain-containing protein	NA	NA	NA	NA	NA
WP_010930537.1|2041885_2043115_-	lytic murein transglycosylase	NA	NA	NA	NA	NA
WP_004566336.1|2043153_2043975_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_029443743.1|2044028_2045180_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_023852690.1|2045271_2045742_-	DUF1854 domain-containing protein	NA	NA	NA	NA	NA
WP_019247811.1|2048310_2050860_+	cyanophycin synthetase	NA	NA	NA	NA	NA
WP_010930533.1|2050930_2053504_+	cyanophycin synthetase	NA	NA	NA	NA	NA
WP_003813568.1|2053769_2053970_+	CsbD family protein	NA	NA	NA	NA	NA
WP_003813570.1|2054001_2054163_+	DUF1328 domain-containing protein	NA	NA	NA	NA	NA
WP_003813572.1|2054220_2054559_+	BON domain-containing protein	NA	NA	NA	NA	NA
WP_076879557.1|2054707_2055658_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_019247882.1|2056432_2057101_+	arylesterase	NA	NA	NA	NA	NA
WP_010930531.1|2057082_2059038_-	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_004568486.1|2059280_2060030_+	glycerophosphodiester phosphodiesterase	NA	A0A2H4PGQ5	Escherichia_phage	27.8	1.5e-14
WP_003816518.1|2060042_2060906_+	23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ	NA	NA	NA	NA	NA
WP_003816520.1|2060909_2062325_-	dihydrolipoyl dehydrogenase	NA	NA	NA	NA	NA
WP_010930530.1|2062458_2063187_-	redoxin family protein	NA	A0A1D8KSL1	Synechococcus_phage	56.8	9.6e-43
WP_003811035.1|2063325_2063526_-	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
WP_003816523.1|2063701_2064100_+	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_003816525.1|2064123_2065524_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	26.5	7.3e-31
WP_010930529.1|2065642_2066395_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003816527.1|2066683_2067361_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004568488.1|2067387_2068167_-	3'-5' exonuclease	NA	NA	NA	NA	NA
WP_003811022.1|2068163_2069048_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A292GJG6	Xanthomonas_phage	49.5	4.6e-15
WP_019247478.1|2069065_2069845_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	46.9	4.8e-32
WP_010930526.1|2069829_2070588_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	51.2	1.4e-68
WP_023852762.1|2070725_2071361_+	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_010930525.1|2071628_2072645_+|transposase	IS110-like element IS1663 family transposase	transposase	NA	NA	NA	NA
WP_010930524.1|2072742_2073783_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	51.3	6.1e-91
WP_003811011.1|2073917_2075210_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	36.0	1.7e-66
WP_003811007.1|2076569_2076953_+	thioredoxin family protein	NA	V9SJ74	Achromobacter_phage	25.8	8.1e-09
WP_010930523.1|2076970_2077558_-	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	35.8	4.7e-16
WP_010930522.1|2077595_2078546_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930521.1|2079530_2080304_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_010930520.1|2080300_2081299_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010930519.1|2081383_2082160_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.2	1.2e-30
WP_010930518.1|2082314_2083919_-	ABC-F family ATPase	NA	A0A1V0SKJ1	Klosneuvirus	28.9	1.2e-53
WP_003816541.1|2084299_2085424_+	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003810992.1|2085550_2086174_+	TRAP transporter small permease subunit	NA	NA	NA	NA	NA
WP_010930517.1|2086170_2088072_+	TRAP transporter large permease subunit	NA	NA	NA	NA	NA
WP_010930516.1|2088120_2088915_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_010930515.1|2088927_2089929_-	muramoyltetrapeptide carboxypeptidase	NA	NA	NA	NA	NA
WP_010930514.1|2089925_2090375_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	38.2	2.0e-06
WP_010930513.1|2090424_2091273_-	hydrolase	NA	NA	NA	NA	NA
WP_005012808.1|2091436_2092387_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_019247780.1|2092419_2092962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013747.1|2093005_2093956_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930511.1|2094111_2094438_-	cation:proton antiporter	NA	NA	NA	NA	NA
WP_033446177.1|2094434_2094716_-	K+/H+ antiporter subunit F	NA	NA	NA	NA	NA
WP_023852885.1|2094715_2095192_-	Na+/H+ antiporter subunit E	NA	NA	NA	NA	NA
WP_004568496.1|2095191_2096820_-	monovalent cation/H+ antiporter subunit D	NA	NA	NA	NA	NA
WP_003810969.1|2096816_2097161_-	Na+/H+ antiporter subunit C	NA	NA	NA	NA	NA
WP_010930509.1|2097160_2100094_-	monovalent cation/H+ antiporter subunit A	NA	NA	NA	NA	NA
WP_065465821.1|2101252_2102203_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003811452.1|2102301_2102598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010930508.1|2102704_2103622_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010930507.1|2103626_2104340_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010930506.1|2104353_2105325_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010930505.1|2107074_2107425_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_010930504.1|2107428_2108616_+	MFS transporter	NA	NA	NA	NA	NA
WP_010930503.1|2109054_2109777_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	68.2	1.3e-87
WP_005013747.1|2110070_2111021_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_019249376.1|2111017_2111446_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003811538.1|2112847_2113810_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010930502.1|2113925_2114879_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010930501.1|2114888_2115881_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010930500.1|2115932_2116688_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010930499.1|2116752_2117442_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_019248077.1|2117663_2118614_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_010930497.1|2118644_2119841_+	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_019247910.1|2119831_2120611_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_019247909.1|2120723_2121650_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010930494.1|2121735_2122680_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010930493.1|2122657_2123527_-	TauD/TfdA family dioxygenase	NA	NA	NA	NA	NA
WP_010930492.1|2123770_2124394_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_019247905.1|2124708_2125008_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_023995112.1|2125021_2128096_-	autotransporter SphB2	NA	NA	NA	NA	NA
WP_010930489.1|2128225_2128900_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_019247865.1|2128892_2130707_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_010930487.1|2130760_2131708_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|2131812_2132763_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_023852967.1|2133315_2134941_-	arylsulfatase	NA	A0A2P0VMN7	Tetraselmis_virus	52.2	2.0e-149
WP_010930475.1|2134990_2136025_-	haloacid dehalogenase-like hydrolase	NA	NA	NA	NA	NA
WP_010930476.1|2136027_2137374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010930477.1|2137370_2138885_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_010930478.1|2138875_2139886_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_010930479.1|2140359_2141301_-	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_010930480.1|2141309_2142278_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_010930481.1|2143817_2144786_+	transporter	NA	NA	NA	NA	NA
WP_010930482.1|2144963_2145953_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010926609.1|2145999_2146758_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010930483.1|2146947_2147685_+	TerC family protein	NA	A0A0S4KZH7	Pseudomonas_phage	46.6	4.1e-41
WP_005012808.1|2147783_2148734_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003816696.1|2148918_2149701_+	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	25.8	2.0e-09
WP_003810743.1|2149694_2150396_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_003810741.1|2150635_2151238_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013747.1|2152564_2153515_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 17
NZ_CP017403	Bordetella pertussis strain 509 chromosome, complete genome	4140370	2222270	2297351	4140370	transposase	Moraxella_phage(16.67%)	46	NA	NA
WP_005012067.1|2222270_2223221_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012067.1|2223319_2224270_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930622.1|2224373_2225405_+	peptidase C45	NA	NA	NA	NA	NA
WP_010930621.1|2225418_2229042_-	5-oxoprolinase	NA	NA	NA	NA	NA
WP_010930620.1|2229120_2229633_-	winged helix DNA-binding protein	NA	NA	NA	NA	NA
WP_019247163.1|2230807_2231509_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019248349.1|2231529_2232495_+	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010930617.1|2232508_2233000_+	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_010930616.1|2234556_2235531_+	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010930615.1|2235537_2236038_+	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_010930614.1|2237355_2239110_-	filamentous hemagglutinin transporter protein FhaC	NA	NA	NA	NA	NA
WP_050833422.1|2239102_2240233_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_010930612.1|2240213_2242835_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_010930611.1|2242897_2243632_-	molecular chaperone FimB	NA	NA	NA	NA	NA
WP_019247159.1|2243881_2244319_-	protein FimA	NA	NA	NA	NA	NA
WP_039250273.1|2244394_2255161_-	filamentous hemagglutinin/adhesin	NA	A0A0R6PJK4	Moraxella_phage	32.5	3.6e-29
WP_010930609.1|2255587_2256217_+	virulence factors two-component system response regulator BvgA	NA	NA	NA	NA	NA
WP_014486076.1|2256225_2259942_+	virulence factors two-component system sensor histidine kinase BvgS	NA	A0A1V0SGX0	Hokovirus	32.0	4.2e-33
WP_003816497.1|2259985_2260861_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_010930607.1|2260994_2261789_-	putative hydro-lyase	NA	NA	NA	NA	NA
WP_010930606.1|2261846_2263196_-	amidase	NA	NA	NA	NA	NA
WP_005013747.1|2266381_2267332_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003811701.1|2267448_2268168_+	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010930605.1|2268340_2269327_+	DctP family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_050833495.1|2269327_2269810_+	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_003811706.1|2269813_2271097_+	TRAP transporter large permease	NA	NA	NA	NA	NA
WP_003811709.1|2271093_2272032_+	citrate lyase subunit beta	NA	NA	NA	NA	NA
WP_010930603.1|2272028_2273738_+	thiamine pyrophosphate-binding protein	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	27.3	5.9e-35
WP_010930602.1|2273747_2274995_+	Zn-dependent hydrolase	NA	NA	NA	NA	NA
WP_003811716.1|2276605_2277895_-	Glu/Leu/Phe/Val dehydrogenase	NA	NA	NA	NA	NA
WP_020699606.1|2279032_2279791_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.9	6.7e-31
WP_010930601.1|2280467_2281211_-	glutamine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010930600.1|2281285_2282026_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010930599.1|2282221_2283058_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_010930598.1|2283108_2283879_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_010930597.1|2283928_2284981_-	DNA polymerase III subunit delta'	NA	NA	NA	NA	NA
WP_003811733.1|2284977_2285604_-	dTMP kinase	NA	A0A1L2BX49	Bacteriophage	35.1	1.6e-22
WP_010930596.1|2285600_2286635_-	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_010930595.1|2286813_2287830_+	folate-binding protein YgfZ	NA	NA	NA	NA	NA
WP_005012067.1|2287928_2288879_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012067.1|2288977_2289928_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930797.1|2292668_2293958_-	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_010930798.1|2294076_2294514_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_010930799.1|2294557_2295766_-	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_003810867.1|2295912_2296377_+	GatB/YqeY domain-containing protein	NA	A0A0K2FLI9	Brevibacillus_phage	32.4	3.9e-05
WP_005015810.1|2296400_2297351_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 18
NZ_CP017403	Bordetella pertussis strain 509 chromosome, complete genome	4140370	2494639	2557399	4140370	tRNA,transposase	Cedratvirus(33.33%)	51	NA	NA
WP_010929577.1|2494639_2495590_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930742.1|2496789_2497740_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930661.1|2499445_2500411_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010930660.1|2501165_2503274_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_061363663.1|2503284_2504691_-	ferric reductase	NA	NA	NA	NA	NA
WP_010930525.1|2506763_2507780_-|transposase	IS110-like element IS1663 family transposase	transposase	NA	NA	NA	NA
WP_010929893.1|2507971_2508589_-	isochorismatase family protein	NA	NA	NA	NA	NA
WP_010929892.1|2508604_2509636_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010929891.1|2510502_2511255_-	maleate isomerase	NA	NA	NA	NA	NA
WP_010930658.1|2511555_2512707_+	NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_029443796.1|2512816_2513305_+	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_010930656.1|2515748_2516519_-	ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	29.2	3.3e-09
WP_010930655.1|2516515_2517292_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	29.5	1.3e-13
WP_019248318.1|2517288_2519238_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_019248317.1|2519329_2520538_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005012067.1|2520584_2521535_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003820159.1|2521902_2522388_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_010930652.1|2522732_2522969_-	membrane protein	NA	NA	NA	NA	NA
WP_010930651.1|2523177_2525163_+	poly-beta-1,6 N-acetyl-D-glucosamine export porin PgaA	NA	NA	NA	NA	NA
WP_010930650.1|2525168_2527274_+	poly-beta-1,6-N-acetyl-D-glucosamine N-deacetylase PgaB	NA	NA	NA	NA	NA
WP_050833431.1|2527277_2528537_+	poly-beta-1,6 N-acetyl-D-glucosamine synthase	NA	NA	NA	NA	NA
WP_015041299.1|2528517_2529156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010930648.1|2529160_2530273_-	alkene reductase	NA	NA	NA	NA	NA
WP_033446196.1|2530325_2530619_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_010930647.1|2530832_2531282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003820150.1|2531288_2531624_+	MaoC family dehydratase	NA	NA	NA	NA	NA
WP_010930646.1|2531637_2532114_+	MaoC family dehydratase	NA	NA	NA	NA	NA
WP_003820147.1|2532117_2532510_+	RidA family protein	NA	NA	NA	NA	NA
WP_033461849.1|2532578_2533535_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010930644.1|2533535_2535656_+	acetate--CoA ligase family protein	NA	NA	NA	NA	NA
WP_019247348.1|2535664_2536369_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010930643.1|2536527_2537556_+	NADH:flavin oxidoreductase	NA	NA	NA	NA	NA
WP_010930642.1|2537962_2539054_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.6	9.3e-26
WP_010930641.1|2539050_2539854_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003810039.1|2539850_2540678_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_010930640.1|2542315_2543440_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010930639.1|2543551_2544505_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003820136.1|2544509_2545148_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010930638.1|2545235_2546003_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_003820133.1|2546017_2546821_-	aspartate dehydrogenase	NA	NA	NA	NA	NA
WP_010930636.1|2546817_2547627_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_004568037.1|2547623_2548607_-	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003820128.1|2548635_2549904_-	TRAP transporter large permease	NA	NA	NA	NA	NA
WP_003810020.1|2549906_2550431_-	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_010930635.1|2550427_2551369_-	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_003810016.1|2551378_2551693_-	NIPSNAP family protein	NA	NA	NA	NA	NA
WP_010930634.1|2551734_2552235_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_010929632.1|2552578_2553595_+|transposase	IS110-like element IS1663 family transposase	transposase	NA	NA	NA	NA
WP_010930633.1|2553988_2555254_-	aspartate kinase	NA	NA	NA	NA	NA
WP_029443761.1|2555353_2556388_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_010930742.1|2556448_2557399_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 19
NZ_CP017403	Bordetella pertussis strain 509 chromosome, complete genome	4140370	2633314	2698938	4140370	tRNA,transposase	Planktothrix_phage(33.33%)	59	NA	NA
WP_005012067.1|2633314_2634265_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003812577.1|2634363_2635134_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.5	8.3e-29
WP_010930397.1|2635130_2635802_-	ectoine/hydroxyectoine ABC transporter permease subunit EhuD	NA	NA	NA	NA	NA
WP_003812581.1|2635798_2636440_-	ectoine/hydroxyectoine ABC transporter permease subunit EhuC	NA	NA	NA	NA	NA
WP_010930396.1|2636452_2637373_-	ectoine/hydroxyectoine ABC transporter substrate-binding protein EhuB	NA	NA	NA	NA	NA
WP_010930395.1|2637533_2638694_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010930394.1|2638735_2639686_-	ornithine cyclodeaminase family protein	NA	NA	NA	NA	NA
WP_010930393.1|2640284_2640509_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162832303.1|2640673_2642407_-	phosphoenolpyruvate--protein phosphotransferase	NA	NA	NA	NA	NA
WP_003812598.1|2642489_2642759_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_003812601.1|2642874_2643273_-	PTS mannose transporter subunit IIA	NA	NA	NA	NA	NA
WP_010930391.1|2643283_2644240_-	glutathione synthase	NA	NA	NA	NA	NA
WP_033446215.1|2644376_2644922_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	29.9	9.1e-14
WP_003812608.1|2644942_2646892_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.0	4.1e-125
WP_033453939.1|2647279_2648056_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_003812612.1|2648061_2648454_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013747.1|2648875_2649826_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930389.1|2649822_2650920_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.3	3.5e-20
WP_076879548.1|2650951_2651902_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930388.1|2652381_2653038_-	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_010930387.1|2653052_2654720_-	TRAP transporter large permease subunit	NA	NA	NA	NA	NA
WP_010930386.1|2654722_2655352_-	TRAP transporter small permease subunit	NA	NA	NA	NA	NA
WP_014486072.1|2655563_2656658_-	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010930384.1|2656802_2657615_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_010930383.1|2657618_2659202_-	membrane protein	NA	NA	NA	NA	NA
WP_010930382.1|2659372_2660503_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_010930381.1|2660689_2661766_-	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_010930380.1|2661847_2662498_-	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_010930379.1|2662512_2663916_-	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_004567445.1|2664199_2665018_-	solute-binding protein	NA	NA	NA	NA	NA
WP_010930378.1|2665014_2665719_-	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.0	2.6e-13
WP_010930377.1|2666618_2667734_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004567447.1|2667767_2668142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010930376.1|2668164_2669322_-	formate dehydrogenase subunit gamma	NA	NA	NA	NA	NA
WP_003812666.1|2669334_2669568_-	lipoprotein	NA	NA	NA	NA	NA
WP_019247523.1|2670202_2673172_-	formate dehydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_023853518.1|2673186_2673396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050833418.1|2673547_2674177_-	cytochrome c oxidase subunit II	NA	NA	NA	NA	NA
WP_023994978.1|2674173_2676231_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_010930372.1|2676287_2676968_-	DUF3306 domain-containing protein	NA	NA	NA	NA	NA
WP_003820494.1|2676964_2677525_-	DUF3305 domain-containing protein	NA	NA	NA	NA	NA
WP_004567450.1|2677531_2678629_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_010930371.1|2678781_2679375_+	molybdenum cofactor guanylyltransferase MobA	NA	NA	NA	NA	NA
WP_010930370.1|2679371_2680664_+	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_003812685.1|2680677_2681220_+	molybdopterin-guanine dinucleotide biosynthesis protein B	NA	NA	NA	NA	NA
WP_010930369.1|2681229_2682066_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_003820487.1|2682099_2683161_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	42.8	2.9e-80
WP_019247210.1|2683202_2684255_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_019247209.1|2684270_2684573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012808.1|2684714_2685665_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930368.1|2685843_2687538_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_003809599.1|2687534_2688620_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.7	6.4e-27
WP_010930367.1|2688667_2689567_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003809593.1|2689577_2690222_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_010930366.1|2691243_2694486_-	carbamoyl-phosphate synthase large subunit	NA	NA	NA	NA	NA
WP_023852833.1|2694496_2695651_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	35.4	3.3e-53
WP_010930364.1|2695877_2696840_+	transaldolase	NA	H6WFR1	Cyanophage	29.2	7.5e-11
WP_076879547.1|2696938_2697889_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929577.1|2697987_2698938_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 20
NZ_CP017403	Bordetella pertussis strain 509 chromosome, complete genome	4140370	2914201	2973986	4140370	tRNA,transposase	Oenococcus_phage(33.33%)	50	NA	NA
WP_005012067.1|2914201_2915152_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930231.1|2915354_2916344_+	succinylglutamate desuccinylase	NA	NA	NA	NA	NA
WP_010930230.1|2916427_2916781_+	NirD/YgiW/YdeI family stress tolerance protein	NA	NA	NA	NA	NA
WP_010930229.1|2916858_2917467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003811662.1|2919140_2919719_-	amino acid synthesis family protein	NA	NA	NA	NA	NA
WP_003811660.1|2919743_2920697_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010930228.1|2920736_2921654_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_033446252.1|2921775_2922702_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010930226.1|2922709_2923456_-	aldolase	NA	NA	NA	NA	NA
WP_010930225.1|2923782_2924724_+	LD-carboxypeptidase	NA	NA	NA	NA	NA
WP_010930224.1|2924950_2926648_-	sodium:solute symporter family protein	NA	NA	NA	NA	NA
WP_010930223.1|2927082_2928504_-	MFS transporter	NA	NA	NA	NA	NA
WP_010930222.1|2928657_2929437_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_019247966.1|2929561_2930440_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010930220.1|2930545_2931670_+	mandelate racemase/muconate lactonizing enzyme family protein	NA	Q6A202	Oenococcus_phage	28.3	1.5e-31
WP_003811636.1|2931715_2932678_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010930219.1|2932670_2933525_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_003811632.1|2933632_2934043_+	VOC family protein	NA	NA	NA	NA	NA
WP_005013747.1|2934039_2934990_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003813574.1|2935088_2935970_-	PhzF family phenazine biosynthesis protein	NA	NA	NA	NA	NA
WP_003821443.1|2936047_2937427_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_010930218.1|2937465_2938311_-	membrane protein	NA	NA	NA	NA	NA
WP_033451623.1|2938326_2938641_-	cupredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_010930217.1|2938673_2939210_-	membrane protein	NA	NA	NA	NA	NA
WP_003813585.1|2939382_2939958_-	polyhydroxyalkanoate synthesis repressor PhaR	NA	NA	NA	NA	NA
WP_003813586.1|2940060_2940798_-	acetoacetyl-CoA reductase	NA	NA	NA	NA	NA
WP_010930216.1|2940865_2942503_-	class I poly(R)-hydroxyalkanoic acid synthase	NA	NA	NA	NA	NA
WP_019247742.1|2942610_2943366_-	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
WP_010930214.1|2943353_2944316_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_033446255.1|2944423_2945218_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_010930213.1|2945279_2947355_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	30.0	2.4e-75
WP_010930212.1|2947519_2949895_+	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_010930211.1|2949975_2951331_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_010930742.1|2951340_2952291_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_162835035.1|2952439_2952763_-	DUF3325 family protein	NA	NA	NA	NA	NA
WP_033447956.1|2954410_2954692_-	DUF3649 domain-containing protein	NA	NA	NA	NA	NA
WP_003813609.1|2954835_2957313_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_003813612.1|2957406_2958369_-	DUF4880 domain-containing protein	NA	NA	NA	NA	NA
WP_010930209.1|2958361_2958895_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_010930208.1|2959616_2960567_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003813618.1|2961034_2961757_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010930207.1|2961811_2962795_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005012067.1|2962924_2963875_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003813621.1|2963871_2964774_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010930206.1|2964861_2965620_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_023853245.1|2965632_2966724_-	cell division protein ZapE	NA	NA	NA	NA	NA
WP_003813626.1|2966821_2968249_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.1	2.1e-41
WP_010930204.1|2968478_2969693_-	2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase	NA	NA	NA	NA	NA
WP_003813631.1|2969738_2972609_-	2-oxoglutarate dehydrogenase E1 component	NA	NA	NA	NA	NA
WP_005012067.1|2973035_2973986_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 21
NZ_CP017403	Bordetella pertussis strain 509 chromosome, complete genome	4140370	2982717	3054738	4140370	tRNA,transposase,holin	Planktothrix_phage(20.0%)	54	NA	NA
WP_005012067.1|2982717_2983668_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003812405.1|2983714_2984269_-	transcription elongation factor GreB	NA	NA	NA	NA	NA
WP_003816844.1|2984336_2985182_-	PHP domain-containing protein	NA	NA	NA	NA	NA
WP_019248398.1|2985251_2986220_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_029443925.1|2986219_2988694_-	DNA internalization-related competence protein ComEC/Rec2	NA	NA	NA	NA	NA
WP_010930196.1|2988866_2992793_-	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_019248079.1|2993528_2996759_-	autotransporter SphB3	NA	NA	NA	NA	NA
WP_010928340.1|2997040_2997868_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_003812422.1|2997901_2998597_-	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	38.6	7.0e-35
WP_019247537.1|2998589_2999870_-	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_023853218.1|2999915_3000857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010930191.1|3000838_3002539_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.3	1.3e-50
WP_010926448.1|3002641_3003745_+	peptide chain release factor 2	NA	NA	NA	NA	NA
WP_010926447.1|3003775_3004531_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010930190.1|3004537_3006058_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.0	1.2e-82
WP_010930189.1|3006100_3006403_+	membrane protein	NA	NA	NA	NA	NA
WP_003812436.1|3006399_3007032_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010930188.1|3007110_3008976_-	long-chain fatty acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	23.3	9.3e-50
WP_020699602.1|3008972_3009767_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	23.3	1.2e-11
WP_010930186.1|3009795_3010911_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010930185.1|3011815_3012694_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_019248175.1|3012693_3013518_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	22.7	1.0e-08
WP_005012067.1|3013685_3014636_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_019248112.1|3014848_3017698_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_010930182.1|3017679_3018408_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_010930180.1|3020009_3020381_-	DUF2069 domain-containing protein	NA	NA	NA	NA	NA
WP_003812701.1|3020398_3021712_+	YihY family inner membrane protein	NA	NA	NA	NA	NA
WP_003812703.1|3021748_3022207_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_005012067.1|3022319_3023270_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930178.1|3023266_3024280_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_003812707.1|3024419_3025406_+	homoserine kinase	NA	NA	NA	NA	NA
WP_161633091.1|3025764_3026472_-	DUF192 domain-containing protein	NA	NA	NA	NA	NA
WP_003809618.1|3028153_3028756_-	YhbY family RNA-binding protein	NA	NA	NA	NA	NA
WP_010930175.1|3028774_3029407_+	RlmE family RNA methyltransferase	NA	NA	NA	NA	NA
WP_162096758.1|3029451_3029703_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010930174.1|3029644_3031531_+	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	M4QMW8	Micromonas_pusilla_virus	41.5	1.4e-109
WP_010930173.1|3031549_3032392_+	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	32.5	3.2e-26
WP_003819875.1|3032388_3033747_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_003809629.1|3033967_3034762_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_010930172.1|3034992_3036486_-	exopolyphosphatase	NA	NA	NA	NA	NA
WP_010930171.1|3036721_3038803_+	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_014486066.1|3038997_3040038_+	phosphate ABC transporter substrate-binding protein PstS	NA	M4QHS4	Cyanophage	40.2	2.1e-51
WP_010930169.1|3040172_3041189_+	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_003809638.1|3041210_3042068_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_010930167.1|3042112_3042889_+	phosphate ABC transporter ATP-binding protein PstB	NA	G9BWD6	Planktothrix_phage	28.7	4.3e-17
WP_005012067.1|3043256_3044207_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013747.1|3044305_3045256_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003809441.1|3045282_3045747_-	barstar family protein	NA	NA	NA	NA	NA
WP_010930165.1|3049358_3050231_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010930164.1|3050273_3051428_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_010930163.1|3051462_3052293_-	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_023853525.1|3052376_3053921_+	4-hydroxy-3-polyprenylbenzoate decarboxylase	NA	NA	NA	NA	NA
WP_010930161.1|3053963_3054323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003819794.1|3054324_3054738_-|holin	phage holin family protein	holin	NA	NA	NA	NA
>prophage 22
NZ_CP017403	Bordetella pertussis strain 509 chromosome, complete genome	4140370	3060713	3117898	4140370	tRNA,transposase	uncultured_Mediterranean_phage(37.5%)	53	NA	NA
WP_010930525.1|3060713_3061730_-|transposase	IS110-like element IS1663 family transposase	transposase	NA	NA	NA	NA
WP_010930157.1|3062065_3062707_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_003809423.1|3062797_3064234_-	D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase	NA	NA	NA	NA	NA
WP_023853534.1|3064391_3065465_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_010930155.1|3065461_3066598_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	44.4	1.9e-85
WP_003809416.1|3066742_3067087_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	40.4	1.0e-10
WP_010930154.1|3067153_3069034_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_003809411.1|3069083_3070019_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	35.5	3.0e-41
WP_010930525.1|3070350_3071367_+|transposase	IS110-like element IS1663 family transposase	transposase	NA	NA	NA	NA
WP_015041211.1|3072304_3073732_+|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_010930151.1|3073728_3074751_+	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	45.4	8.7e-50
WP_003809396.1|3074740_3075214_+	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_010930149.1|3075354_3076242_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_014486064.1|3076238_3077882_+	apolipoprotein N-acyltransferase	NA	NA	NA	NA	NA
WP_003819773.1|3077878_3078886_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_010930525.1|3079716_3080733_+|transposase	IS110-like element IS1663 family transposase	transposase	NA	NA	NA	NA
WP_003817162.1|3080832_3081465_-	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_003811911.1|3081473_3081863_-	chemotaxis protein CheY	NA	Q56AR1	Bacillus_thuringiensis_phage	33.3	5.7e-10
WP_010930146.1|3081915_3082968_-	chemotaxis response regulator protein-glutamate methylesterase	NA	NA	NA	NA	NA
WP_010930145.1|3083831_3085538_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	41.7	1.4e-12
WP_003811919.1|3085611_3086112_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_010930144.1|3086126_3088184_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_019247393.1|3088210_3088504_-	response regulator	NA	NA	NA	NA	NA
WP_003817154.1|3088605_3089553_-	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_003811927.1|3089565_3090441_-	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_003811929.1|3090561_3091122_-	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_010930143.1|3091156_3091480_-	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_003811933.1|3091915_3092653_+	RNA polymerase sigma factor FliA	NA	NA	NA	NA	NA
WP_005012067.1|3092951_3093902_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003809486.1|3094145_3094409_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_003819817.1|3094482_3094764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010930142.1|3094780_3095641_-	M23 family metallopeptidase	NA	A0A292GJG6	Xanthomonas_phage	36.1	2.6e-15
WP_003809479.1|3095637_3095973_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010930141.1|3096026_3096677_-	molybdopterin adenylyltransferase	NA	NA	NA	NA	NA
WP_010930800.1|3096882_3097833_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_033461972.1|3097916_3099386_+	inorganic phosphate transporter	NA	NA	NA	NA	NA
WP_019247197.1|3099406_3100351_-	AzlC family ABC transporter permease	NA	NA	NA	NA	NA
WP_003809467.1|3100396_3100714_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010930139.1|3100716_3101655_-	DnaJ domain-containing protein	NA	A0A0P0YMJ9	Yellowstone_lake_phycodnavirus	24.1	5.6e-11
WP_003819814.1|3101832_3102318_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_010930138.1|3102336_3102885_+	diguanylate cyclase	NA	NA	NA	NA	NA
WP_023994624.1|3102916_3103069_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023853531.1|3103161_3104295_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930137.1|3104398_3105040_+	glutathione transferase	NA	NA	NA	NA	NA
WP_003809454.1|3107535_3108474_+	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_010930135.1|3108499_3109690_+	acetate kinase	NA	NA	NA	NA	NA
WP_010930134.1|3109686_3110460_+	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_010930133.1|3110489_3111683_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_010930132.1|3111800_3112811_-	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_010930131.1|3112828_3114865_-	transketolase	NA	NA	NA	NA	NA
WP_010930130.1|3115059_3115800_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_005012067.1|3115898_3116849_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012808.1|3116947_3117898_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 23
NZ_CP017403	Bordetella pertussis strain 509 chromosome, complete genome	4140370	3179060	3232690	4140370	transposase	Staphylococcus_phage(28.57%)	49	NA	NA
WP_005013747.1|3179060_3180011_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930094.1|3180282_3180864_+	OmpA family protein	NA	NA	NA	NA	NA
WP_010930093.1|3180989_3181715_+	bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase	NA	NA	NA	NA	NA
WP_010930092.1|3181711_3182389_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_010930091.1|3182604_3183786_+	MFS transporter	NA	NA	NA	NA	NA
WP_010930090.1|3184558_3184741_+	type II toxin-antitoxin system HicA family toxin	NA	A0A1L2JY37	Aeribacillus_phage	56.1	3.7e-12
WP_005012808.1|3184770_3185721_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_004566317.1|3185850_3186243_+	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0R6PJ17	Moraxella_phage	45.0	4.8e-25
WP_003821497.1|3186519_3187431_-	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	27.6	4.4e-05
WP_010930088.1|3187555_3188530_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010930087.1|3188564_3188924_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010930086.1|3190170_3190593_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010930085.1|3190597_3191581_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010930084.1|3191592_3193251_+	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	24.9	2.3e-20
WP_003821488.1|3193344_3193920_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_010930083.1|3193944_3194934_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_029443845.1|3195069_3196047_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_004566323.1|3196172_3197246_+	TauD/TfdA family dioxygenase	NA	NA	NA	NA	NA
WP_010930081.1|3197323_3198184_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_003813501.1|3198238_3199135_-	TrmB family transcriptional regulator	NA	NA	NA	NA	NA
WP_010930080.1|3199176_3199992_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003821482.1|3200105_3201338_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162892901.1|3201410_3202565_+	tricarballylate utilization 4Fe-4S protein TcuB	NA	NA	NA	NA	NA
WP_010930077.1|3202585_3203989_+	FAD-dependent tricarballylate dehydrogenase TcuA	NA	NA	NA	NA	NA
WP_010930076.1|3204038_3205493_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_162096761.1|3205597_3207010_-	MmgE/PrpD family protein	NA	NA	NA	NA	NA
WP_003821476.1|3207921_3208749_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_010930074.1|3208745_3209618_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003821473.1|3209637_3210612_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010930073.1|3211889_3212441_+	decarboxylase	NA	NA	NA	NA	NA
WP_010929626.1|3212528_3213479_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_003810865.1|3213577_3214663_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_010930072.1|3214760_3215171_+	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_003810859.1|3215786_3217700_+	S9 family peptidase	NA	NA	NA	NA	NA
WP_010930070.1|3220450_3221185_-	serine/threonine protein phosphatase	NA	A0A2H4J0P0	uncultured_Caudovirales_phage	49.6	3.8e-63
WP_003810851.1|3221348_3222530_+	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_003810850.1|3222526_3222739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003810847.1|3222735_3223716_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_010930068.1|3223761_3224589_-	oxidoreductase	NA	A0A2H4PQR8	Staphylococcus_phage	47.4	1.7e-67
WP_023852913.1|3224738_3226553_+	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	27.9	5.7e-44
WP_003810840.1|3226607_3226991_+	Rieske 2Fe-2S domain-containing protein	NA	NA	NA	NA	NA
WP_005012067.1|3226987_3227938_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003810839.1|3228049_3228301_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003810837.1|3228494_3228710_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003810835.1|3228806_3229925_-	mannose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_003810832.1|3230044_3230257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010930064.1|3230416_3230638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|3230690_3231641_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012067.1|3231739_3232690_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 24
NZ_CP017403	Bordetella pertussis strain 509 chromosome, complete genome	4140370	3253445	3325447	4140370	transposase,holin	Acinetobacter_phage(25.0%)	59	NA	NA
WP_005012067.1|3253445_3254396_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930050.1|3254494_3255151_-	DUF4136 domain-containing protein	NA	NA	NA	NA	NA
WP_010930049.1|3255298_3258007_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	24.0	2.8e-15
WP_003813068.1|3258016_3259036_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	35.7	1.5e-49
WP_010930742.1|3259032_3259983_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_003813893.1|3260081_3260570_-	2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase	NA	NA	NA	NA	NA
WP_003813895.1|3260566_3261250_-	2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_010926959.1|3261279_3264735_+	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_010930046.1|3264770_3265631_+	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_010930045.1|3265759_3266677_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014905892.1|3266814_3267795_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_003813904.1|3267854_3269645_+	acetolactate synthase large subunit	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	26.1	2.0e-25
WP_010930042.1|3269641_3270418_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010930041.1|3270427_3270946_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003813909.1|3271058_3273329_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_010930039.1|3273540_3275772_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_003813915.1|3276072_3276402_-	DUF2818 family protein	NA	NA	NA	NA	NA
WP_003813916.1|3276418_3277903_-	NADH-quinone oxidoreductase subunit NuoN	NA	NA	NA	NA	NA
WP_019247436.1|3277913_3279416_-	NADH-quinone oxidoreductase subunit M	NA	NA	NA	NA	NA
WP_010930037.1|3279412_3281425_-	NADH-quinone oxidoreductase subunit L	NA	NA	NA	NA	NA
WP_003813920.1|3281442_3281751_-	NADH-quinone oxidoreductase subunit NuoK	NA	NA	NA	NA	NA
WP_003813921.1|3281747_3282395_-	NADH-quinone oxidoreductase subunit J	NA	NA	NA	NA	NA
WP_003813924.1|3282412_3282901_-	NADH-quinone oxidoreductase subunit NuoI	NA	NA	NA	NA	NA
WP_003813926.1|3282922_3283996_-	NADH-quinone oxidoreductase subunit NuoH	NA	NA	NA	NA	NA
WP_010930036.1|3283995_3286323_-	NADH-quinone oxidoreductase subunit G	NA	NA	NA	NA	NA
WP_003813930.1|3286338_3287706_-	NADH-quinone oxidoreductase subunit NuoF	NA	NA	NA	NA	NA
WP_003813932.1|3287702_3288197_-	NADH-quinone oxidoreductase subunit NuoE	NA	NA	NA	NA	NA
WP_010930035.1|3288242_3289499_-	NADH-quinone oxidoreductase subunit D	NA	NA	NA	NA	NA
WP_023997298.1|3289501_3290122_-	NADH-quinone oxidoreductase subunit C	NA	NA	NA	NA	NA
WP_003813941.1|3290199_3290676_-	NADH-quinone oxidoreductase subunit B	NA	NA	NA	NA	NA
WP_003813943.1|3290712_3291072_-	NADH-quinone oxidoreductase subunit A	NA	NA	NA	NA	NA
WP_010930034.1|3291260_3292418_-	porin	NA	NA	NA	NA	NA
WP_005012067.1|3292730_3293681_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_033446246.1|3293653_3294253_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003813949.1|3294254_3294689_+	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_003813951.1|3294685_3295120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003813952.1|3295103_3295907_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_003813954.1|3295923_3296739_-	DNA repair exonuclease	NA	NA	NA	NA	NA
WP_020699608.1|3296735_3297551_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_010930033.1|3297697_3298399_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003813960.1|3298426_3300385_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	30.3	8.0e-28
WP_005013747.1|3300467_3301418_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930032.1|3301638_3302307_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_010930031.1|3302430_3303537_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_010930029.1|3306648_3308142_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_010926969.1|3308156_3308828_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_010930028.1|3308871_3309324_-	azurin	NA	NA	NA	NA	NA
WP_010930027.1|3309506_3310154_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_023853163.1|3310257_3312306_+	hydantoinase/oxoprolinase family protein	NA	NA	NA	NA	NA
WP_010930025.1|3312302_3314315_+	hydantoinase B/oxoprolinase family protein	NA	NA	NA	NA	NA
WP_010930024.1|3314340_3315675_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_003813981.1|3315783_3316776_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_003813982.1|3316842_3318927_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_019248051.1|3318951_3319923_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010930022.1|3320051_3321083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010930021.1|3321086_3322238_-	cystathionine beta-lyase	NA	NA	NA	NA	NA
WP_010930020.1|3322441_3323332_+	transcriptional regulator LrhA	NA	NA	NA	NA	NA
WP_003813987.1|3323409_3324234_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010930158.1|3324430_3325447_-|transposase	IS110-like element IS1663 family transposase	transposase	NA	NA	NA	NA
>prophage 25
NZ_CP017403	Bordetella pertussis strain 509 chromosome, complete genome	4140370	3333081	3385033	4140370	terminase,tRNA,transposase,holin	Synechococcus_phage(15.38%)	50	NA	NA
WP_010930018.1|3333081_3335313_-|holin	choline BCCT transporter BetT	holin	NA	NA	NA	NA
WP_010930017.1|3336100_3336547_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_003813996.1|3336568_3337315_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_003813997.1|3337458_3338436_-	NAD(P)H-quinone oxidoreductase	NA	NA	NA	NA	NA
WP_010930016.1|3339069_3339681_+	PIN domain-containing protein	NA	K4HZX4	Acidithiobacillus_phage	32.5	3.3e-12
WP_003813999.1|3339674_3340892_-	threonine ammonia-lyase	NA	NA	NA	NA	NA
WP_005013747.1|3341032_3341983_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814000.1|3341979_3342699_-	lipoprotein	NA	NA	NA	NA	NA
WP_003821234.1|3342819_3344979_-	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
WP_003814002.1|3345069_3345339_-	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_005019401.1|3345427_3345634_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003814003.1|3345632_3346160_+	lipoprotein	NA	NA	NA	NA	NA
WP_003814004.1|3346178_3346958_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_010930015.1|3347125_3348142_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_003814006.1|3348214_3348706_-	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_019248169.1|3348716_3350432_-	acetolactate synthase 3 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	30.1	9.1e-60
WP_010931443.1|3352974_3353577_-	hypothetical protein	NA	R9TF81	Synechococcus_phage	43.6	7.9e-27
WP_010931444.1|3353699_3353942_-	hypothetical protein	NA	A0A0H5AUE5	Pseudomonas_phage	53.2	5.6e-16
WP_010931445.1|3353947_3355003_-	hypothetical protein	NA	A0A0H5BBX3	Pseudomonas_phage	50.6	2.6e-97
WP_010931446.1|3355031_3356450_-	DUF4055 domain-containing protein	NA	R9TF43	Synechococcus_phage	42.1	2.2e-99
WP_010931447.1|3356452_3357730_-|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	64.7	2.4e-150
WP_019247942.1|3357716_3358202_-|transposase	transposase	transposase	C7U0W1	Enterobacteria_phage	61.5	7.3e-39
WP_005012067.1|3358841_3359792_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_161633094.1|3360048_3360738_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023853179.1|3360730_3360982_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_010931451.1|3361536_3362148_+	S24 family peptidase	NA	NA	NA	NA	NA
WP_019247378.1|3362219_3362426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|3362677_3363628_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_019248926.1|3363726_3364800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010931475.1|3364967_3365762_+	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010925795.1|3365801_3366326_-	DUF934 domain-containing protein	NA	NA	NA	NA	NA
WP_010931474.1|3366318_3368061_-	nitrite/sulfite reductase	NA	NA	NA	NA	NA
WP_010931473.1|3368270_3369029_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	24.4	4.4e-14
WP_010931472.1|3369031_3369739_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	25.4	8.2e-07
WP_014905407.1|3369755_3370637_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_019247734.1|3370647_3371406_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_019248554.1|3371374_3372130_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010931468.1|3372199_3373618_+	amidase	NA	NA	NA	NA	NA
WP_003819076.1|3373639_3374290_-	carbonic anhydrase	NA	NA	NA	NA	NA
WP_033446132.1|3374423_3374759_-	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_005015810.1|3374847_3375798_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931467.1|3375874_3377695_+	DNA helicase RecQ	NA	L7RCS0	Acanthamoeba_polyphaga_moumouvirus	35.3	3.1e-74
WP_010931466.1|3377699_3378773_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.7	2.3e-08
WP_003814230.1|3378895_3379864_+	threo-3-hydroxy-L-aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_010927008.1|3379937_3380849_+	complex I NDUFA9 subunit family protein	NA	NA	NA	NA	NA
WP_003814226.1|3380867_3381440_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_010931465.1|3381520_3382069_-	crossover junction endodeoxyribonuclease RuvC	NA	NA	NA	NA	NA
WP_010931464.1|3382068_3383658_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.2	8.7e-65
WP_003814221.1|3383727_3383967_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_023995141.1|3384007_3385033_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
>prophage 26
NZ_CP017403	Bordetella pertussis strain 509 chromosome, complete genome	4140370	3390357	3452596	4140370	protease,transposase	uncultured_Mediterranean_phage(40.0%)	54	NA	NA
WP_005013747.1|3390357_3391308_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931401.1|3391406_3392357_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814206.1|3392617_3393712_+	porin	NA	NA	NA	NA	NA
WP_033446149.1|3393802_3394675_+	cytochrome c oxidase assembly protein	NA	NA	NA	NA	NA
WP_003814203.1|3394696_3395536_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	48.9	1.1e-66
WP_010931459.1|3395611_3397129_+|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_010931458.1|3397225_3398326_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_010931457.1|3398342_3398765_-	SnoaL-like domain-containing protein	NA	NA	NA	NA	NA
WP_003814195.1|3398787_3399000_-	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_010931456.1|3399046_3399967_-	branched-chain amino acid transaminase	NA	NA	NA	NA	NA
WP_010931455.1|3400149_3400899_+	AzlC family ABC transporter permease	NA	NA	NA	NA	NA
WP_003814188.1|3400901_3401231_+	AzlD domain-containing protein	NA	NA	NA	NA	NA
WP_033446148.1|3401518_3402871_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	34.4	2.1e-51
WP_003814185.1|3402882_3403266_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_010931453.1|3403327_3404128_+	EI24 domain-containing protein	NA	NA	NA	NA	NA
WP_005015810.1|3404226_3405177_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931477.1|3405232_3406045_+	competence/damage-inducible protein A	NA	NA	NA	NA	NA
WP_003814178.1|3406203_3407052_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_019248367.1|3407252_3411647_+	dermonecrotic toxin	NA	NA	NA	NA	NA
WP_010931479.1|3411740_3412718_-	tripartite tricarboxylate transporter substrate binding protein BugD	NA	NA	NA	NA	NA
WP_003814172.1|3413104_3413683_+	TIGR01841 family phasin	NA	NA	NA	NA	NA
WP_010931480.1|3413830_3414880_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_033446151.1|3414920_3415646_-	arginyltransferase	NA	NA	NA	NA	NA
WP_003814161.1|3416449_3417031_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_010931482.1|3417027_3417939_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003820995.1|3418054_3418456_+	DoxX family protein	NA	NA	NA	NA	NA
WP_010927005.1|3418473_3419076_-	DUF2946 family protein	NA	NA	NA	NA	NA
WP_003814152.1|3419133_3419517_-	membrane protein	NA	NA	NA	NA	NA
WP_005012067.1|3420215_3421166_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931483.1|3421314_3422025_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010931484.1|3422096_3423758_-	thiamine pyrophosphate-binding protein	NA	NA	NA	NA	NA
WP_010931485.1|3423832_3424798_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_003808542.1|3424852_3425761_-	TauD/TfdA family dioxygenase	NA	NA	NA	NA	NA
WP_039249903.1|3426067_3428356_-	NADP-dependent malic enzyme	NA	NA	NA	NA	NA
WP_010931487.1|3428497_3429469_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010929956.1|3429508_3430459_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931488.1|3430769_3431711_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003808549.1|3431710_3432544_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_010931489.1|3432547_3434398_+	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.2	1.6e-17
WP_010931490.1|3436077_3437613_+	M81 family metallopeptidase	NA	NA	NA	NA	NA
WP_010931491.1|3437706_3438648_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010931492.1|3438758_3439559_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003808562.1|3439620_3440127_-	SRPBCC family protein	NA	NA	NA	NA	NA
WP_003808563.1|3440123_3440462_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_010931493.1|3440890_3443410_+	AsmA family protein	NA	NA	NA	NA	NA
WP_003808567.1|3443406_3443793_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010931494.1|3443800_3444934_-	benzoate/H(+) symporter BenE family transporter	NA	NA	NA	NA	NA
WP_003808570.1|3444997_3445249_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	53.4	1.6e-18
WP_003808574.1|3445303_3445813_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	42.1	1.2e-28
WP_003808577.1|3445833_3446454_-	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_023853086.1|3446529_3447633_+	signal recognition particle-docking protein FtsY	NA	NA	NA	NA	NA
WP_010931496.1|3449461_3450283_-	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_033446133.1|3450279_3451170_-	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_010931070.1|3451645_3452596_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 27
NZ_CP017403	Bordetella pertussis strain 509 chromosome, complete genome	4140370	3565845	3619665	4140370	tail,tRNA,transposase	uncultured_Caudovirales_phage(23.53%)	59	NA	NA
WP_010930179.1|3565845_3566796_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929827.1|3566912_3567980_+	linear amide C-N hydrolase	NA	NA	NA	NA	NA
WP_010929828.1|3568055_3571184_-	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
WP_033446197.1|3571751_3572657_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_010929830.1|3572659_3573331_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_010929831.1|3573487_3574447_+	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_003821340.1|3574454_3575117_+	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_010929956.1|3575113_3576064_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931442.1|3576738_3576990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019247789.1|3577052_3577535_+	hypothetical protein	NA	A0A2H4JE38	uncultured_Caudovirales_phage	37.1	1.8e-13
WP_010931440.1|3577536_3577737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010931439.1|3577736_3578132_+	hypothetical protein	NA	A0A2D2W284	Stenotrophomonas_phage	35.0	7.8e-07
WP_010931438.1|3578128_3578527_+	hypothetical protein	NA	I6PCW1	Cronobacter_phage	38.0	4.2e-16
WP_010931437.1|3578523_3578946_+	DUF4128 domain-containing protein	NA	NA	NA	NA	NA
WP_010931436.1|3578953_3579454_+	HNH endonuclease	NA	A0A1I9SEX5	Klebsiella_phage	45.1	4.4e-31
WP_010931435.1|3579708_3580227_+	hypothetical protein	NA	A0A1S5R1H0	Pseudomonas_phage	38.3	5.4e-24
WP_003813412.1|3580236_3580566_+	hypothetical protein	NA	A0A2H4J121	uncultured_Caudovirales_phage	44.0	2.9e-15
WP_010931434.1|3580583_3580874_+	DUF1799 domain-containing protein	NA	A0A2H4JBP7	uncultured_Caudovirales_phage	45.2	3.7e-14
WP_010931433.1|3580899_3583512_+|tail	phage tail tape measure protein	tail	A0A2H4J107	uncultured_Caudovirales_phage	38.6	4.9e-105
WP_010931432.1|3583521_3583881_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010931431.1|3583948_3584482_+	DUF1833 family protein	NA	A5A3Q9	Burkholderia_phage	46.9	1.1e-40
WP_010931430.1|3584478_3584868_+	C40 family peptidase	NA	A0A0G3EYJ9	Achromobacter_phage	50.0	3.0e-35
WP_010931429.1|3584860_3588817_+	DUF1983 domain-containing protein	NA	A0A0B5A1N2	Achromobacter_phage	40.8	3.9e-215
WP_010931428.1|3588821_3589238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_124740660.1|3589218_3589416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010926428.1|3589456_3589720_+	hypothetical protein	NA	A0A1B0V3F2	Roseobacter_phage	41.8	7.2e-09
WP_010931426.1|3589719_3590532_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010931425.1|3590536_3590779_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010931424.1|3590757_3591309_+	lysozyme	NA	NA	NA	NA	NA
WP_010931423.1|3591308_3591824_+	DUF2514 family protein	NA	NA	NA	NA	NA
WP_010926433.1|3591820_3592102_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010931422.1|3592101_3592323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010931421.1|3592651_3593323_-	SOS response-associated peptidase	NA	Q5QF62	Pseudomonas_virus	39.9	4.7e-36
WP_010931420.1|3593678_3594365_-	response regulator	NA	NA	NA	NA	NA
WP_003814635.1|3594345_3594918_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_003814636.1|3594983_3596714_+|tRNA	proline--tRNA ligase	tRNA	A0A2K9L3R9	Tupanvirus	29.4	4.6e-11
WP_010931419.1|3596766_3597195_+	tol-pal system-associated acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_003814641.1|3597197_3597878_+	protein TolQ	NA	NA	NA	NA	NA
WP_003814643.1|3597877_3598336_+	protein TolR	NA	NA	NA	NA	NA
WP_010931418.1|3598372_3599347_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_010931417.1|3599363_3600680_+	Tol-Pal system protein TolB	NA	NA	NA	NA	NA
WP_003814650.1|3600711_3601209_+	peptidoglycan-associated lipoprotein Pal	NA	NA	NA	NA	NA
WP_003814652.1|3601295_3601985_+	tol-pal system protein YbgF	NA	NA	NA	NA	NA
WP_010931416.1|3601984_3603034_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_003814657.1|3603030_3603825_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.6	2.4e-15
WP_019247923.1|3603993_3604344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019247922.1|3604319_3604877_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_039249767.1|3606006_3607005_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_033446233.1|3606967_3607402_+	carbon monoxide dehydrogenase	NA	NA	NA	NA	NA
WP_010929974.1|3608918_3609803_+	DMT family transporter	NA	NA	NA	NA	NA
WP_033461521.1|3609799_3610027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005015810.1|3610044_3610995_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_077598842.1|3610974_3612054_-	cardiolipin synthase ClsB	NA	NA	NA	NA	NA
WP_010929972.1|3612050_3612911_-	endonuclease	NA	NA	NA	NA	NA
WP_003807038.1|3613023_3614814_-|tRNA	aspartate--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	25.5	6.5e-08
WP_023852857.1|3614854_3615505_-	DUF502 domain-containing protein	NA	A0A2I7S9X1	Vibrio_phage	28.4	8.6e-11
WP_010929971.1|3615520_3615829_-	FmdB family transcriptional regulator	NA	NA	NA	NA	NA
WP_010929970.1|3615994_3617281_-	membrane protein	NA	NA	NA	NA	NA
WP_005012067.1|3618714_3619665_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 29
NZ_CP017403	Bordetella pertussis strain 509 chromosome, complete genome	4140370	3856690	3911760	4140370	protease,tRNA,transposase	Bacillus_phage(28.57%)	47	NA	NA
WP_003815821.1|3856690_3857140_+|protease	ClpXP protease specificity-enhancing factor	protease	NA	NA	NA	NA
WP_010929719.1|3857658_3857799_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010929718.1|3857806_3857968_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_076879590.1|3858043_3858259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|3858245_3859196_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929717.1|3860239_3860518_-	DUF4148 domain-containing protein	NA	NA	NA	NA	NA
WP_010929716.1|3861660_3862209_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	43.1	1.3e-28
WP_010929715.1|3862271_3863951_-	thiol reductant ABC exporter subunit CydC	NA	W8CYL7	Bacillus_phage	27.6	3.6e-16
WP_010929714.1|3863947_3865699_-	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	23.8	3.4e-09
WP_003817696.1|3865695_3865821_-	cytochrome bd-I oxidase subunit CydX	NA	NA	NA	NA	NA
WP_004567834.1|3865834_3866989_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_023852659.1|3867004_3868582_-	cytochrome d ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_010929712.1|3868707_3869253_-	GbsR/MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005012067.1|3869812_3870763_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929711.1|3871493_3872474_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010929710.1|3872487_3873612_+	CoA transferase	NA	NA	NA	NA	NA
WP_003814321.1|3873619_3875374_-	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_010929709.1|3875480_3876380_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003814324.1|3876444_3877428_-	tripartite tricarboxylate transporter substrate binding protein BugE	NA	NA	NA	NA	NA
WP_010929708.1|3877563_3878544_+	AEC family transporter	NA	NA	NA	NA	NA
WP_010929707.1|3878560_3879952_-	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_010929706.1|3880103_3880640_+|tRNA	bifunctional alanine racemase/tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_019247543.1|3880570_3881956_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A2H4JCM7	uncultured_Caudovirales_phage	30.3	4.5e-17
WP_033446171.1|3882098_3882719_-	membrane protein	NA	NA	NA	NA	NA
WP_033461782.1|3882823_3884713_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	32.8	2.5e-79
WP_003814337.1|3884709_3885651_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_003814339.1|3885756_3886806_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	43.6	5.6e-68
WP_010929704.1|3887058_3887760_+	DnaA regulatory inactivator Hda	NA	NA	NA	NA	NA
WP_010929703.1|3887756_3888455_+	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_010929702.1|3888455_3889811_+	polynucleotide adenylyltransferase PcnB	NA	A0A1B1IVF3	uncultured_Mediterranean_phage	36.8	3.4e-25
WP_010929701.1|3889807_3890299_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_003814351.1|3890317_3891274_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_003814355.1|3892684_3894787_-	TRAP transporter large permease subunit	NA	NA	NA	NA	NA
WP_003814356.1|3894957_3896001_+	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003814358.1|3896044_3896788_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003814363.1|3897809_3898220_-	4-carboxymuconolactone decarboxylase	NA	NA	NA	NA	NA
WP_010929700.1|3899169_3899967_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_005012808.1|3900065_3901016_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_039251057.1|3900988_3901930_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012067.1|3901926_3902877_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929681.1|3902991_3903993_-	HindIII family type II restriction endonuclease	NA	NA	NA	NA	NA
WP_010929682.1|3904083_3904650_-	preprotein translocase subunit SecD	NA	NA	NA	NA	NA
WP_010929683.1|3904968_3906882_+	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_010929684.1|3906923_3908354_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_019247308.1|3908466_3909879_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_003818947.1|3909895_3910591_-	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005012067.1|3910809_3911760_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 30
NZ_CP017403	Bordetella pertussis strain 509 chromosome, complete genome	4140370	4042652	4115973	4140370	protease,transposase	uncultured_Mediterranean_phage(16.67%)	55	NA	NA
WP_005012067.1|4042652_4043603_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931563.1|4043599_4044790_-	voltage-gated potassium channel protein	NA	NA	NA	NA	NA
WP_010931562.1|4044911_4045676_-	phytanoyl-CoA dioxygenase	NA	NA	NA	NA	NA
WP_003807735.1|4045762_4046866_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_010930158.1|4047057_4048074_-|transposase	IS110-like element IS1663 family transposase	transposase	NA	NA	NA	NA
WP_003815102.1|4048355_4048844_+	D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	34.1	1.6e-17
WP_003817656.1|4050187_4050868_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	34.8	3.5e-15
WP_010931560.1|4050929_4051781_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_010931559.1|4051777_4052575_-	thiazole synthase	NA	NA	NA	NA	NA
WP_010931558.1|4052678_4053572_-	cobalamin-binding protein	NA	NA	NA	NA	NA
WP_010931557.1|4053583_4055473_-	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	30.8	7.6e-07
WP_010931556.1|4055809_4059583_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	50.8	8.6e-10
WP_005012067.1|4059579_4060530_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929826.1|4060838_4061531_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	41.6	6.3e-36
WP_003818232.1|4061904_4062405_-	SET domain-containing protein	NA	NA	NA	NA	NA
WP_023853391.1|4062511_4063432_+	bestrophin	NA	NA	NA	NA	NA
WP_010929823.1|4063448_4063925_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_023853380.1|4064027_4065869_+	biosynthetic-type acetolactate synthase large subunit	NA	E4WLQ6	Ostreococcus_tauri_virus	30.4	2.2e-59
WP_010929821.1|4065924_4066683_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010929820.1|4066710_4068144_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_003818225.1|4068217_4068997_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010929819.1|4069009_4069843_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_020699616.1|4069851_4070622_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.9	8.1e-24
WP_010929818.1|4070621_4071686_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010929817.1|4071837_4074465_-	DNA topoisomerase III	NA	A0A0G2YA05	Acanthamoeba_polyphaga_mimivirus	25.4	6.1e-23
WP_010929816.1|4074528_4077150_+	DUF4401 domain-containing protein	NA	NA	NA	NA	NA
WP_003815964.1|4078077_4078536_-	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_010929815.1|4078814_4081058_-	TonB-dependent hemoglobin/transferrin/lactoferrin family receptor	NA	NA	NA	NA	NA
WP_010929814.1|4081254_4083279_-	TRAP transporter permease	NA	NA	NA	NA	NA
WP_019248007.1|4083402_4084365_-	TAXI family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_010929812.1|4084576_4085716_+	DSD1 family PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_010929811.1|4085738_4086704_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_004565905.1|4086899_4088090_+	acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	26.7	4.4e-21
WP_003815955.1|4088103_4088349_+	DUF1653 domain-containing protein	NA	NA	NA	NA	NA
WP_010929810.1|4088377_4090399_-	acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha	NA	NA	NA	NA	NA
WP_003815953.1|4090445_4092053_-	methylcrotonoyl-CoA carboxylase	NA	A0A1B2ITV7	Pike_perch_iridovirus	57.3	5.4e-22
WP_010929808.1|4092153_4093323_-	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
WP_005013747.1|4096204_4097155_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929699.1|4097311_4097635_+	phosphate starvation-inducible protein	NA	NA	NA	NA	NA
WP_023853200.1|4097739_4098780_-	cyclase	NA	NA	NA	NA	NA
WP_010929697.1|4098785_4099565_-	3-oxoadipate enol-lactonase	NA	NA	NA	NA	NA
WP_003807672.1|4099610_4099907_-	YciI family protein	NA	NA	NA	NA	NA
WP_003807674.1|4099932_4100208_-	muconolactone Delta-isomerase	NA	NA	NA	NA	NA
WP_003819086.1|4100264_4100909_-	CoA transferase subunit B	NA	NA	NA	NA	NA
WP_010929696.1|4100908_4101595_-	3-oxoacid CoA-transferase subunit A	NA	NA	NA	NA	NA
WP_033446325.1|4101793_4102576_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010929694.1|4102626_4103352_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010929693.1|4103383_4104733_-	short-chain fatty acid transporter	NA	NA	NA	NA	NA
WP_010929692.1|4104844_4105777_-	3-hydroxyacyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_033454003.1|4106234_4109030_-|protease	serine protease autotransporter SphB1	protease	NA	NA	NA	NA
WP_023994893.1|4109623_4112467_-	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_010929689.1|4112637_4113357_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A0A0RPC6	Escherichia_phage	43.9	8.0e-50
WP_010929688.1|4113395_4113944_-	N-acetyltransferase	NA	A0A2H4J136	uncultured_Caudovirales_phage	41.7	1.2e-21
WP_019248089.1|4114098_4114998_+	virginiamycin B lyase	NA	NA	NA	NA	NA
WP_005012808.1|4115022_4115973_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
