The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP013019	Clostridium pasteurianum strain M150B, complete genome	4351863	201572	272277	4351863	tRNA,protease,transposase,coat	Pandoravirus(20.0%)	57	NA	NA
WP_003440504.1|201572_202514_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003440507.1|202942_206047_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2I2L3Y0	Orpheovirus	35.3	4.8e-184
WP_003440509.1|206279_207278_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_003440511.1|207364_207949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003440514.1|208040_208445_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003440516.1|208720_209650_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003440519.1|209764_210046_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003440522.1|210395_210581_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087946533.1|210917_211064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155760344.1|211161_211335_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003440545.1|213829_215353_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_003440548.1|215432_215627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003440551.1|217271_218549_-	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_003440556.1|218624_219383_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_003440571.1|219560_223613_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_003440573.1|223704_224277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003440576.1|224483_226478_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	23.0	3.4e-05
WP_003440580.1|226501_227725_+	peptidase T	NA	NA	NA	NA	NA
WP_003440583.1|227729_228092_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_003440585.1|228588_230778_+	DNA topoisomerase III	NA	A0A1V0SCS0	Indivirus	26.6	1.1e-25
WP_003440587.1|230959_231643_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_144311755.1|231639_233052_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_003440593.1|233294_233858_+	GTP cyclohydrolase I FolE	NA	E7DN69	Pneumococcus_phage	44.9	3.3e-35
WP_003440596.1|233896_234382_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_003440599.1|234451_235261_+	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	31.6	9.4e-23
WP_003440602.1|235262_236090_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	S4VNV0	Pandoravirus	36.2	1.4e-13
WP_087946534.1|236086_236503_-	YibE/F family protein	NA	NA	NA	NA	NA
WP_003440606.1|236472_237210_-	class B sortase	NA	NA	NA	NA	NA
WP_003440607.1|237482_238748_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_003440614.1|238789_239506_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.4	5.9e-37
WP_003440617.1|239502_240699_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_034830476.1|240721_241696_+	glycosyltransferase family 2 protein	NA	M1FQW5	Enterobacteria_phage	41.3	2.8e-50
WP_003440623.1|241865_242642_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003440625.1|242871_243780_+	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_003440628.1|243784_245086_+	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_003440630.1|245066_245903_+	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_003440633.1|246494_247874_+	radical SAM protein	NA	NA	NA	NA	NA
WP_003440637.1|248189_249455_+	carbohydrate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003440640.1|249709_250852_-	glycosyltransferase family 4 protein	NA	A0A1X9SKE5	Sulfolobus_islandicus_rod-shaped_virus	26.8	4.3e-05
WP_003440641.1|251007_252018_+|coat	CotS family spore coat protein	coat	NA	NA	NA	NA
WP_003440642.1|252026_252239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003440643.1|252245_253004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003440644.1|253146_254175_+|coat	CotS family spore coat protein	coat	NA	NA	NA	NA
WP_071167541.1|255705_256833_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_003440649.1|257016_258021_+|coat	CotS family spore coat protein	coat	NA	NA	NA	NA
WP_003440652.1|258135_259116_+	sporulation peptidase YabG	NA	NA	NA	NA	NA
WP_003440655.1|259361_259598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003440657.1|260108_261671_+	DUF3794 domain-containing protein	NA	NA	NA	NA	NA
WP_003440660.1|261806_262649_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_003440664.1|262766_263651_-	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_003440666.1|264165_264579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003440668.1|264729_265845_+	stage II sporulation protein R	NA	NA	NA	NA	NA
WP_003440673.1|265873_267037_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_003440676.1|267333_268707_+	germination protein YpeB	NA	NA	NA	NA	NA
WP_003440679.1|268898_269930_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_003440682.1|270124_270541_+	DUF1934 domain-containing protein	NA	NA	NA	NA	NA
WP_034830312.1|270648_272277_+|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	30.6	4.3e-51
>prophage 2
NZ_CP013019	Clostridium pasteurianum strain M150B, complete genome	4351863	2061095	2069420	4351863		uncultured_Mediterranean_phage(42.86%)	8	NA	NA
WP_003444245.1|2061095_2061974_+	site-specific tyrosine recombinase XerD	NA	A0A1B1IQT7	uncultured_Mediterranean_phage	25.8	6.0e-15
WP_003444249.1|2062057_2063224_+	phosphopentomutase	NA	NA	NA	NA	NA
WP_003444257.1|2063236_2064052_+	purine-nucleoside phosphorylase	NA	Q5YBA4	Grouper_iridovirus	41.7	1.8e-53
WP_003444259.1|2064134_2064953_+	purine-nucleoside phosphorylase	NA	Q5YBA4	Grouper_iridovirus	47.5	3.3e-60
WP_003444261.1|2064971_2066273_+	pyrimidine-nucleoside phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	62.5	5.9e-144
WP_003444263.1|2066452_2067664_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	32.0	5.7e-32
WP_003444265.1|2068081_2068840_+	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	23.6	1.4e-07
WP_143756574.1|2068826_2069420_+	segregation/condensation protein B	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	37.3	1.1e-20
>prophage 3
NZ_CP013019	Clostridium pasteurianum strain M150B, complete genome	4351863	2085237	2135119	4351863	protease,transposase,coat,integrase,tRNA,bacteriocin	Paenibacillus_phage(22.22%)	42	2113349:2113364	2116520:2116535
WP_003444313.1|2085237_2086290_+|coat	CotS family spore coat protein	coat	NA	NA	NA	NA
WP_003444314.1|2086464_2087337_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_155760368.1|2087403_2087550_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003444315.1|2088008_2089340_+|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_003444316.1|2089384_2092012_+	DNA mismatch repair protein MutS	NA	A0A1V0SDQ0	Indivirus	27.5	3.2e-56
WP_003444318.1|2092087_2093980_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	36.5	2.1e-81
WP_034830709.1|2094118_2095057_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_003444321.1|2095160_2095409_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_003444325.1|2096153_2097275_+	iron-molybdenum cofactor biosynthesis protein	NA	NA	NA	NA	NA
WP_003444327.1|2097437_2098715_+	methionine gamma-lyase family protein	NA	NA	NA	NA	NA
WP_003444329.1|2098876_2099488_-	transcriptional repressor LexA	NA	A0A0N9RTK0	Paenibacillus_phage	39.7	1.9e-12
WP_003444331.1|2099744_2100308_-|protease	tesA-like protease	protease	NA	NA	NA	NA
WP_003444332.1|2100392_2100647_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003444335.1|2101083_2101764_+	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_003444338.1|2101818_2102694_+	lipoyl synthase	NA	NA	NA	NA	NA
WP_003444339.1|2102969_2104904_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_003444341.1|2105186_2106170_+	thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha	NA	E3SJ83	Synechococcus_phage	25.7	1.1e-09
WP_003444343.1|2106171_2107146_+	alpha-ketoacid dehydrogenase subunit beta	NA	NA	NA	NA	NA
WP_003444345.1|2107193_2108510_+	2-oxo acid dehydrogenase subunit E2	NA	NA	NA	NA	NA
WP_003444347.1|2108523_2109915_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	30.9	1.8e-53
WP_003444349.1|2110176_2110752_+	arylesterase	NA	NA	NA	NA	NA
WP_003444351.1|2111075_2111486_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003444353.1|2111603_2112593_-	tyrosine recombinase XerC	NA	A0A2R2ZHE2	Clostridioides_phage	26.3	8.8e-15
2113349:2113364	attL	AAAAAGTCAAATTATT	NA	NA	NA	NA
WP_003448320.1|2113551_2114358_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_034829662.1|2114373_2115633_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_155760369.1|2118233_2118383_+	hypothetical protein	NA	NA	NA	NA	NA
2116520:2116535	attR	AATAATTTGACTTTTT	NA	NA	NA	NA
WP_003442373.1|2118823_2120044_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003442371.1|2120057_2121179_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_003442369.1|2121423_2122260_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_051035245.1|2122272_2123136_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_003442365.1|2123164_2123677_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003442364.1|2123697_2125059_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_034830050.1|2125362_2125668_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003442362.1|2125989_2127381_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_003442361.1|2127492_2129337_-	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	24.0	4.3e-15
WP_143756567.1|2129417_2129612_-|bacteriocin	CA_C0660 family putative sactipeptide bacteriocin	bacteriocin	NA	NA	NA	NA
WP_003442358.1|2129702_2131064_-	insulinase family protein	NA	A0A2K9LA15	Tupanvirus	26.4	1.3e-13
WP_034830048.1|2131073_2132639_-	radical SAM protein	NA	NA	NA	NA	NA
WP_087946539.1|2132956_2133100_+	cyclic lactone autoinducer peptide	NA	NA	NA	NA	NA
WP_003442354.1|2133101_2133728_-	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_076719024.1|2133821_2134109_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_143756622.1|2134198_2135119_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	21.6	9.3e-11
>prophage 4
NZ_CP013019	Clostridium pasteurianum strain M150B, complete genome	4351863	2551962	2608863	4351863	transposase,integrase,portal,terminase,tail,tRNA,capsid,head	Bacillus_phage(23.81%)	59	2598190:2598209	2611522:2611541
WP_003441319.1|2551962_2552700_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_003441315.1|2552885_2553410_+	rubrerythrin	NA	NA	NA	NA	NA
WP_003441311.1|2553522_2554878_-	nitrogenase	NA	NA	NA	NA	NA
WP_003441308.1|2554914_2556465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003441306.1|2556980_2558732_-	DUF4153 domain-containing protein	NA	NA	NA	NA	NA
WP_034829996.1|2559003_2559147_-	aspartyl-phosphate phosphatase Spo0E family protein	NA	NA	NA	NA	NA
WP_003441304.1|2559565_2560348_+	hypothetical protein	NA	U5Q0C0	Bacillus_phage	65.3	6.9e-39
WP_080751556.1|2560493_2561897_-	diguanylate cyclase	NA	G3MA91	Bacillus_virus	41.9	3.0e-16
WP_003441298.1|2562658_2563240_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003441294.1|2563735_2564572_-	ABC transporter	NA	NA	NA	NA	NA
WP_003441290.1|2564578_2565493_-	ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	27.3	5.6e-16
WP_003441287.1|2565794_2566916_-	DUF4885 domain-containing protein	NA	NA	NA	NA	NA
WP_003441284.1|2566961_2567849_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003440352.1|2568622_2569918_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_003441281.1|2570084_2570672_-	nitroreductase family protein	NA	NA	NA	NA	NA
WP_003441277.1|2571287_2572454_+	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_003441274.1|2572523_2572889_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003441270.1|2573265_2573784_-	VanZ family protein	NA	NA	NA	NA	NA
WP_003441264.1|2574318_2574639_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_003441259.1|2574838_2575108_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003444845.1|2575123_2576350_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_003441250.1|2577053_2578262_-	response regulator	NA	NA	NA	NA	NA
WP_003441247.1|2578275_2578722_-	response regulator	NA	NA	NA	NA	NA
WP_003441244.1|2578696_2582182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003441241.1|2582233_2582404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003441238.1|2582475_2584041_-	Site-specific DNA recombinase	NA	NA	NA	NA	NA
WP_155760376.1|2584123_2584264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003441235.1|2584394_2585810_-	hypothetical protein	NA	Q0H227	Geobacillus_phage	27.5	6.9e-21
WP_003441232.1|2585826_2587455_-	phage-like protein	NA	A0A0A7RUI9	Clostridium_phage	38.7	2.1e-50
WP_003441229.1|2587454_2588156_-	phage-like protein	NA	A0A0A7RWN1	Clostridium_phage	39.3	6.2e-39
WP_003441227.1|2588155_2590015_-	hypothetical protein	NA	M4QNS0	Tetraselmis_viridis_virus	24.6	7.2e-18
WP_152414171.1|2590014_2590293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003441221.1|2590352_2590688_-	hypothetical protein	NA	A0A0U4KKN8	Bacillus_phage	33.3	1.2e-05
WP_003441218.1|2590814_2591384_-	hypothetical protein	NA	A0A0U4IS63	Bacillus_phage	40.6	8.8e-36
WP_003441216.1|2591401_2591776_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003441214.1|2591777_2592116_-	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
WP_003441209.1|2592105_2592408_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003441207.1|2592412_2592709_-|head,tail	phage head-tail connector protein	head,tail	NA	NA	NA	NA
WP_003441204.1|2592718_2592904_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003441203.1|2592989_2594039_-|capsid	phage capsid protein	capsid	S5MNB6	Brevibacillus_phage	72.2	2.1e-144
WP_003441202.1|2594060_2594444_-	hypothetical protein	NA	A0A0K2CNR0	Brevibacillus_phage	62.2	3.5e-36
WP_003441201.1|2594460_2595018_-	DUF4355 domain-containing protein	NA	NA	NA	NA	NA
WP_034829991.1|2595300_2595756_-	hypothetical protein	NA	A6N234	Microbacterium_phage	48.6	1.7e-18
WP_003441199.1|2595838_2596255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155760556.1|2596581_2596923_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003441190.1|2596885_2597785_-|head	phage head morphogenesis protein	head	S5M601	Brevibacillus_phage	30.0	8.2e-20
WP_003441188.1|2597771_2599049_-|portal	phage portal protein	portal	A0A1V0DZW8	Clostridioides_phage	35.3	5.6e-62
2598190:2598209	attL	TTTTCAATATTATTTAGTTC	NA	NA	NA	NA
WP_003441184.1|2599110_2599530_-	protein export chaperone secb	NA	NA	NA	NA	NA
WP_003441180.1|2599526_2599994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003441177.1|2599999_2600419_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034829988.1|2600491_2602042_-|terminase	phage terminase large subunit	terminase	A0A0N7AEF1	Bacillus_phage	35.6	9.7e-77
WP_003441172.1|2602211_2603261_+	AAA family ATPase	NA	Q7M293	Enterobacteria_phage	30.6	1.6e-27
WP_003441170.1|2603290_2604136_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0E3M2X0	Bacillus_phage	28.9	3.5e-20
WP_003441168.1|2604320_2605025_-	hypothetical protein	NA	A0A2H4JAE2	uncultured_Caudovirales_phage	47.9	1.9e-24
WP_003441166.1|2605077_2605740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003441163.1|2605862_2606285_-	gamma-glutamylcyclotransferase	NA	G3MAQ5	Bacillus_virus	35.6	4.0e-17
WP_003441161.1|2606355_2607264_-	hypothetical protein	NA	A0A2K9V489	Faecalibacterium_phage	45.5	6.9e-67
WP_003441158.1|2607352_2607622_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003441156.1|2607618_2608863_-	DNA modification methylase	NA	E4ZFL4	Streptococcus_phage	50.7	1.8e-121
2611522:2611541	attR	TTTTCAATATTATTTAGTTC	NA	NA	NA	NA
>prophage 5
NZ_CP013019	Clostridium pasteurianum strain M150B, complete genome	4351863	2646499	2660872	4351863		Synechococcus_phage(33.33%)	10	NA	NA
WP_003447551.1|2646499_2648002_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	43.8	2.5e-61
WP_003447550.1|2648390_2649008_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	36.6	1.5e-20
WP_003447549.1|2648995_2649991_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	M4QRQ6	Synechococcus_phage	45.1	2.1e-64
WP_003447548.1|2650011_2651421_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.8	2.0e-57
WP_003447546.1|2651446_2652157_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FUQ7	Synechococcus_phage	43.7	5.3e-46
WP_003447544.1|2652156_2652636_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	49.4	1.9e-31
WP_003447542.1|2653235_2656997_-	phosphoribosylformylglycinamidine synthase	NA	A6N228	Microbacterium_phage	24.1	1.3e-34
WP_003447540.1|2657209_2657734_+	tryptophan transporter	NA	NA	NA	NA	NA
WP_003447538.1|2658040_2658412_+	helix-turn-helix transcriptional regulator	NA	E4ZFI8	Streptococcus_phage	32.7	1.7e-11
WP_003447537.1|2658586_2660872_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	33.6	7.5e-110
>prophage 6
NZ_CP013019	Clostridium pasteurianum strain M150B, complete genome	4351863	2828041	2884352	4351863	tRNA,protease,transposase	Bacillus_phage(21.43%)	47	NA	NA
WP_051803910.1|2828041_2829370_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_003442552.1|2830444_2831602_-	hypothetical protein	NA	A0A1B3AYT3	Gordonia_phage	28.7	3.0e-22
WP_003442554.1|2834367_2834916_-	O-acetyl-ADP-ribose deacetylase	NA	A0A0K1L687	Scale_drop_disease_virus	45.2	8.8e-33
WP_003442556.1|2835099_2835882_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003442558.1|2835997_2836369_-	lactoylglutathione lyase	NA	NA	NA	NA	NA
WP_003442561.1|2836624_2837365_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_003442563.1|2837477_2837741_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003442565.1|2837959_2838850_-	DUF2156 domain-containing protein	NA	NA	NA	NA	NA
WP_003442574.1|2839040_2839874_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_003442575.1|2839951_2840695_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_003442578.1|2840726_2841830_-	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_003442590.1|2841965_2843078_-	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_003442592.1|2843291_2843510_-	DUF3892 domain-containing protein	NA	NA	NA	NA	NA
WP_003442595.1|2843618_2844266_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_071167516.1|2844538_2845219_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_003442599.1|2845386_2846412_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003442602.1|2846422_2847451_-	hypothetical protein	NA	A0A1P8CWN9	Bacillus_phage	26.9	1.2e-09
WP_003442605.1|2847593_2848634_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003442608.1|2848651_2849734_-	hypothetical protein	NA	A0A291LB83	Escherichia_phage	37.2	4.5e-12
WP_003442611.1|2850055_2851432_-	PhoH family protein	NA	A0A141HS37	Bacillus_phage	48.0	9.7e-121
WP_003442614.1|2851905_2852334_+	transcriptional repressor	NA	NA	NA	NA	NA
WP_003442617.1|2852448_2853399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003441259.1|2853566_2853836_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003444845.1|2853851_2855078_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_003442620.1|2855401_2855986_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_003442623.1|2855966_2858309_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	43.6	9.9e-174
WP_003442626.1|2858432_2860109_-|protease	ATP-dependent protease LonB	protease	A0A167RA83	Powai_lake_megavirus	33.1	1.0e-15
WP_003442629.1|2860255_2861560_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	58.4	1.4e-140
WP_003442632.1|2861579_2862164_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	56.2	4.8e-53
WP_003442635.1|2862287_2863583_-	trigger factor	NA	NA	NA	NA	NA
WP_003442639.1|2863806_2864589_-	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_003442642.1|2864612_2865404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003442644.1|2865806_2868995_-	carbamoyl-phosphate synthase (glutamine-hydrolyzing) large subunit	NA	NA	NA	NA	NA
WP_003442647.1|2869104_2870190_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	35.0	1.5e-55
WP_003442650.1|2870535_2872053_-	M1 family metallopeptidase	NA	NA	NA	NA	NA
WP_003442654.1|2872264_2872846_-	orotate phosphoribosyltransferase	NA	Q58MW1	Prochlorococcus_phage	31.0	6.3e-05
WP_003442657.1|2872991_2873891_-	dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_003442660.1|2873883_2874624_-	dihydroorotate dehydrogenase electron transfer subunit	NA	NA	NA	NA	NA
WP_003442668.1|2874808_2875672_-	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_003442670.1|2875683_2876871_-	dihydroorotase	NA	NA	NA	NA	NA
WP_003442673.1|2877086_2877509_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_003442675.1|2877509_2878433_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	39.7	1.7e-52
WP_003442677.1|2878905_2879511_+	DedA family protein	NA	NA	NA	NA	NA
WP_003442679.1|2879688_2880261_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_003442680.1|2880303_2882043_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	34.1	3.4e-62
WP_003442685.1|2882314_2882518_+	alpha/beta-type small acid-soluble spore protein	NA	NA	NA	NA	NA
WP_034829948.1|2882723_2884352_-|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	30.6	2.5e-51
>prophage 7
NZ_CP013019	Clostridium pasteurianum strain M150B, complete genome	4351863	3682734	3750921	4351863	protease,transposase,portal,terminase,tail,capsid,head	Clostridium_phage(52.94%)	61	NA	NA
WP_003444845.1|3682734_3683961_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_051035266.1|3684079_3684847_+	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	37.1	3.2e-20
WP_003446396.1|3684992_3686063_-	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_003446394.1|3686257_3686950_-	molecular chaperone TorD family protein	NA	NA	NA	NA	NA
WP_003446392.1|3686951_3687923_-	DMSO reductase anchor subunit	NA	NA	NA	NA	NA
WP_003446391.1|3687926_3688508_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	44.0	7.1e-49
WP_003446387.1|3688688_3691358_-	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	28.2	1.6e-82
WP_003446386.1|3691670_3694055_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	39.0	1.1e-143
WP_003446383.1|3694344_3694566_-	NifU family protein	NA	NA	NA	NA	NA
WP_003446380.1|3694751_3695168_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003446377.1|3695445_3696081_-	flavodoxin family protein	NA	NA	NA	NA	NA
WP_003446375.1|3696325_3696667_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003446371.1|3697138_3698647_-	glycoside hydrolase family 32 protein	NA	NA	NA	NA	NA
WP_071167531.1|3698671_3699520_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_003446368.1|3699522_3700464_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_003446367.1|3700699_3702016_-	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003446366.1|3702130_3703108_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_003446365.1|3703406_3704378_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_003446364.1|3704481_3705336_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003446363.1|3705769_3706597_+	PHP domain-containing protein	NA	NA	NA	NA	NA
WP_003446362.1|3706693_3706888_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003446005.1|3712756_3713233_+	NAD(P)H-dependent oxidoreductase subunit E	NA	NA	NA	NA	NA
WP_003446003.1|3713358_3714114_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_003446001.1|3714110_3714857_-	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	NA	NA	NA	NA
WP_003446000.1|3714883_3715405_-	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_087946548.1|3715407_3717285_-	anaerobic carbon-monoxide dehydrogenase catalytic subunit	NA	NA	NA	NA	NA
WP_003445998.1|3717340_3719182_-	NADH-quinone oxidoreductase subunit NuoF	NA	NA	NA	NA	NA
WP_003445997.1|3719559_3720192_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_003445996.1|3720560_3720734_-	NADH:ubiquinone oxidoreductase NADH-binding (51 kD) subunit	NA	NA	NA	NA	NA
WP_003445995.1|3721069_3721846_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_003445993.1|3722610_3722901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080751534.1|3723216_3723678_+	LysE family transporter	NA	NA	NA	NA	NA
WP_003445989.1|3723684_3724083_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003445982.1|3724079_3724493_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003445981.1|3725885_3726431_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_034829853.1|3726949_3727306_+	four-helix bundle copper-binding protein	NA	NA	NA	NA	NA
WP_003445979.1|3728041_3729073_-	Cfr family 23S rRNA (adenine(2503)-C(8))-methyltransferase	NA	NA	NA	NA	NA
WP_003445978.1|3729228_3730713_-	Lsa family ABC-F type ribosomal protection protein	NA	A0A2K9L3Z8	Tupanvirus	26.6	1.1e-24
WP_003445977.1|3732254_3732464_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081387060.1|3732637_3733057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003445973.1|3733474_3733699_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076719123.1|3733721_3735596_-	hypothetical protein	NA	H7BV46	unidentified_phage	28.3	3.0e-24
WP_003445971.1|3735778_3736156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003445969.1|3736134_3736551_-	HEPN domain-containing protein	NA	NA	NA	NA	NA
WP_003445967.1|3736883_3737180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003445965.1|3737197_3739039_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003445964.1|3739097_3739808_-	lj928 prophage protein	NA	A0A286QN36	Streptococcus_phage	29.1	1.9e-19
WP_003445963.1|3739808_3742373_-|tail	minor tail protein	tail	A0A1L2BYA6	Clostridium_phage	45.4	3.8e-70
WP_034830073.1|3742594_3742894_-	hypothetical protein	NA	A0A1L2BYA4	Clostridium_phage	40.2	4.7e-12
WP_003445960.1|3742947_3743523_-|tail	phi13 family phage major tail protein	tail	A0A1L2BYA0	Clostridium_phage	58.9	2.2e-58
WP_003445958.1|3743543_3743876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003445955.1|3743878_3744262_-	HK97 gp10 family phage protein	NA	E2ELI9	Clostridium_phage	38.8	1.1e-16
WP_003445954.1|3744261_3744621_-|head	phage head closure protein	head	NA	NA	NA	NA
WP_003445953.1|3744621_3744912_-|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_003445952.1|3744958_3746053_-|capsid	phage major capsid protein	capsid	I2E8V4	Clostridium_phage	53.6	2.3e-96
WP_003445951.1|3746111_3746711_-|head,protease	HK97 family phage prohead protease	head,protease	D7PQ42	Enterococcus_phage	40.9	4.9e-29
WP_003445950.1|3746715_3747933_-|portal	phage portal protein	portal	I2E8V3	Clostridium_phage	41.5	9.6e-80
WP_003445949.1|3747933_3748137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003445948.1|3748153_3749839_-|terminase	terminase large subunit	terminase	A0A0A7RUM0	Clostridium_phage	52.0	8.4e-167
WP_003445945.1|3749838_3750297_-|terminase	phage terminase small subunit P27 family	terminase	A0A0A7RUQ4	Clostridium_phage	62.7	4.3e-41
WP_003445944.1|3750486_3750921_-	hypothetical protein	NA	Q0SPJ9	Clostridium_phage	36.6	4.7e-13
>prophage 8
NZ_CP013019	Clostridium pasteurianum strain M150B, complete genome	4351863	4024401	4081721	4351863	tRNA,transposase,holin,coat	Streptococcus_phage(18.75%)	56	NA	NA
WP_003447818.1|4024401_4024578_+|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
WP_034830606.1|4024688_4026242_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_003447816.1|4026325_4026514_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034830604.1|4026599_4027370_+	ATPase AAA	NA	U5N3V8	Enterobacteria_phage	38.1	4.9e-37
WP_003447612.1|4028985_4029663_-	YIP1 family protein	NA	NA	NA	NA	NA
WP_003447614.1|4029694_4030072_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003447615.1|4030101_4031289_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_003447617.1|4031285_4031972_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.8	2.0e-34
WP_003447619.1|4031949_4033002_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_155760402.1|4033126_4033291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080751536.1|4033280_4033964_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	29.9	1.5e-13
WP_003447623.1|4033971_4034472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003447630.1|4036383_4036704_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003447632.1|4037320_4038673_+	[Fe] hydrogenase	NA	NA	NA	NA	NA
WP_003447635.1|4038866_4039388_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_003447637.1|4039444_4040098_+	HAD family phosphatase	NA	NA	NA	NA	NA
WP_003447638.1|4040290_4040731_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003447640.1|4040777_4042334_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	27.6	7.8e-50
WP_003447643.1|4042454_4043165_-	2-phosphosulfolactate phosphatase family protein	NA	NA	NA	NA	NA
WP_003447646.1|4043289_4044240_-	PucR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003447648.1|4044251_4045361_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	Q6GZ03	Mycoplasma_phage	31.8	1.4e-21
WP_143756599.1|4045455_4046385_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	43.9	1.7e-31
WP_003447653.1|4046481_4047639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003447655.1|4047895_4048942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003447656.1|4049027_4049927_+	radical SAM protein	NA	NA	NA	NA	NA
WP_003447659.1|4050068_4051868_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	28.3	1.0e-05
WP_003447661.1|4051887_4052562_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003447663.1|4052567_4052954_-	DUF3783 domain-containing protein	NA	NA	NA	NA	NA
WP_003447665.1|4053009_4053525_-	peptidylprolyl isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	43.9	3.5e-23
WP_003447666.1|4053677_4054457_-	glutamate racemase	NA	NA	NA	NA	NA
WP_003447667.1|4054880_4056968_+	glutamine synthetase	NA	NA	NA	NA	NA
WP_003447668.1|4057061_4057868_-	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	37.6	1.0e-37
WP_003447669.1|4058038_4058839_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	47.8	4.2e-60
WP_003447670.1|4058867_4060124_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	53.3	5.0e-108
WP_034830663.1|4060200_4060455_+	DUF4491 family protein	NA	NA	NA	NA	NA
WP_003447672.1|4060540_4061932_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	36.0	1.3e-83
WP_003447673.1|4062309_4064151_+	asparagine synthase (glutamine-hydrolyzing)	NA	R4TIC1	Phaeocystis_globosa_virus	25.5	2.9e-27
WP_003447684.1|4064203_4064368_-	rubredoxin	NA	NA	NA	NA	NA
WP_003447686.1|4064580_4065117_-	peroxiredoxin	NA	NA	NA	NA	NA
WP_003447688.1|4065171_4065399_-	NrdH-redoxin	NA	NA	NA	NA	NA
WP_003447690.1|4065400_4066327_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	40.7	2.6e-61
WP_003447691.1|4066679_4066976_+|coat	spore coat associated protein CotJA	coat	NA	NA	NA	NA
WP_003447692.1|4066996_4067269_+|coat	spore coat protein CotJB	coat	NA	NA	NA	NA
WP_003447694.1|4067299_4067872_+	manganese catalase family protein	NA	NA	NA	NA	NA
WP_003447696.1|4068075_4068615_-	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_143756635.1|4068619_4069186_-	type 1 glutamine amidotransferase	NA	NA	NA	NA	NA
WP_080751537.1|4069296_4069482_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155760404.1|4069615_4069780_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003447703.1|4069929_4071318_-	Fe-only nitrogenase subunit beta	NA	NA	NA	NA	NA
WP_003447705.1|4071333_4071684_-	Fe-only nitrogenase subunit delta	NA	NA	NA	NA	NA
WP_003447707.1|4071699_4073277_-	nitrogenase iron-iron protein, alpha chain	NA	NA	NA	NA	NA
WP_003440352.1|4073685_4074981_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_003447709.1|4075166_4075994_-	nitrogenase iron protein	NA	NA	NA	NA	NA
WP_003447711.1|4077083_4078841_-	ATP-dependent RNA helicase	NA	A0A248SJQ0	Salicola_phage	31.7	2.5e-60
WP_003447713.1|4079016_4080591_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_143756600.1|4080590_4081721_-|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	Q6GZ03	Mycoplasma_phage	44.2	2.6e-18
>prophage 9
NZ_CP013019	Clostridium pasteurianum strain M150B, complete genome	4351863	4268568	4324904	4351863	protease,transposase,integrase,terminase,holin	Clostridium_phage(81.58%)	58	4287811:4287828	4334243:4334260
WP_080751542.1|4268568_4269039_+|integrase	site-specific integrase	integrase	A0A0A8WF01	Clostridium_phage	31.6	6.9e-10
WP_080751543.1|4269059_4269257_+|integrase	tyrosine-type recombinase/integrase	integrase	X5JB41	Clostridium_phage	48.3	1.7e-07
WP_003445019.1|4269576_4270893_-	High affinity gluconate/L-idonate permease	NA	NA	NA	NA	NA
WP_003445018.1|4271303_4273022_-	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
WP_003445017.1|4273284_4274601_-	High affinity gluconate/L-idonate permease	NA	NA	NA	NA	NA
WP_003445015.1|4275020_4275698_-	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003445014.1|4275723_4276743_-	sugar kinase	NA	NA	NA	NA	NA
WP_003445013.1|4276761_4277406_-	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_003445012.1|4277648_4278413_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003445011.1|4278790_4279231_+	Hsp20/alpha crystallin family protein	NA	A0A218MMV3	uncultured_virus	31.1	1.6e-05
WP_003445010.1|4279863_4280361_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003445009.1|4280415_4281399_-	cell wall hydrolase/autolysin	NA	A0A0A7RUJ1	Clostridium_phage	42.2	2.0e-35
WP_003445002.1|4281417_4281807_-|holin	phage holin family protein	holin	A0A0A7S099	Clostridium_phage	56.7	9.6e-34
WP_003445000.1|4281849_4288752_-	hypothetical protein	NA	M9Q2I5	Clostridium_phage	39.7	1.2e-62
4287811:4287828	attL	ATAATTAATACTGTTGGA	NA	NA	NA	NA
WP_003444998.1|4288778_4289156_-	hypothetical protein	NA	M9Q2L1	Clostridium_phage	47.2	1.7e-22
WP_034830556.1|4289221_4289491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003444994.1|4289670_4290018_-	hypothetical protein	NA	M9Q2F8	Clostridium_phage	58.3	6.8e-31
WP_003444992.1|4290028_4294156_-	transglycosylase SLT domain-containing protein	NA	M9Q251	Clostridium_phage	46.7	7.5e-100
WP_003444989.1|4294196_4294616_-	hypothetical protein	NA	M9Q2L2	Clostridium_phage	60.9	5.9e-21
WP_034830554.1|4294676_4294985_-	bacteriophage Gp15 protein	NA	M9Q2I4	Clostridium_phage	73.3	8.7e-38
WP_003444987.1|4294999_4295329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003444986.1|4295350_4295806_-	hypothetical protein	NA	M9Q1I1	Clostridium_phage	59.7	1.1e-47
WP_003444985.1|4295816_4296203_-	hypothetical protein	NA	M9Q2F6	Clostridium_phage	68.0	2.6e-47
WP_003444984.1|4296202_4296586_-	hypothetical protein	NA	M9Q249	Clostridium_phage	64.6	8.3e-38
WP_003444983.1|4296585_4296912_-	hypothetical protein	NA	M9Q2I3	Clostridium_phage	54.3	4.1e-30
WP_003444966.1|4296920_4297280_-	hypothetical protein	NA	M9Q2K9	Clostridium_phage	56.7	3.7e-32
WP_003444957.1|4297282_4297570_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003444955.1|4297580_4298546_-	hypothetical protein	NA	A0A1J0MCK3	Streptomyces_phage	55.2	4.4e-88
WP_003444953.1|4298561_4299161_-	minor structural GP20 protein	NA	S5MUG0	Brevibacillus_phage	42.6	2.9e-29
WP_143756604.1|4299446_4299647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003444947.1|4299657_4299900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003444945.1|4299967_4300291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003444943.1|4301926_4303432_-	hypothetical protein	NA	M9Q246	Clostridium_phage	63.0	1.3e-182
WP_034830630.1|4303434_4304826_-|terminase	phage terminase large subunit	terminase	A0A090EUA8	Clostridium_phage	72.9	2.0e-198
WP_034830628.1|4304818_4305340_-|transposase	transposase	transposase	A0A0A7RTH0	Clostridium_phage	73.3	2.0e-58
WP_003444940.1|4305556_4306105_-	hypothetical protein	NA	I2E8Y5	Clostridium_phage	30.2	8.6e-12
WP_003444939.1|4306117_4307482_-	DEAD/DEAH box helicase	NA	A0A1S7FYY5	Listeria_phage	62.1	1.7e-162
WP_003444938.1|4307478_4307757_-	VRR-NUC domain-containing protein	NA	A0A2K5B272	Erysipelothrix_phage	52.2	3.1e-18
WP_034830627.1|4308028_4310416_-	phage-like protein	NA	A0A0A7RTG3	Clostridium_phage	79.8	0.0e+00
WP_155760405.1|4310489_4310636_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003444933.1|4310915_4311941_-	nucleoid-associated protein	NA	J9QE81	Clostridium_phage	33.1	2.1e-43
WP_003444932.1|4311955_4313914_-	DNA polymerase	NA	A0A0A7RTL3	Clostridium_phage	78.2	0.0e+00
WP_003444931.1|4313918_4314479_-	DUF2815 family protein	NA	A0A0A7RVM4	Clostridium_phage	84.9	4.4e-88
WP_003444930.1|4314600_4315764_-	DUF2800 domain-containing protein	NA	A0A0A7S066	Clostridium_phage	66.8	6.2e-145
WP_003444929.1|4315765_4316215_-	hypothetical protein	NA	A0A0A7RTD8	Clostridium_phage	32.3	1.6e-08
WP_003444928.1|4316250_4316511_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003444927.1|4316524_4316986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003444925.1|4317306_4317918_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_003444924.1|4317904_4318171_-	sporulation transcriptional regulator SpoIIID	NA	M9Q261	Clostridium_phage	49.3	8.4e-13
WP_003444922.1|4318301_4318544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003444920.1|4318577_4318718_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003444918.1|4318883_4319051_-	hypothetical protein	NA	Q8SBM7	Clostridium_phage	64.2	8.9e-13
WP_003444916.1|4319067_4319316_-	helix-turn-helix transcriptional regulator	NA	Q8SBM9	Clostridium_phage	59.7	4.4e-16
WP_003444915.1|4319502_4319943_+	helix-turn-helix transcriptional regulator	NA	Q8SBN0	Clostridium_phage	57.8	7.3e-22
WP_003444914.1|4319976_4320438_+	hypothetical protein	NA	A0A0A7RVV2	Clostridium_phage	57.9	2.6e-46
WP_003444913.1|4320529_4321579_+|integrase	site-specific integrase	integrase	Q8SBN2	Clostridium_phage	63.8	1.1e-127
WP_003444912.1|4321650_4322982_-	replicative DNA helicase	NA	O80281	Escherichia_phage	47.7	4.2e-105
WP_003444911.1|4323005_4324904_-|protease	ATP-dependent protease, Lon family	protease	A0A0R6PGP8	Moraxella_phage	23.2	5.8e-23
4334243:4334260	attR	TCCAACAGTATTAATTAT	NA	NA	NA	NA
