The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP017421	Arthrobacter sp. ZXY-2 chromosome, complete genome	4495402	1422304	1474772	4495402	protease,transposase,integrase	Enterobacteria_phage(25.0%)	45	1416698:1416715	1466487:1466504
1416698:1416715	attL	GAAGCGATAGACGAGTCA	NA	NA	NA	NA
WP_084798139.1|1422304_1424248_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	H6X3M6	Enterobacteria_phage	31.6	1.5e-63
WP_133830737.1|1424355_1424565_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071416451.1|1424893_1427683_+	ATP-dependent helicase	NA	Q331U3	Clostridium_botulinum_C_phage	21.9	8.5e-15
WP_071416452.1|1427789_1428410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071416453.1|1428472_1429414_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071416454.1|1429450_1430152_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071416455.1|1430154_1430418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071416456.1|1430414_1430699_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071416457.1|1430727_1431222_+	hypothetical protein	NA	A0A2D1GMZ4	Pseudoalteromonas_phage	36.1	2.6e-15
WP_071416458.1|1431379_1431751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071416459.1|1431743_1432250_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071416460.1|1432334_1432646_+	hypothetical protein	NA	NA	NA	NA	NA
WP_056387422.1|1432642_1432900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156783999.1|1432970_1433792_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071416462.1|1433778_1434252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071416464.1|1434681_1435032_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_071416465.1|1435129_1436230_+	ACR3 family arsenite efflux transporter	NA	NA	NA	NA	NA
WP_071416466.1|1436275_1436950_+	metalloregulator ArsR/SmtB family transcription factor	NA	NA	NA	NA	NA
WP_071416467.1|1437086_1437509_+	arsenate reductase ArsC	NA	A0A2H4PQT9	Staphylococcus_phage	37.3	7.8e-13
WP_071416468.1|1437541_1438543_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	53.6	1.1e-78
WP_071416469.1|1438724_1440107_+	NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_071416470.1|1440160_1440817_+	arsenate reductase ArsC	NA	NA	NA	NA	NA
WP_071416471.1|1440816_1441233_+	low molecular weight phosphatase family protein	NA	NA	NA	NA	NA
WP_071416472.1|1441548_1443072_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	52.4	3.9e-123
WP_071416473.1|1443250_1443631_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_071416474.1|1443901_1444303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079941738.1|1444299_1446345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079941737.1|1446341_1447967_-	hypothetical protein	NA	NA	NA	NA	NA
WP_084798168.1|1448071_1449478_-|integrase	integrase	integrase	NA	NA	NA	NA
WP_084798140.1|1449642_1449993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156784000.1|1450088_1451267_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_084798142.1|1451263_1453789_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_071416478.1|1453775_1454342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071416479.1|1454462_1454900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156784001.1|1455289_1456507_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_071416481.1|1456506_1457295_+	DNA replication protein	NA	U5N3V8	Enterobacteria_phage	42.4	2.5e-49
WP_156784002.1|1457335_1457527_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071416483.1|1457638_1458013_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071416746.1|1458222_1458594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071416484.1|1458703_1459069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071416485.1|1459099_1460854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071416486.1|1460855_1466417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071416487.1|1466583_1470678_-	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
1466487:1466504	attR	GAAGCGATAGACGAGTCA	NA	NA	NA	NA
WP_156784003.1|1470803_1472924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071416489.1|1473005_1474772_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A2I7REQ1	Vibrio_phage	27.0	3.1e-39
>prophage 2
NZ_CP017421	Arthrobacter sp. ZXY-2 chromosome, complete genome	4495402	2575601	2596594	4495402	protease,portal,head,capsid	Arthrobacter_phage(26.32%)	29	NA	NA
WP_071416587.1|2575601_2576351_+	hypothetical protein	NA	G1BND3	Mycobacterium_phage	42.5	6.0e-32
WP_071416588.1|2576343_2576904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071416589.1|2576900_2577257_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071416590.1|2577283_2577619_+	hypothetical protein	NA	A0A222ZFU2	Arthrobacter_phage	59.2	9.2e-33
WP_071416756.1|2577645_2578584_+	hypothetical protein	NA	A0A0S2SXP3	Bacillus_phage	45.2	1.6e-45
WP_071416591.1|2578705_2579446_+	hypothetical protein	NA	A0A2H4J580	uncultured_Caudovirales_phage	37.3	5.0e-23
WP_071416592.1|2579442_2580678_+	AAA family ATPase	NA	A0A1P8VV42	Rathayibacter_phage	33.7	4.7e-58
WP_071416593.1|2580671_2580911_+	glutaredoxin-like protein NrdH	NA	V5UN81	Mycobacterium_phage	47.9	3.4e-13
WP_071416594.1|2580913_2581438_+	single-stranded DNA-binding protein	NA	A0A222Z8A5	Arthrobacter_phage	89.7	6.9e-51
WP_071416595.1|2581434_2581764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071416596.1|2581760_2581940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071416597.1|2581933_2582527_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071416598.1|2582899_2583184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071416757.1|2583311_2583578_+	hypothetical protein	NA	A0A1W6JQA3	Corynebacterium_phage	53.1	6.6e-18
WP_071416600.1|2584010_2584364_+	hypothetical protein	NA	A0A173G9F3	Propionibacterium_phage	44.6	7.2e-12
WP_084798149.1|2584323_2585925_+	hypothetical protein	NA	A0A1D8ETA8	Propionibacterium_phage	46.4	3.4e-125
WP_071416601.1|2585927_2587442_+|portal	phage portal protein	portal	A0A1I9SDX0	Arthrobacter_phage	42.4	3.0e-107
WP_071416602.1|2587441_2588203_+|head,protease	HK97 family phage prohead protease	head,protease	A0A142K7E0	Mycobacterium_phage	45.9	2.1e-48
WP_071416603.1|2588220_2589447_+|capsid	phage major capsid protein	capsid	A0A222ZHH0	Arthrobacter_phage	52.8	1.2e-98
WP_071416604.1|2589514_2589736_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071416605.1|2589754_2590279_+	hypothetical protein	NA	A0A1D8ETD3	Propionibacterium_phage	41.8	2.3e-30
WP_071416606.1|2590278_2590629_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071416607.1|2590628_2590901_+	HK97 gp10 family phage protein	NA	A0A1P8VV83	Rathayibacter_phage	54.5	1.0e-18
WP_071416608.1|2590893_2591319_+	hypothetical protein	NA	A0A1P8VV86	Rathayibacter_phage	34.7	1.5e-08
WP_071416609.1|2591385_2592216_+	hypothetical protein	NA	A0A1P8VV84	Rathayibacter_phage	30.9	6.7e-16
WP_071416610.1|2592309_2592621_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071416611.1|2592677_2592995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071416612.1|2593005_2595825_+	hypothetical protein	NA	A0A2R3ZZQ3	Microbacterium_phage	39.5	5.0e-47
WP_071416613.1|2595817_2596594_+	hypothetical protein	NA	A0A222ZEP0	Arthrobacter_phage	31.3	4.8e-24
>prophage 3
NZ_CP017421	Arthrobacter sp. ZXY-2 chromosome, complete genome	4495402	3139543	3147049	4495402		Bacillus_phage(16.67%)	8	NA	NA
WP_021473670.1|3139543_3140989_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	29.7	8.9e-24
WP_021473671.1|3141094_3141385_+	WXG100 family type VII secretion target	NA	NA	NA	NA	NA
WP_021473672.1|3141590_3142631_-	ribonuclease HI family protein	NA	A0A142CJN1	Brazilian_marseillevirus	36.6	1.8e-18
WP_071416649.1|3142861_3144487_-	chaperonin GroEL	NA	A0A240F779	uncultured_virus	54.2	1.3e-148
WP_031216907.1|3144785_3144989_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	58.2	1.4e-15
WP_021473675.1|3145167_3145788_-	LytR C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_021473676.1|3145837_3146173_-	DUF3263 domain-containing protein	NA	A0A0A7RXU7	Mycobacterium_phage	51.5	9.9e-11
WP_021473677.1|3146281_3147049_+	uracil-DNA glycosylase	NA	A0A0A8IL23	Epstein-Barr_virus	39.7	2.0e-27
>prophage 4
NZ_CP017421	Arthrobacter sp. ZXY-2 chromosome, complete genome	4495402	3883281	3932833	4495402	transposase,protease,tRNA	Lysinibacillus_phage(18.18%)	34	NA	NA
WP_071416326.1|3883281_3884571_-|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	22.2	6.1e-08
WP_021471353.1|3884830_3885016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021471354.1|3885025_3886483_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_021471355.1|3886620_3887130_-	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_071416669.1|3887382_3889500_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_021471357.1|3889550_3890765_-	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
WP_021471358.1|3890898_3893391_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	K4FB40	Cronobacter_phage	41.3	5.6e-135
WP_021471359.1|3893566_3893893_-	Lsr2 family protein	NA	A0A222ZMT6	Mycobacterium_phage	38.5	3.1e-09
WP_021471361.1|3894196_3895726_-|tRNA	lysine--tRNA ligase	tRNA	A0A2K9KZX5	Tupanvirus	37.0	6.2e-76
WP_021471362.1|3895782_3896673_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_021471363.1|3896683_3897538_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_021471364.1|3897596_3898430_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_021474818.1|3904468_3905362_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_021474817.1|3905492_3906866_+	MFS transporter	NA	NA	NA	NA	NA
WP_021474816.1|3906895_3907327_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_021474815.1|3907335_3908193_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	40.5	5.2e-48
WP_021474814.1|3908283_3908607_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_021474838.1|3909609_3910857_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	36.8	1.0e-36
WP_071416326.1|3914350_3915640_+|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	22.2	6.1e-08
WP_021474245.1|3917843_3919322_-	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_021474244.1|3919424_3920327_-	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_021474243.1|3920332_3921259_-	DUF2520 domain-containing protein	NA	NA	NA	NA	NA
WP_031217125.1|3921251_3922781_-	PH domain-containing protein	NA	NA	NA	NA	NA
WP_021474241.1|3922789_3923302_-	PH domain-containing protein	NA	NA	NA	NA	NA
WP_021474240.1|3923282_3923807_-	DUF3180 domain-containing protein	NA	NA	NA	NA	NA
WP_021474239.1|3923810_3924350_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_021474238.1|3924346_3924706_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_021474237.1|3924717_3925623_-	dihydropteroate synthase	NA	S4VNV0	Pandoravirus	32.6	6.1e-23
WP_031217124.1|3925630_3926263_-	GTP cyclohydrolase I FolE	NA	E7DN69	Pneumococcus_phage	57.3	7.3e-47
WP_021474235.1|3926273_3928343_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	A0A0P0CDP4	Ostreococcus_lucimarinus_virus	40.9	1.2e-90
WP_021474234.1|3928826_3929840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021474233.1|3929991_3930543_-	hypoxanthine phosphoribosyltransferase	NA	A0A1V0SEQ1	Hokovirus	34.0	6.6e-12
WP_031217123.1|3930572_3931631_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_021474231.1|3931711_3932833_-|protease	zinc-dependent metalloprotease	protease	NA	NA	NA	NA
>prophage 1
NZ_CP017422	Arthrobacter sp. ZXY-2 plasmid pZXY21, complete sequence	288370	119273	181928	288370	integrase,transposase	Leptospira_phage(16.67%)	53	119133:119160	123881:123908
119133:119160	attL	TGTCATTTTCAGAAGCTGACGGCACAAA	NA	NA	NA	NA
WP_021474737.1|119273_120959_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	M4T586	Rhodobacter_phage	26.8	5.5e-09
WP_043427059.1|120961_121870_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_021474735.1|121866_122814_+	TniQ family protein	NA	NA	NA	NA	NA
WP_021474734.1|123293_123536_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021474733.1|124083_124347_+	glutaredoxin family protein	NA	A0A2D1GL80	Mycobacterium_phage	40.8	3.6e-08
123881:123908	attR	TTTGTGCCGTCAGCTTCTGAAAATGACA	NA	NA	NA	NA
WP_021474732.1|124343_125108_+	single-stranded DNA-binding protein	NA	A0A286N316	Arthrobacter_phage	47.9	6.8e-23
WP_031217359.1|125124_125364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021474730.1|125717_126071_-	VOC family protein	NA	NA	NA	NA	NA
WP_021474729.1|126512_126824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021474728.1|126856_127507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021474727.1|127831_128137_+	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
WP_071416786.1|128141_129758_+	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_071416787.1|129786_131019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021474766.1|131063_131510_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021474765.1|131727_132420_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021474764.1|132688_133357_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021474763.1|133694_134285_-	SLATT domain-containing protein	NA	NA	NA	NA	NA
WP_152343102.1|134833_135931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021474760.1|136594_137254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021474759.1|137250_138111_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156784043.1|138733_139880_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.2	3.0e-35
WP_071416789.1|140860_142093_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152343075.1|142157_142739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021474533.1|142817_143411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_084798175.1|143798_144434_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_021474531.1|144713_145880_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_021474530.1|146107_146797_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_021474529.1|146789_147605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021474528.1|147591_147810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021474527.1|148083_149079_-	HNH endonuclease	NA	A0A161HSS2	Gordonia_phage	38.9	2.3e-07
WP_031217266.1|150104_150674_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_082038892.1|150729_152151_-	APC family permease	NA	NA	NA	NA	NA
WP_031217263.1|152658_154035_-	FAD-binding oxidoreductase	NA	S4VRT3	Pandoravirus	32.7	1.1e-23
WP_082038893.1|154748_156083_+	APC family permease	NA	NA	NA	NA	NA
WP_021474522.1|156348_156654_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_017200503.1|161070_162120_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.6	7.6e-17
WP_083848075.1|162116_163028_-	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_082038923.1|162954_163794_-	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_021474519.1|163753_164221_-	molybdenum cofactor biosynthesis protein MoaE	NA	NA	NA	NA	NA
WP_031217257.1|164333_164840_-	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_082038922.1|164836_166192_-	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_043427502.1|166433_167534_+	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
WP_017200510.1|167540_167807_+	MoaD/ThiS family protein	NA	NA	NA	NA	NA
WP_071416162.1|168962_169751_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	32.7	8.5e-13
WP_071416791.1|169747_171190_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_016359465.1|171529_172381_+	xanthine dehydrogenase family protein subunit M	NA	NA	NA	NA	NA
WP_026005772.1|172377_172875_+	(2Fe-2S)-binding protein	NA	A0A0P0IVM8	Acinetobacter_phage	43.1	7.8e-20
WP_071416792.1|172867_175318_+	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	NA	NA	NA	NA
WP_016359462.1|175385_176663_+	(S)-6-hydroxynicotine oxidase	NA	NA	NA	NA	NA
WP_071416326.1|176772_178062_-|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	22.4	6.3e-05
WP_156784043.1|178794_179942_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.2	3.0e-35
WP_071416793.1|180340_180565_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071416326.1|180638_181928_+|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	22.4	6.3e-05
